The
N
-acetylglutamate synthase/
N
-acetylglutamate kinase
metabolon of
Saccharomyces cerevisiae
allows co-ordinated
feedback regulation of the first two steps in arginine biosynthesis
Katia Pauwels, Agnes Abadjieva, Pierre Hilven, Anna Stankiewicz and Marjolaine Crabeel
Department of Genetics and Microbiology of the Vrije Universiteit Brussel, Brussels, Belgium
In Saccharomyces cerevisiae, which uses the nonlinear
pathway of arginine biosynthesis, the first two enzymes,
N-acetylglutamate synthase (NAGS) and N-acetylglutamate
kinase (NAGK), are controlled by feedback inhibition. We
have previously shown that NAGS and NAGK associate in
a complex, essential to synthase activity and protein level
[Abadjieva, A., Pauwels, K., Hilven, P. & Crabeel, M. (2001)
J. Biol. Chem. 276, 42869–42880].
The NAGKs of ascomycetes possess, in addition to the
catalytic domain that is shared by all other NAGKs and
whose structure has been determined, a C-terminal domain
of unknown function and structure. Exploring the role of
these two domains in the synthase/kinase interaction, we
demonstrate that the ascomycete-specific domain is required
to maintain synthase activity and protein level.
Previous results had suggested a participation of the third
enzyme of the pathway, N-acetylglutamylphosphate reduc-
tase, in the metabolon. Here, genetic analyses conducted in
yeast at physiological level, or in a heterologous background,
clearly demonstrate that the reductase is dispensable for
synthase activity and protein level.
Most importantly, we show that the arginine feedback
regulation of the NAGS and NAGK enzymes is mutually
interdependent. First, the kinase becomes less sensitive to
arginine feedback inhibition in the absence of the synthase.
Second, and as in Neurospora crassa, in a yeast kinase
mutant resistant to arginine feedback inhibition, the
synthase becomes feedback resistant concomitantly.
We conclude that the NAGS/NAGK metabolon pro-
motes the co-ordination of the catalytic activities and feed-
back regulation of the first two, flux controlling, enzymes of
the arginine pathway.
Keywords:yeast;N-acetylglutamate synthase; N-acetylglu-
tamate kinase; metabolon; co-ordinated feedback inhibition.
De novo arginine biosynthesis in plants and microorganisms
occurs in eight biochemical steps starting from glutamate. In
the fifth step of this pathway ornithine is generated from
N-acetylornithine. Two different ornithine synthesis reac-
tions can be distinguished. In the linear pathway, ornithine
is generated through the hydrolysis of N-acetylornithine. In
the cyclic pathway, the acetyl group of N-acetylornithine is
transferred to glutamate, thereby regenerating N-acetylglu-
tamate (Fig. 1). Because it avoids the acetyl-CoA consu-
ming initial step, catalysed by N-acetylglutamate synthase
(NAGS) (EC 2.3.1.1), the cyclic pathway is energetically
more favourable. However, an organism, which regenerates
N-acetylglutamate through ornithine synthesis, still requires
the synthase in order to ensure a constant level of acetylated
compounds during cell growth. Therefore an anaplerotic
role is attributed to acetylglutamate synthase in organisms
using the cyclic pathway of ornithine synthesis [1,2].
The linear pattern of ornithine synthesis is found in
Escherichia coli and some other bacteria and archea [1–5].
The cyclic pattern is more widespread among the procary-
otes [6–13], and it is observed in all investigated ascomyce-
tes, including Candida utilis [14], Saccharomyces cerevisiae
[15], Neurospora crassa [2], and in Chlamydomonas algae
[16]. In the fungi, ornithine synthesis proceeds entirely in the
mitochondria [17,18].
