Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells

A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells Shinichi Mitsui1,*, Akira Okui2, Katsuya Kominami2, Eiichi Konishi1, Hidetoshi Uemura2 and Nozomi Yamaguchi1

1 Department of Cell Biology, Research Institute for Geriatrics, Kyoto Prefectural University of Medicine, Kyoto, Japan 2 Research and Development Center, Fuso Pharmaceutical Industries Ltd, Morinomiya, Joto-ku, Osaka, Japan

Keywords cerebellum; chromosome 16; ovarian cancer; tumor marker

Correspondence N. Yamaguchi, Department of Cell Biology, Research Institute for Geriatrics, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan Fax: +81 75 251 5848 Tel: +81 75 251 5797 E-mail: nozomi@koto.kpu-m.ac.jp

*Present address Department of Neurobiology and Anatomy, Kochi Medical School, Okou, Nankoku 783- 8505, Japan

Database The nucleotide sequence reported in this paper has been entered in the DDBJ ⁄ Gen- Bank ⁄ EMBL databases under accession no. AB010779

cleaved benzyloxycarbonyl

(Received 25 November 2004, revised 4 July 2005, accepted 3 August 2005)

doi:10.1111/j.1742-4658.2005.04901.x

We have isolated a cDNA that encodes a novel serine protease, prosemin, from human brain. The cDNA of human prosemin is 1306 bp, encoding 317 amino acids. It showed significant homology with the sequence of a chromosome 16 cosmid clone (accession no. NT_037887.4). The prosemin gene contains six exons and five introns. The amino acid sequence of prose- min shows significant homology to prostasin, c-tryptase, and testisin (43%, 41%, and 38% identity, respectively), the genes of which are also located on chromosome 16. Northern hybridization showed that prosemin is expressed predominantly in the pancreas and weakly in the prostate and cerebellum. However, western blot and RT-PCR analyses showed that prosemin is expressed and secreted from various kinds of cancer cells, such as glioma, pancreas, prostate, and ovarian cell lines. Prosemin is secreted in the cystic fluid of clinical ovarian cancers. Furthermore, immunohisto- chemistry showed prosemin protein localized in the apical parts of ovarian carcinomas. Recombinant prosemin was expressed in COS cells and was purified by immunoaffinity chromatography. Recombinant prosemin pre- (Z)-His-Glu-Lys-methylcoumaryl ferentially amidide (MCA) and t-butyloxycarbonyl (Boc)-Gln-Ala-Arg-MCA. Our results suggest that prosemin is a novel serine protease of the chromo- some 16 cluster that is highly expressed in the pancreas. The usefulness of this serine protease as a candidate tumor marker should be further examined.

Abbreviations Boc, t-butyloxycarbonyl; Bz, benzoyl; CNS, central nervous system; Glu(Obzl), glutamic acid c-benzyl ester; Glp, L-pyroglutamyl; MCA, 4-methylcoumaryl-7-amidide; NHS, N-hydroxysuccinimide; Z, benzyloxycarbonyl.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4911

Serine proteases play important roles in a variety of physiological processes, such as blood coagulation, growth factor processing, the digestion of nutrients, and cell migration, when cells move to the target organs and reconstitute extracellular matrices, especi- ally during developmental stages. In the central ner- vous system (CNS), serine proteases are believed to be involved in various neuronal functions [1]. Tissue-type plasminogen activator is essential for memory forma- tion and seizures [2,3]. Knockout mice lacking neuro- psin ⁄ KLK8, a member of the kallikrein family, have a reduced number of active synapses [4]. On human and mouse genomes, over 500 proteases are encoded [5] and some proteases other than plasminogen activator and neuropsin may contribute to neuronal function. transmembrane We have recently reported a novel

S. Mitsui et al.

A novel serine protease in various cancer cells

sequence

showed the human genome draft of that this gene is located on chromosome 16p13.3 (NT_037887.4). Although human prosemin cDNA was isolated from the brain, northern hybridization showed that prosemin is expressed strongly in the pancreas, but weakly in the prostate and cerebellum (Fig. 4). The nucleotide sequences of the cDNA and the cosmid clone are identical. A comparison of the cDNA and ge- nomic sequences clarified the gene structure of human prosemin (Fig. 1). The prosemin gene is approximately 6.5 kb, and contains six exons and five introns. All exon–intron boundaries are consistent with the GT– AG rule. The exons range in size from 27 to 601 bp. The second exon encodes only nine amino acids, which constitute part of the pro-enzyme fragment. The initi- ation codon is consistent with Kozak’s consensus sequence [21]. Although we did not determine the tran- scription initiation site, the 5¢ UTR appears to be lon- ger than 67 bp because the primer for the first PCR used to isolate the full-length cDNA was designed to hybridize with that position (at 991 in Fig. 2). Further, homology search showed that our sequence contained longest 5¢ UTR when compared with EST the sequences. Several transcription regulatory elements occur within 1.2 kb upstream from the first exon: three AP-1 sites, a CREB binding site, and a NF-jB binding site. There is no typical TATA or CAAT box in the putative promoter region. The putative signal sequence is encoded by the first exon, and the pro-enzyme frag- ment is encoded by exons 1 and 2. The catalytic triad, His, Asp, and Ser, is encoded in exons 3, 4, and 6, respectively. Exon 6 contains a polyadenylation signal.

serine protease, spinesin ⁄ TMPRSS5, which is localized at synapses [6]. Motopsin (PRSS12) is a mosaic serine protease, with a kringle domain and three scavenger receptor cysteine-rich domains, that is expressed pref- erentially in motor neurons [7,8]. Some novel members of the kallikrein family have also been reported. Hip- postasin (KLK11) is expressed in hippocampal pyram- idal neurons and shows kallikrein-like enzyme activity [9]. Another kallikrein-like protease, neurosin (KLK6), which has trypsin-like activity, is secreted by activated microglial cells and localized on senile plaques and Lewy’s bodies [10,11]. We have shown that the alter- native splicing of neuropsin ⁄ KLK8 is regulated in a tissue-specific manner [12]. These proteases are thought to play important roles in neuronal functions via the digestion of extracellular matrices, the processing of growth factors, and the activation of cell-surface recep- tors. However, such proteolytic phenomena occur markedly in tumor cells as well as in the CNS. Some of the proteases described above have been reported to be tumor markers, although they are expressed pre- dominantly in the CNS. Neuropsin was identified as a serine protease that is overexpressed in ovarian carci- nomas, although its mRNA is detected negligibly in normal ovaries [13,14]. Serum neurosin levels are ele- vated specifically in patients with ovarian cancer [15]. Furthermore, we have previously reported that the alternative splicing of hippostasin is regulated in a cancer-specific manner [16]. In addition, serum levels of hippostasin are increased in patients with ovarian and prostate cancers [17]. Other kallikreins are aber- rantly expressed in many types of cancers and their expression is often associated with patient prognosis (reviewed in [18–20]). Structure of human prosemin

Here, we describe a novel member of the chromo- some 16 serine protease family. Prosemin cDNA was isolated from a human brain cDNA pool. Immuno- chemical and RT-PCR analyses revealed that prosemin is expressed in various kinds of cancer cell lines and in clinical samples of ovarian carcinomas. The characteri- zation and functions of prosemin are described.

Results

cDNA cloning and structure of the prosemin gene

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4912

We isolated a cDNA of 958 bp that encodes a novel serine protease of 317 amino acids from human brain cDNA pool. The predicted amino acid sequence includes a serine protease motif, and this protein was designated ‘prosemin’, as this protein was first detected in seminal fluid (data not shown). A BLAST search The predicted amino acid sequence of prosemin shows that this protein belongs to the chymotrypsin (S1) fam- ily and may be synthesized as a prepro form. Hydro- pathy plot analysis showed that the 32 amino acids of the N-terminus constitute a putative signal sequence (data not shown). A typical serine protease activation motif is also conserved at Arg49-Val-Val-Gly-Gly, sug- gesting that the 17 amino acids from Ala33 to Arg49 might comprise the pro-fragment of prosemin. A pos- sible N-glycosylation site occurs at Asn70 in the cata- lytic domain. The essential triad for protease activity was identified at His90, Asp141, and Ser242. An aspar- tate residue six amino acids before the active Ser242 suggests that prosemin has trypsin-like activity. In addition to a similarity in gene structure, a homology search of the SWISSPROT protein database showed significant similarity between prosemin and prostasin, c-tryptase, and testisin, with 43%, 41%, and 37.5%

S. Mitsui et al.

A novel serine protease in various cancer cells

w o r r a

n A

s u s n e s n o c

. s r e t t e

l

y r a d n u o b

e t i h w n

i

i

. k n a B n e G m o r f

n w o h s

n o r t n – n o x e

e r a

n e k a t

e h T

7 D 5 2 3

. d e x o b

s e s a e t o r p

l

e r a

e n o c

i

i

e n i r e s

n o g e r

r o f

i

s d c a

d m s o c m o r f

i

r e t o m o r p

o n m a

e h t

d e v i r e d

n

i

s

i

s u s n e s n o c

l

s t n e m e e

e c n e u q e s

e h T

i

l

i

c m o n e g

g n i t c a - s c

e h T

. y e v i t c e p s e r

l

e v i t a t u p

, s e n

d n a

i l r e d n u

. y e v i t c e p s e r

l

s n o x E

i

, e t i s

e g n s

i

d n a

l

l

. n m e s o r p

l

e b u o d

y b

n a m u h

n o i t a y s o c y g - N e h t

f o

i

d n a

d e t a c d n

i

e t i s

e r a

l

e c n e u q e s

i

i

i

a n g s

d c a

i

g n s s e c o r p

l

o n m a

d n a

e v i t a t u p

l

n o i t a y n e d a y o p

e h t

e h t

e r u t c u r t s

i

d n a

e t a c d n

i

l

e n e G

. 1

e c r i c

.