Control of the metabolic flux through a biosynthetic
pathway usually occurs at the level of the first committed
step and is often mediated by the end product of the
pathway. This classical mechanism operates in organisms
using the linear pathway of arginine synthesis: arginine
exerts feedback inhibition on N-acetylglutamate synthase in
E. coli and Salmonella typhimurium [19–21]. In pathways
where acetylglutamate is regenerated, the second enzyme of
arginine biosynthesis, N-acetylglutamate kinase (NAGK)
(EC 2.7.2.8) becomes the main controlling step. Feedback
inhibition of the kinase by arginine has been demonstrated
in several bacteria [7,22,23]. Yet, metabolic control should
occur on the production of acetylglutamate, regardless of its
origin. Therefore, feedback inhibition on both the synthase
and the kinase is believed to be general for organisms using
Correspondence to M. Crabeel, Department of Genetics and
Microbiology of the Vrije Universiteit Brussel, c/o CERIA-COOVI,
Emile Gryson avenue 1, B-1070 Brussels, Belgium.
Fax: + 32 2 526 72 73, Tel.: + 32 2 526 72 84,
E-mail: mcrabeel@vub.ac.be
Abbreviations:NAGS,N-acetylglutamate synthase; NAGK,
N-acetylglutamate kinase; NAGPR, N-acetylglutamylphosphate
reductase; CD, catalytic active domain; ASD, ascomycetes specific
domain.
Enzymes:N-acetylglutamate synthase (EC 2.3.1.1), N-acetylglutamate
kinase (EC 2.7.2.8), N-acetylglutamylphosphate reductase
(EC 1.2.1.38).
(Received 25 November 2002, revised 14 January 2003,
accepted 22 January 2003)
Eur. J. Biochem. 270, 1014–1024 (2003) FEBS 2003 doi:10.1046/j.1432-1033.2003.03477.x
cyclic ornithine synthesis. The feedback regulation of these
first two steps in the arginine pathway has been clearly
demonstrated in the bacterium Pseudomonas aeruginosa and
in two ascomycetes: S. cerevisiae and N. crassa [24–28].
In the latter two organisms, the control of the first two
steps of the arginine pathway includes an extra level of
complexity. Beside its own structural gene (ARG2),
N-acetylglutamate synthase activity also requires the yeast
ARG5,6 gene (arg-6 in N. crassa). The ARG5,6 and arg-6
genes encode each a polyprotein precursor which is
maturated in the mitochondrial matrix to N-acetylglu-
tamate kinase and N-acetylglutamylphosphate reductase
(NAGPR) (EC 1.2.1.38), catalysing, respectively, the sec-
ond and third step of arginine biosynthesis [29,30]. This
requirement of an extra gene for the synthase activity was
first observed in N. crassa, where cells containing some
nonsense mutants of the arg-6 gene displayed no detectable
synthase activity, despite the presence of an intact synthase
encoding gene (arg-14) [28,31]. An interaction between the
synthase and the kinase of N. crassa was demonstrated by
the yeast two-hybrid system (R. L. Weiss, S. K. Chae,
J. Chung, C. McKinstry, M. Karaman and G. Turner,
University of California, Los Angeles, CA, USA, personal
communication). Similar data in yeast were independently
obtained by our group [32]. An increase in synthase activity,
expected to result from higher copy numbers of its structural
gene ARG2, has only been observed with a parallel increase
in the ARG5,6 gene copy number. The yeast synthase/kinase
interaction was demonstrated by coimmunoprecipitation
methods [32].
The physical participation of reductase, the second mat-
urated gene product of ARG5,6, to the synthase/kinase com-
plex, has not been proven so far. Hence, it is not clear whether
synthase activity and protein level require reductase. How-
ever, the existence of mutations in the reductase-encoding
domain of the N. crassa arg-6 gene, which affect synthase
activity, suggests a possible role for the reductase [28,31].
Moreover, increasing the copy-number of a synthetic gene,
only encoding the kinase domain of S. cerevisiae ARG5,6
gene, is not sufficient to increase the activity of yeast NAGS
when coexpressed with high copy-number of ARG2 [32].
Another remarkable result, concerning the regulation of
the first enzymes of the arginine pathway, has been reported
by the team of R. L. Weiss. A series of ornithine-over-
producing N. crassa mutants [33], were mapped to the
N-terminus of N-acetylglutamate kinase and shown to bear
F81L modifications. The data suggest that this single
amino-acid modification of the kinase might result in the
deregulation of the first two enzyme activities of the arginine
pathway, leading to the hypothesis of a co-ordinated
feedback control (R. L. Weiss, S. K. Chae, J. Chung,
C. McKinstry, M. Karaman and G. Turner, University of
California, Los Angeles, CA, USA, personal communi-
cation).
The co-ordinated regulation of the first two enzymes of
the arginine pathway in ascomycetes seems to correlate with
some particular features of both the synthase and the kinase
genes. The ascomycete N-acetylglutamate synthase enco-
ding genes are conserved and appear evolutionarily not
related to the gene family encoding N-acetylglutamate
synthase in bacteria [32,34]. Recently, the murine and the
human genes encoding N-acetylglutamate synthase were
Fig. 1. Simplified scheme of the arginine biosynthesis pathway in
S. cerevisiae.Step 1 is catalysed by N-acetylglutamate synthase
(synthase), step 2 by N-acetylglutamate kinase (kinase), step 3 by
N-acetylglutamylphosphate reductase (reductase), and step 5 by
N-acetylornithine-glutamate acetyltransferase (acetyltransferase).
FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1015
characterized and shown to pertain to the same family as the
ascomycete synthase [35,36]. This apparent dual origin
of the synthases is in sharp contrast with the common
evolutionary relationship ascribed to all other genes
involved in the arginine biosynthesis in different organisms.
Amino-acid sequence alignments of known members of
the N-acetylglutamate kinase family illustrate conservation
over all three domains of living organisms (Bacteria,
Archaea, and Eucarya) of a region corresponding to the
E. coli NAGK, the only NAGK of known 3D structure
[37], representing the catalytic NAGK domain. However,
all the ascomycete N-acetylglutamate kinases characterized
to date, namely those of S. cerevisiae,Schizosaccharomyces
pombe,N. crassa,andCandida albicans, have two specific
features: (a) they are encoded together with NAGPR as a
bi-functional precursor protein that is processed into two
distinct enzymes in the mitochondria, and (b) they possess
an extra region of about 200 amino acids at their
C-terminus, that we call the ascomycete-specific domain
(ASD) [29,30]. It is tempting to speculate that the
ascomycete-specific domain (ASD) of the kinase might
play a role in formation of the synthase/kinase protein
complex.
This work investigates three important unsolved ques-
tions related to the structure and function of the yeast
NAGS/NAGK metabolon. We analyse (a) the role of the
reductase in the activity and protein level of the synthase, (b)
the role of the ASD of the kinase in its interaction with the
synthase, and (c) the significance of the yeast NAGS/
NAGK metabolon in terms of its co-ordinated feedback
regulation by arginine.
Experimental procedures
Strains and growth conditions
S. cerevisiae. The wild-type strain of this laboratory is
S1278b (Mat a). MG471 (Mat a, ura3–471) was directly
derived from S1278b by M. Grenson, Universiteit
Brussel, Belgium. The strains YeBR5 (Mat a, ura3–471,
Darg5::gen
R
), YeBR6 (Mat a, ura3–471, Darg6::gen
R
,
arg5
–
), and 14S31b (Mat a, ura3
–
,his3
–
) have been
described previously [32]. The construction of strain SS1
(Mat a,ura3–471, Darg3), derived from MG471, has been
described [38]. Strain KA44 (Mat a, ura3
–
,his3
–
,Darg2::
gen
R
) and strain KA42 (Mat a, ura3
–
,his3
–
,Darg5,6::gen
R
)
are derived from 14S31b and were constructed using A.