d n a

g i F

s e c n e u q e s

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4913

S. Mitsui et al.

A novel serine protease in various cancer cells

Fig. 2. Amino acid alignment of the chromosome 16 serine protease family. White letters indicate amino acids identical to those in human prosemin. Asterisks show the amino acids conserved among the seven proteases. Dashes denote gaps. The essential triad and peripheral sequences are indicated by lines. Cys41 in the pro-enzyme fragment may form a disulfide bond with Cys175 in the catalytic domain.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4914

identity, respectively (Fig. 2). Amino acid alignment of these proteases shows that 10 of the 12 cysteine resi- dues in the prosemin zymogen are conserved among these proteases. Cys41 is predicted to form a disulfide bond with Cys175, as in other S1 proteases, whereas the a-, b-, and d-tryptases do not contain a cysteine residue in the pro-enzyme fragment. However, pro- semin does not contain a hydrophobic region at the carboxyl terminus. This portion is apparently different from the corresponding regions of prostasin, c-tryptase and testisin, which anchor the proteins to the plasma membrane.

S. Mitsui et al.

A novel serine protease in various cancer cells

Enzyme activity of human prosemin

the same

To analyze the enzyme activity of prosemin, recombin- ant prosemin was expressed in COS cells. In our system, the putative catalytic domain was fused with the prepro- enzyme fragment of human trypsinogen. Recombinant prosemin was secreted into the conditioned medium and purified by immunoaffinity chromatography. SDS ⁄ PAGE of purified prosemin produced a single band of 33 000 Da, which reacted with anti-prosemin IgG (Fig. 3A). Purified prosemin still contained the pro- enzyme fragment of trypsinogen and was activated by enterokinase (Fig. 3B–D). Activated prosemin cleaved a substrate [t-butyloxycarbonyl (Boc)-Gln- fluorescent Ala-Arg-4-methylcoumaryl-7-amidide (MCA)], whereas preactivated recombinant prosemin and enterokinase showed no activity against substrate. SDS ⁄ PAGE showed that enterokinase treatment of recombinant prosemin caused a decrease in the mole- cular mass from 33 000 to 31 000, indicating successful digestion of the artificial trypsinogen pro-enzyme frag- ment. The amount of 31 kDa prosemin increased in pro- portion to the time of incubation with enterokinase. Prosemin activity appeared to be related to the amount of 31 kDa protein, although extended incubation caused some degradation of the recombinant prosemin,

B

C

A

D

E

F

Fig. 3. Enzymatic characterization of recombinant prosemin. (A) SDS ⁄ PAGE of purified recombinant prosemin. Anti-prosemin IgG raised against a synthetic peptide recognized this protein (lane 1). Purified prosemin was detected as a single band by silver staining (lane 2). (B) After activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 (cid:1)C for the indicated times. White and shadowed bars indicate before and after activation by enterokinase, respectively. Black bars indicate the enzymatic activity of entero- kinase on the substrate. The closed circles and line indicate prosemin enzyme activity after activation of the protein by enterokinase; the enzymatic action of enterokinase upon the substrate has been subtracted. Mean values and standard deviations (SD; n ¼ 3) are indicated. (C) Activation of recombinant prosemin by enterokinase. Purified recombinant prosemin was incubated with enterokinase at 37 (cid:1)C for 0 (lane1), 5 (lane 2), 24 (lane 3), 48 (lane 4) h. After incubation, the recombinant protein was visualized by silver staining after SDS ⁄ PAGE. (D) The enzymatic activity of prosemin activated for various times was measured at 37 (cid:1)C using the substrate Boc-Gln-Ala-Arg-MCA. (E) Recom- binant prosemin activated for 24 h was incubated with the indicated substrates for 1 h at 37 (cid:1)C. Mean values and SD are shown (n ¼ 3). (F) Activated prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 (cid:1)C for 1 h at various pHs. Phosphate buffer (0.1 M) and Tris ⁄ HCl (0.1 M) buffer were used for pH 5.0–9.0 and pH 9.0–11.0, respectively. Mean values and SD are shown (n ¼ 3).

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4915

S. Mitsui et al.

A novel serine protease in various cancer cells

A

B

Fig. 4. Expression of prosemin in normal human tissues. (A) Northern hybridization was carried out overnight at 65 (cid:1)C. Strong signal was detected in the pancreas, and weak signals were observed in the prostate and cerebellum. (B) Expression of prosemin mRNA was analyzed by RT-PCR. A specific band of the expected size was detected in most human tissues (arrowhead).

including autodegradation. These results indicate that the detected activity derived from the activated recom- binant prosemin.

cleaved

lum (Fig. 4A). We isolated a cDNA fragment encoding prosemin from a human brain cDNA pool. However, prosemin mRNA was detected only in the cerebellum. It was not detected in other regions of the brain, such as the thalamus, substantia nigra, hippocampus, cor- pus callosum, caudate nucleus, or amygdala (data not shown). However, using RT-PCR, we detected prose- min mRNA in most human tissues except the hippo- campus and liver (Fig. 4B). The levels of prosemin expression are very low in these tissues.

Prosemin expression in various cancer cell lines

At pH 8.0, recombinant prosemin the most preferen- tially (Z)-His-Glu-Lys- benzyloxycarbonyl MCA, and it showed high enzymatic activity against Boc-Gln-Ala-Arg-MCA and Boc-Glu(Obzl)-Ala-Arg- MCA, which are substrates for trypsin and factor XIa, respectively, and weakly cleaved Boc-Val-Pro-Arg- MCA, Pro-Phe-Arg-MCA, l-Pyroglutamyl (Glp)-Arg- MCA, and Boc-Phe-Ser-Arg-MCA (Fig. 3E). The optimum pH for prosemin activity was investigated using Boc-Glu-Ala-Arg-MCA as substrate (Fig. 3F). Activated recombinant prosemin showed no enzymatic activity at pH < 6.0. Prosemin showed maximum enzymatic activity at pH 8.0–9.0, and showed about half maximal activity at pH > 10.0.

Expression of prosemin mRNA in normal human tissues

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4916

Prosemin mRNA of 1.4 kb was expressed strongly in the pancreas and weakly in the prostate and cerebel- Recently, some serine proteases, including testisin and prostasin, have been reported as tumor markers. The expression of prosemin in cancer cell lines was ana- lyzed. Immunoblotting using anti-prosemin IgG detec- ted a protein of 33 kDa, which is identical to the in condi- molecular mass of recombinant prosemin, tioned medium from some human cancer cell lines (Fig. 5A). A 20 kDa protein was detected in some cell lines, such as HPC-Y0, HPC-YS, SKOV-3, OVK-18, DU-145, U373, KHG2, HOG, KP-N-YN, Colo38,

S. Mitsui et al.

A novel serine protease in various cancer cells

A

C

B

Fig. 5. Secretion of prosemin protein and expression of prosemin mRNA in various kinds of cancer cells. (A) Conditioned medium (25 lg) from various cancer cell lines was used for western blot analysis with antibody raised against a synthetic prosemin peptide. A 33 kDa immu- noreactive protein (black arrowhead) and a 20 kDa protein (white arrowhead) were detected. (B) RT-PCR for prosemin mRNA in cancer cell lines. The predicted size of the PCR product was 500 bp and the specific PCR product was detected in various kinds of cell lines. It should be noted that Ishikawa, OVK-18, and HUE showed no band or weak bands, which is consistent with the results of the western blot analysis. (C) Western blot analysis of cancerous fluid from clinical ovarian cancers. Immunoreactive protein was detected in the cystic fluid as a 30 kDa protein (lanes 2,3), whereas recombinant prosemin produced a 33 kDa band (lane 1).

lines splicing variants during the PCR cloning process (S. Mitsui, A. Okui, K. Kominami, E. Konishi, H. Uem- ura and N. Yamaguchi, unpublished data). The expres- sion pattern of prosemin in cancer cell is summarized in Table 1.

Immunohistochemical detection of prosemin in ovarian cancer

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4917

and OUR-10, although the 33 kDa protein was not detected. Either the 33 kDa or the 20 kDa protein was detected in all 11 pancreatic cancer cell lines and four colon cancer cell lines. An immunoreactive 20 kDa protein was detected in both of two prostate cell lines, two of three ovarian cell lines, and one of three lung cancer cell lines. There was no detectable protein in the conditioned media from some cell lines: SKLU1, K562, HUE, Ishikawa-EM, and glioma Ishikawa. RT- PCR was used to confirm the expression of prosemin mRNA in some cell lines. A band of the predicted size (500 bp) of the PCR product was observed for most of the cell lines tested, including HPC-YO and HPC-YS, in which only the 20 kDa protein was detected (Fig. 5B). However, no PCR product was detected in Ishikawa, a glioma line. HUE and OVK18 expressed low levels of prosemin mRNA. The transcript levels of prosemin suggested by RT-PCR analysis were consis- tent with the results of western blot analysis, although RT-PCR is relatively nonquantitative. A431, DU-145, and LNCap showed some smaller bands, which may reflect splicing variants because we identified eight Western blot analysis and RT-PCR indicated the expression of prosemin in ovarian cancer cell lines. Ovarian cancers express some kinds of chromosome 16 serine proteases, including testisin and prostasin. We investigated the expression of prosemin in ovarian can- cers using immunohistochemistry. Western blot analy- sis showed that prosemin occurred in ovarian cystic fluids (Fig. 5C). As shown in Fig. 6, immunoreactive prosemin was localized at the apical portion of carci- noma cells, whereas nonimmune serum produced no signal. This localization was identical in mucinous and serous adenocarcinomas. The strong expression of prosemin in serous carcinomas is noteworthy. Three of

S. Mitsui et al.

A novel serine protease in various cancer cells

Table 1. Expression and secretion of prosemin from cancer cell lines. ND, not determined.