Wach’s method [39]: the genomic ARG2 ORF (KA44) or
the genomic ARG5,6 ORF (KA42) were replaced by the
kanMX4 cassette and the strains were selected on the basis
of their geneticin resistance. PCR analysis confirmed the
presence of the expected modification in those strains. SA2,
derived from MG471, was constructed using the delitto
perfetto system developed by Storici et al.[40].The
procedure allowed scarless removal of the NAGK encoding
ARG6 region from the chromosomal ARG5,6 gene (deletion
from amino acid 84–493 in the ORF encoding the kinase/
reductase precursor). The resulting ura3
–
,Darg6 mutant
strain can be restored to prototrophy by plasmid pYB7,
expressing ARG6 from a GAL promoter. This confirms
that, as expected, SA2 expresses active NAGPR from the
remaining ARG5 region of the ARG5,6 gene.
All yeast strains were grown at 30 ConM.ammedium,
a minimal medium containing 0.02
M
(NH
4
)
2
SO
4
,3%
glucose, vitamins, and trace minerals [41]. Where required,
uracil,
L
-histidine or
L
-arginine was added to a concentra-
tion of 25 lgÆmL
)1
. Genes which are transcriptionally
controlled by the GAL promoter were induced by growing
cells on M.gal medium (containing 2% galactose as the
carbon source) instead of the usual M.am medium
(containing 3% glucose). Arginine starved cells were
initially grown on medium containing arginine, centrifuged,
washed with water and resuspended in M.am medium
without arginine. Cells were starved for 3 h before
harvesting them.
E. coli. Strains XA4(argA
–
)andXC33(argC
–
)fromthe
laboratory of S. Baumberg have been described previously
[32]. Rosetta(DE3)(pRARE) is a commercial strain (Nov-
agen) in which the pRARE plasmid over-expresses tRNAs
for most rare E. coli codons.
E. coli strains were grown at 37 C on rich medium
supplemented with ampicillin (25 lgÆmL
)1
)andchloram-
phenicol (35 lgÆmL
)1
) where required. Cell cultures at a
D
600
of 0.600 were induced by addition of IPTG (2,5 m
M
)
and overnight incubation at 30 C.
Culture conditions for the spot tests: approximately 2 mL
of cells at D
600
of 0.250 grown on rich medium plus
ampicilline, were harvested by centrifugation, washed and
resuspended in minimal medium to a concentration of
10
10
cellsÆmL
)1
. Drops of 10 lL of 10-fold serial dilutions
(from 10
10
cellsÆmL
)1
to 10
5
cellsÆmL
)1
) were spotted on
minimal medium with or without arginine (100 lgÆmL
)1
),
and with or without IPTG (1 m
M
). Sets of four plates were
incubated at 37 C, 30 Cor25C.
Oligonucleotides
BY4, BY5: [32], HP72 ¼GTCTCACAACAACAATTGG
CTGTGATCAAGGTG. HP73 ¼CACCTTGATCACA
GCTAATTGTTGTTGTGAGAC. HP79 ¼CACACG
ACTTCACAAAATTTTCAACTAATTTGTAACCTCT
CCTGATCATAG. HP80 ¼CTATGATCAGGAGAGG
TTACAAATTAGTTGAAAATTTTGTGAAGTCGTG
GTG. HP81 ¼CACTAATTTGTAACCTCTCCTGAT
AACCTCTCTTTTTGTGCTGATATTG. HP82 ¼CAA
TATCAGCACAAAAAGAGAGGTTATCAGGAGAG
GTTACAAATTAGTG. AA29 ¼CGTCAGACCATGG
GGTGGAGGAGAATATTCGCGCATGAACTCAAG.