Western blot of conditioned media

33 kDa

20 kDa

Cell line

Tissue

RT-PCR

suggest

Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Pancreas Endothelium Vulva Colon Colon Colon Colon Lung Lung Lung Breast Thyroid Liver Blood Kidney Neuron Oligodendroglioma Glioma Glioma Glioma

HPC-Y0 HPC-Y3 HPC-Y5 HPC-Y9 HPC-Y25 HPC-YS HPC-YT AsPC-1 Capan I Capan II BxPC-3 HUE A431 Clo201 WiDr SW1119 Colo38 A549 SKLU QG MCF-7 T3M-1 Chang K562 OUR-10 KP-N-YN HOG Ishikawa KHG2 U373 Ishikawa-EM Endometrium OVK-18 SKOV-3 HOC-Y1 PC-3 DU-145

Ovary Ovary Ovary Prostate Prostate

– + + + + + + + + – – + + – + + – – + + + + + – – – – + + + + + – – – – – – – – – – – – – –

+ + + + + + + + + + + + – + + + + + – – + + + – – + + + + – + + – – + + + +

+ + + ND ND + + ND ND ND ND ND + – + ND ND + ND ND ND ND ND ND ND ND ND + + – + ND + – + – + + ND + +

syntenic region of mouse chromosome 17, there is a tryptase gene cluster consisting of at least four serine proteases [25]. Among the chromosome 16 protease family members, the prosemin gene structure is similar to the structures of prostasin, c-tryptase, and testisin. The characteristic feature of these genes is the short second exon, which encodes only six or nine amino acids of the pro-peptide fragment (Fig. 1). No TATA box sequence has been identified in the promoter regions of these genes. The amino acid sequence of prosemin is up to 43% homologous to those of prosta- sin and c-tryptase (Fig. 2). Furthermore, two cysteine residues, Cys41 and Cys161, are conserved only among these four proteases, and not in the other tryptases. These results the chromosome 16 that, of serine protease family members, these four proteases at least are derived from a single ancestral gene.

five serous adenocarcinomas and three of eight mucin- ous adenocarcinomas were positively stained by anti- prosemin IgG.

Discussion

The deduced amino acid sequence of prosemin shows the characteristic feature of the S1 family. The triad essential for serine protease activity and the peripheral consensus sequence have been identified (Figs 1 and 2). An aspartic acid residue six amino acids before the act- ive Ser242 suggests that prosemin preferentially cleaves after Arg or Lys residues in a target substrate. In fact, recombinant prosemin cleaved Z-His-Glu-Lys-MCA, Boc-Glu(Obzl)-Ala-Arg-MCA, and Boc-Gln-Ala-Arg- MCA. Prosemin might be synthesized as a prepro-pro- tein because it contains 32 hydrophobic amino acids at the amino terminal, which constitute a possible signal peptide. Prosemin protein was secreted into conditioned medium when the full-length prosemin cDNA was expressed by a baculovirus expression system (data not shown). In fact, western blot analysis showed that prose- min is secreted in the cystic fluids of ovarian cancers (Fig. 5C). Prosemin secreted by human cancer cell lines was detected as a 33 kDa protein. However, the prose- min zymogen contains 17 amino acids of the pro- enzyme fragment and 268 amino acids of the mature enzyme, so the molecular mass is calculated to be about 31 kDa. This discrepancy may be attributable to post- translational modifications, such as N-glycosylation at Asn70. An activation motif typical of serine proteases is also observed at Arg49-Val-Val-Gly-Gly-Glu-Asp. The released pro-enzyme fragment is predicted to be linked with the catalytic domain by a disulfide bond between Cys41 and Cys175; this is typical of many members of the S1 family.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4918

We have isolated a cDNA encoding a novel serine pro- tease, prosemin, from a human brain cDNA pool. Homology search to human genomic sequence indica- ted that the prosemin gene is located on chromosome 16p13.3. In this region, genes for at least eight serine proteases are clustered: aII-, b-, cI-, cII-, w-tryptases [22], testisin [23], prostasin [24], and prosemin. On the We confirmed the enzymatic activity of prosemin with a recombinant protein. In our system, recombin- ant prosemin was secreted into conditioned medium (Fig. 3A), although it was composed of the trypsino- gen prepro-peptide and the catalytic domain of pro- semin. We have developed this chimeric protein system

S. Mitsui et al.

A novel serine protease in various cancer cells

Fig. 6. Immunohistochemistry of prosemin in ovarian cancers. Paraffin-embedded sections were stained with antibody directed against recombinant prosemin. (A) Mucinous adenocarcinoma. (B) and (C) Serous adenocarcinomas, borderline. Immunoreactive prosemin was observed in the apical portion. (D) Normal rabbit IgG produced no signals in the same sample as shown in (C).

hippostasin (KLK11) [9,10]. It is also advantageous that the artificial pro-enzyme fragment blocks any pro- teolytic activity acting on the recombinant protein. Recombinant prosemin only exhibited its activity when immobilized enterokinase digested away the pro- enzyme fragment (Fig. 3B–D). Thus, we can recover the recombinant enzyme with no fear of autodegrada- tion. Our system might be suitable for producing recombinant serine proteases.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4919

to use the attendant advantages, although full-length cDNA can be expressed in an expression system. The recombinant protein was secreted into the conditioned medium by the trypsinogen signal peptide, which facili- tates collection of the protein. Furthermore, the trypsi- nogen prepro-peptide seems to function as a chaperon for some serine proteases. Recently, pro-enzymatic fragments have been identified as intramolecular chap- erons for some serine proteases, such as carboxypepti- dase Y in yeast, subtilisin, a-lytic protease, and aqualysin in bacteria (reviewed in [26]). When a histi- dine tag was fused with the prosemin catalytic domain using the pTrcHis B vector (Invitrogen), no enzymatic activity was detected because refolding was disrupted (data not shown). We have reported the enzymatic activities of chimeric proteins composed of the trypsi- nogen signal ⁄ pro-peptide and the catalytic domains of the kallikrein-like proteases, neurosin (KLK6) and The enzymatic characteristics of prosemin are inter- esting, although its physiological functions are still obscure. Prosemin hydrolyzes fluorogenic substrates at an optimum pH of 8.0–9.0 (Fig. 3F), which is similar to the optimum pH for prostasin activity, pH 9.0 [27]. Prostasin preferentially cleaved Pro-Phe-Arg-MCA and Val-Leu-Arg-MCA, but showed slight enzyme activity against Phe-Phe-Arg-MCA. Prosemin acted enzymati- cally on Pro-Phe-Arg-MCA and Boc-Val-Leu-Arg-

S. Mitsui et al.

A novel serine protease in various cancer cells

We have focused on ovarian cancer because other members of the chromosome 16 serine protease family, testisin and prostasin, are also expressed in ovarian car- cinomas [31,32]. Immunohistochemical analysis demon- strated the expression of prosemin in clinical ovarian carcinomas, regardless of cancer type (Fig. 6). The local- ization of prosemin in the apical portion suggests that prosemin is secreted into the lumen. Western blot analy- sis that detected prosemin in cystic fluids confirms this possibility (Fig. 5C). It should be noted that prosemin occurs significantly in borderline serous adenocarcino- mas, because there is still no available marker for the early diagnosis of ovarian cancer (Fig. 6).

In other

laminin, Prosemin might be a good candidate tumor marker, although it remains to be confirmed that prosemin protein secreted from carcinomas flows into the blood. We are developing an ELISA to measure prosemin, and seeking physiological substrates to better under- stand the physiological functions of the protein and its potential as a tumor marker.

Experimental procedures

cDNA cloning of human prosemin

MCA, although it preferentially cleaved Boc-Glu(Obzl) and Gln-Ala-Arg-MCA as well as Z-His-Glu-Lys- MCA unlike prostasin (Fig. 3E). Such enzymatic characteristics may reflect the amino acid similarities between prosemin and prostasin. The optimum pH for prosemin is also similar to that for pancreatic digestive serine proteases, including CTRL-1 [28], trypsin, and pancreatic elastase [29]. Northern blot analysis showed that, of the normal tissues, prosemin is abundantly expressed in the pancreas (Fig. 4). All the pancreatic cancer cell lines tested secreted prosemin into the con- ditioned medium (Fig. 5). These results suggest that the prosemin produced in the pancreas might function as a digestive enzyme, although confirmation that secreted into the pancreatic fluid is prosemin is required. tissues, prosemin may not be involved in the reconstitution of the extracellular mat- rix, because recombinant prosemin does not digest fibronectin, type-V collagen, or gelatin, despite its enzyme activity (data not shown). The levels of prosemin expressed in normal tissues are too low for the reconstitution of the extracellular matrix. Nerve growth factor and brain-derived neurotrophic factor have recently been shown to undergo processing by serine proteases in extracellular regions [30]. Prosemin might be involved in the processing of some proteins.