K1 ¼GGCCATGGTTTCATCTACTAACGGCTTTT
CAG. K2 ¼GGCCAAGCTTTCAACTACTTGCTGA
TGAGTTGAGGGTAG. K4 ¼GGCCTGCAGCTCAA
GGCGCACTCCCGTTCTG. K8 ¼GGCCTGCAGTCA
ATGATGATGATGATGATGTGAAATATTTTTTTCA
TTTTCCCAAC. K10 ¼CCGGAAGCTTTCAGACAC
CAATAATTTTATTTTCAGGG. K12 ¼CCGGAAG
CTTGTGAGCGGATAACAATTTCACACAGGAAAC
AGACCATGCCTCGTCCCGAGGGAGTTAACACC.
Plasmid constructs
Table 1 gives an overview of the main features of the
plasmids used in this work, including the new constructs.
Plasmids pHP17, pHP21, and pHP22 (expressing the
1016 K. Pauwels et al. (Eur. J. Biochem. 270)FEBS 2003
ARG5,6 gene altered in its NAGK-encoding ARG6 region)
were all constructed by recombinant PCR, using S1278b
genomic DNA as template. Two overlapping fragments
were generated in a first PCR amplification step, then self-
annealed, elongated to duplex DNA, and amplified in a
second PCR step using the two externaloligonucleotide
primers of the two oligonucleotide pairs of the first PCRs.
These external primers are designed to add adequate
restriction sites for classical cloning in the pYX223 vector
(from R&D systems). The latter is a 2 micron-based yeast–
E. coli shuttle vector, bearing HIS3 as selection marker, and
in which the expression of the inserted genes is put under the
control of a GAL promoter. The BY4/HP73 and HP72/
BY5 primer pairs were used to construct pHP17, BY4/
HP79, and HP80/BY5 for pHP21 and BY4/HP81 and
HP82/BY5 for pHP22.
Plasmids of the pYK series were all derived from the
E. coli expression vector pTrc99a (Pharmacia) and contain
different insertions, all obtained by PCR amplification. The
inserted fragments allow the expression of the ORF under
the transcriptional control of the IPTG-inducible strong
bacterial trp-lac promoter and under the translational
control of an appropriate Shine–Dalgarno sequence.
Plasmids pYK1 expresses the ARG6 ORF, cloned as an
NcoI–HindIII fragment amplified using K1 and K2 as
primers and plasmid pYB3 as a template. Plasmid pYK7
expresses the ARG2 ORF, cloned as a NcoI–PstI fragment
(primers AA29 and K8 and pYB2 as a template). With
primer AA29, a tag of six histidine codons is fused in frame
to the C-terminus of the ARG2 ORF for immunodetection
of the enzyme. Plasmid pYK8 was obtained by inserting
the ARG6 ORF and its trp-lac promoter (from position
)115) as a PstI–HindIII fragment (primers K4/K2, tem-
plate pYK1) into plasmid pYK7. The artificial operon of
plasmid pYK11 expresses a bi-cistronic ARG5/ARG6
mRNA under the control of the trp-lac promoter and
was obtained by inserting a HindIII fragment (primers
K10/K12, template pYK3), containing the reductase
encoding region, into plasmid pYK8. Primer K12 has a
35-nucleotide 5¢extension containing a ribosome site and
an initiator codon.
DNA sequencing
The nucleotide sequence of the ARG5,6 gene, cloned in
the plasmids pHP17, pHP21, pHP22 and pYK11, was
determined. Beside the intended modification or deletion,
these constructions, issued from independent PCR-
amplifications, share additionally the same 15 single-
nucleotide differences with respect to the data base
sequence. These S1278b-specific differences with respect
to the ARG5,6 gene of strain S288c, used to establish
the data base, result in only one amino-acid difference:
the E803K modification in the region of the gene
encoding NAGPR.
Enzyme activity assays
Acetylglutamate synthase. This enzyme activity was meas-
ured by a radioassay using
L
-[U-
14
C] glutamate and acetyl-
CoA as substrates, as described previously [32]. Dependent
on the experiment, 400 mL to 2 L of yeast cultures at
D
600
0.4 were required. Extracts were prepared using the
French press. For E. coli experiments, cells of 100 mL
cultures (induced overnight) were collected and extracts
were obtained by ultrasonication.