the corresponding normal

cDNA cloning of human prosemin was performed by PCR techniques, as described previously [9]. PolyA+ RNA from human brain (Clontech Laboratories Inc., Palo Alto, CA) was reverse-transcribed using an oligo-dT primer attached to a NotI adaptor sequence, GGCCACGCGTCGACTAG TAC(T)17, using Superscript II reverse transcriptase (Invi- trogen, Carlsbad, CA). Degenerate RT-PCR was performed using a primer designed to hybridize with the serine prote- ase motif (Supplementary Fig. S1). The sequences of PCR products were analyzed using an automatic sequencer (DSQ-1000, Shimadzu, Kyoto, Japan) after cloning into pGEM-T Easy vector (Promega, Madison, WI). Primers for 5¢ and 3¢ RACE were designed based on the sequence of the product of degenerate PCR. For 3¢ RACE, nested PCR was carried out with primer 2 and the adaptor primer, using the PCR product amplified by primer 1 and the adap- tor primer as template. 5¢ RACE was performed with primers 3, 4, AP1, and AP2 using a Marathon RACE Amplification Kit (Clontech) according to the manufac- turer’s instructions. Full-length cDNA was isolated by nes- ted RT-PCR between primers 5 (GCCATGGTGGTTTC TGGAGC) and 6 (CTGAATTCCTAGGAGCGCGCGGC GGCC) using the PCR product generated by primers 7 (TACACACCCTGACCCGCATC) and 6 as template.

of serine

The sequence of the cDNA was analyzed using genetyx software (Software Development Co. Ltd, Tokyo, Japan).

Sequence analysis

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4920

In contrast to the specific expression of prosemin in normal tissues, various kinds of tumor cell lines secrete prosemin (Fig. 5). The immunoreactive 20 kDa protein might be a degradation product of 33 kDa prosemin the preparation process, because formed during RT-PCR detected prosemin mRNA in cells that expressed only the 20 kDa protein (Fig. 5B and Table 1). It should be noted that prosemin protein was detected in many ovarian, lung, and colon cancer cell lines, whereas tissues expressed low levels of prosemin mRNA. There are some reports that tumorigenesis causes the aberrant expression proteases. Neurosin ⁄ KLK6, expressed predominantly in the brain, is up-regulated in ovarian carcinomas [10,15]. Neuropsin ⁄ KLK8 mRNA is not detected in the normal ovary, but is overexpressed in ovarian carcinomas [13]. Further- more, hippostasin ⁄ KLK11 is up-regulated in ovarian and prostate cancers [17]. Recent experimental data suggest that human kallikreins promote or inhibit invasion, metastasis by tumor growth, angiogenesis, proteolytic processing of growth factor binding pro- teins, activation of other proteases and growth factors, degradation of extracellular matrix proteins (reviewed in [18–20]). Prosemin may also have other roles inclu- ding the processing of growth factors and other pro- teases, as described above, especially in the CNS.

S. Mitsui et al.

A novel serine protease in various cancer cells

Multi-alignment and the search for transcriptional elements were carried out using BCM search (http://searchlauncher. bcm.tmc.edu/) and TFSEARCH (http://www.cbrc.jp/ research/db/TFSEARCH.html), respectively.

20 lm of a specific substrate in 20 mm Tris ⁄ HCl (pH 8.0) containing 0.2 m NaCl at 37 (cid:1)C for the appropriate time. To determine the optimum pH, 0.1 m phosphate buffers were used at pH 5.0 to pH 9.0, and 0.1 m Tris ⁄ HCl buffers from pH 9.0 to pH 11.0. Enzymatic activity was measured as fluorescence (excitation at 380 nm, emission at 460 nm) using a plate reader (Cytofluor 2300, Applied Biosystems, Foster City, CA).

Northern hybridization

Multiple human polyA+ RNA blots were purchased from Clontech. Full-length cDNA amplified between primers 5 and 6 was labeled using a BcaBEST Random Labeling Kit (Takara Suzo Co. Ltd, Kyoto, Japan). Hybridization was carried out overnight in Express HybTM hybridization solu- tion (Clontech) at 55 (cid:1)C. The membrane was washed in 0.1· SSPE and 0.1% (w ⁄ v) SDS at room temperature for 10 min. Radioactivity was detected using an FLA-2000 Bio- Image Analyzer (Fuji Photo Film Co. Ltd, Tokyo, Japan).

Western blot analysis

Purified recombinant prosemin or synthetic peptide (Gly-Glu-Asp-Ser-Thr-Asp-Ser-Glu-Trp-Pro-Trp-Ile-Val- Ser-Ile-Gln-Lys-Asn-Gly-Thr-His-His-Cys) conjugated with keyhole-limpet hemocyanin was used to immunize New Zealand white rabbits, as described previously [33]. Anti- bodies raised against prosemin were used after purification on Protein A Sepharose (Amersham Pharmacia Biotech). The indicated cell lines were cultured in protein free Ham’s F12 medium for several days. The conditioned medium was recovered, freeze-dried, and reconstituted at 5 mgÆmL)1 with NaCl ⁄ Pi. Aliquots (5 lL) of reconstituted conditioned med- ium were separated electrophoretically on a 12.5% (w ⁄ v) SDS-polyacrylamide gel and blotted onto poly(vinylidene difluoride) membrane (Immobilon, Millipore, Bedford, MA). The membrane was incubated with anti-prosemin IgG diluted 1 : 1000 with 5% (w ⁄ v) nonfat skim milk in NaCl ⁄ Pi containing 0.05% (v ⁄ v) Tween-20 (NaCl ⁄ Pi-Tween). The immunoreaction was enhanced by microwave treatment for 20 min using an MI77 microwave oven (Azumaya, Tokyo, Japan). The membrane was washed with NaCl ⁄ Pi-Tween three times, and incubated with anti-rabbit IgG conjugated with alkaline phosphatase. The immunoreaction was visual- ized by incubation in 50 mm Tris ⁄ HCl (pH 9.7) containing 5 mm MgCl2, 450 lgÆmL)1 4-nitroblue tetrazolium chloride, and 157 lgÆmL)1 5-bromo-4-chloro-3-indolyl phosphate.