Table 1. Main features of the plasmids used in this work.
Plasmids Cloning vector
Origin of
insert Nature of insert Expressed protein
pYB2 pYX213 (2l,URA3)S1278b PromoterGAL ARG2 ORF-HAtag (32) WT NAGS-HA
pYB3 pYX223 (2l,HIS3)S1278b PromoterGAL ARG5,6 ORF (32) WT NAGK + WT NAGPR
(amino acids 1–863)
pYB7 pYX223 (2l,HIS3)S1278b PromoterGAL ARG6 (32) WT NAGK (amino acids 1–537)
pYB8 pYX223 (2l,HIS3)S1278b PromoterGAL ARG5 (32) WT NAGPR (amino acids 1–38 +
amino acids 494–863)
pHP17 pYX223 (2l,HIS3)S1278b PromoterGAL ARG5,6 ORF (F99L) FB
R
NAGK + WT NAGPR
pHP21 pYX223 (2l,HIS3)S1278b PromoterGAL ARG5,6 ORF
(Damino acids 355–493)
NAGK (DASD) + WT NAGPR
pHP22 pYX223 (2l,HIS3)S1278b PromoterGAL ARG5,6 ORF
(Damino acids 85–347)
NAGK (DCD) + WT NAGPR
p238 YCp50 (ARS-CEN, S288c GCN4 (4 uORFs untranslated)
a
Constitutive expression of Gcn4p
URA3)
pYK1 pTrc99a S1278b PromoterTrc ARG6 WT NAGK (amino acids 58 to 51)
pYK7 pTrc99a S1278b PromoterTrc ARG2 ORF-HIS6tag WT NAGS-HIS6
pYK8 pTrc99a S1278b PromoterTrc ARG2 ORF-HIS6tag +
PromoterTrc ARG6
WT NAGS-HIS6 + WT NAGK
(amino acids 58–513)
pYK11 pTrc99a S1278b PromoterTrc ARG2 ORF-HIS6tag +
PromoterTrc ARG6 +
ARG5 operon
WT NAGS-HIS6 + WT NAGK
(amino acids 58–513) + WT NAGPR
(amino acids 531–863)
a
Gift of A. Hinnebusch, National Institute of Child Health and Human Development, Bethesda, MD, USA.
FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1017
Acetylglutamate kinase. The assay used to measure
NAGK activity has been described previously [18]. In total
yeast extracts, this assay detects two distinct enzymatic
reactions [18,26]. As the interfering activity is not inhibited
by arginine (in contrast to the full inhibition of NAGK), a
blank including 5 m
M
arginine was used by Jauniaux et al.
to subtract the interfering activity [18]. Because we used
arginine feedback resistant mutants in this work, we used
adapted blanks containing 50 m
M
arginine. In some
experiments, the blanks were reaction mixtures incubated
without the substrate acetylglutamate. This explains the
presence of a residual activity, resistant to arginine inhibi-
tion, in Fig. 5 (about 15% of the initial kinase activity). A
kinase activity similar to that residual activity is measured in
extracts of strain KA42 bearing a full deletion of the
ARG5,6 gene.
All NAGS and NAGK activities reported in this work
are means of at least three independent experiments.
Standard deviations generally did not exceed 15%.
Western blots
A standard chemiluminescence Western blotting protocol
(Roche) was used to analyse the yeast NAGS expressed in
E. coli from plasmids pYK7, pYK8, and pYK11. Equal
amounts of total proteins of the different crude extracts were
separated by SDS/PAGE on 12% gels, and then blotted on
an ECL Hybond nitrocellulose membrane (Amersham
Pharmacia Biotech) in transfer buffer [25 m
M
Tris,
192 m
M
glycine, 20% (v/v) methanol] using a Mini PRO-
TEAN 3 blotting cell (Bio-Rad). Specific primary mouse
anti-HIS Ig (Santa Cruz Biotechnology) (0.1 ngÆmL
)1
)and
40 UÆmL
)1
peroxidase-labelled secondary antibody (Roche)
were used to detect the tagged synthase protein. Chemilu-
minescence was monitored by autoradiography. Detection
of Haemaglutinin (HA)-tagged NAGS, expressed by the
pYB2 plasmid in yeast cells, was as described previously [32].
Results
At physiological levels, the presence
of N-acetylglutamyl phosphate reductase
is dispensable to synthase activity
In order to determine the influence of N-acetylglutamyl
phosphate reductase on the activity of N-acetylglutamate
synthase, the synthase activity was measured in different
mutants carrying deletions in relevant parts of the chromo-
somal ARG5,6 gene. Strain YeBR6 expresses neither the
kinase nor the reductase, while only the kinase is expressed
by strain YeBR5 [32]. A new strain, SA2 bears a deletion of
the kinase-encoding domain of ARG5,6 and has its
remaining reductase-encoding domain fused to the mito-
chondrial targeting peptide. The SS1 strain is used as the
ARG5,6
+
positive control. SS1 bears an ARG3 deletion
rendering the control strain arginine-dependent, like the
tested strains. SS1, SA2, YeBR5 and YeBR6 are all directly
derived from MG471.
In a crude extract of wild-type yeast, the physiological
level of synthase activity is barely detectable. The detection
becomes even more difficult for the strains requiring
arginine for cell growth, presumably due to a tight binding
of the feedback inhibitor. Moreover, adequate removal of
the inhibiting arginine, by dialysis or repeated gel filtration,
is limited by the lack of stability of the synthase. To
overcome this difficulty, we choose to assay NAGS in
extracts of arginine-starved cells (see strains and growth
conditions). The arginine deprivation results in a Gcn4p-
mediated transcriptional activation of the ARG2 gene
(K. Pauwels and M. Crabeel, unpublished results) and
reduces the pool of the feedback inhibitor. Even higher
levels of synthase activity were detected in strains bearing
the p238 plasmid, due to a constitutive production of the
Gcn4p transcriptional transactivator (Table 2).
Synthase activity was assayed in crude extracts of arginine
starved SS1, YeBR5, SA2 and YeBR6, with and without
the plasmid p238 (Table 2). No synthase activity was
detectable in absence of the kinase (SA2 and YeBR6 vs.
SS1). In contrast, the absence of reductase did not affect
considerably the synthase activity, though a small decrease
was observed (YeBR5 vs. SS1). These data demonstrate
that, at physiological level, the synthase activity requires the
presence of the kinase, and that the additional presence of
the reductase is dispensable.
Activity and protein level of the yeast synthase
expressed in
E. coli
, require the coexpression
of the yeast kinase but not of the yeast reductase
The E. coli strain XA4 (argA
–
), which is defective in
N-acetylglutamate synthase, cannot be restored to arginine
prototrophy by a trp-lac-promoter-driven expression of the
Table 2. Physiological levels of the N-acetylglutamate synthase in strains bearing different deletions in the ARG5,6 gene.
Strain Relevant genotype
Status of
NAGS activity (nmolÆmin
)1
Æmg
)1
protein)NAGK NAGPR
SS1 ARG5,6,Darg3 + + 2.2
SS1 (p238)
a
9.36
YeBR5 Darg5 + – 1.5
YeBR5 (p238)
a
7.3
SA2 Darg6 – + <0.2
b
SA2 (p238)
a
<0.2
b
YeBR6 Darg5,6 – – <0.2
b
YeBR6 (p238)
a
<0.2
b
a
Plasmid p238 expresses Gcn4p constitutively;
b
below detection.
1018 K. Pauwels et al. (Eur. J. Biochem. 270)FEBS 2003