The following cell

(a gift

The putative catalytic domain of human prosemin was fused to the trypsinogen prepro-peptide, as described else- where [10]. In brief, a PCR fragment from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen) at the HindIII and KpnI sites to produce pTSd. The cDNA fragment encoding the putative catalytic site was amplified by PCR (forward pri- mer, GTTGTGGGCGGCGAGGACAG; reverse primer, ATTGTCGACCTAGGAGCGCGCGGCGGC). This PCR fragment was digested with SalI and subcloned into pTSd at blunted KpnI and XhoI sites to produce pTSd ⁄ prosemin. The veracity of the fusion vector was checked by DNA sequencing. pTSd ⁄ prosemin (50 lg) was transfected into COS-1 cells cultured in a 150 cm2 flask using Lipofect- Amine Plus (Invitrogen, Carlsbad, CA). The cells were cul- tured in serum-free medium (Invitrogen) containing 700 lgÆmL)1 G418. The conditioned medium was recovered several days later. Recombinant prosemin was purified by immunoaffinity column chromatography using an antibody directed against Asp-Asp-Asp-Asp-Lys, which was immobi- lized on N-hydroxysuccinimide (NHS)–Sepharose (Amer- sham Pharmacia Biotech, Buckinghamshire, UK). The bound protein was eluted with 0.1 m citrate buffer (pH 3.0) and neutralized with 2 m Tris.

Production of recombinant prosemin

lines were tested: pancreatic cancer, HPC-Y0, HPC-Y3, HPC-Y5, HPC-Y9, HPC-Y25, HPC-YS, HPC-YT, and those established by the author (N Yamaguchi), AsPC-1 (ATCC CRL-1682), Capan-1 (ATCC HTB-79), Capan-2 (ATCC HTB-80), BxPC-3 (ATCC CRL-1687); colon cancer, Colo 201 (ATCC CCL- 204), WiDr (ATCC CCL-218), SW1116 (ATCC CCL-223); lung cancer, A540 (ATCC CCL-185), SKLU1 (ATCC HTB-57); neuroblastoma, KP-N-YN [34] from T. Sugimoto, Kyoto Prefectural University of Medicine, Japan); glioma, U373 MG, Ishikawa, KHG2 (established by N. Yamaguchi); oligodendroglioma, HOG (a gift from G. Dawson, University of Chicago, IL); ovarian cancer, OVK18 (supplied by the Institute of Development, Aging and Cancer, Tohoku University, Japan), SKOV-3 (ATCC HTB-77); endometrial tumor, Ishikawa-EM [35], epider- moid, A431 (ATCC CRL-1555); breast cancer, MCF-7 (ATCC HTB-22); thyroid cancer, T3M-1 [36]; liver, Chang

Purified recombinant prosemin was activated by incubation with recombinant enterokinase (EK Max, Invitrogen), which was immobilized on NHS–Sepharose, at 37 (cid:1)C overnight to remove the N-terminal sequence from Asp-Asp-Asp-Asp- Lys. An aliquot of activated prosemin was incubated with

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4921

Enzyme assay

S. Mitsui et al.

A novel serine protease in various cancer cells

lymphoma, K562 (ATCC CCL-243); (ATCC CCL-13); kidney, OUR-10 (supplied by Osaka University, Japan); endothelial cell line, HUE (established by N Yamaguchi).

2 Qian Z, Gilbert ME, Colicos MA, Kandel ER & Kuhl D (1993) Tissue-plasminogen activator is induced as an immediate-early gene during seizure, kindling and long- term potentiation. Nature 361, 453–457.

3 Tsirka S, Gualandris A, Amaral DG & Strickland S

(1995) Excitotoxin-induced neuronal degeneration and seizure are mediated by tissue plasminogen activator. Nature 377, 340–344.

4 Hirata A, Yoshida S, Inoue N, Matsumoto-Miyai K, Ninomiya A, Taniguchi M, Matsuyama T, Kato K, Iizasa H, Kataoka Y, Yoshida N & Shiosaka S (2001) Abnormalities of synapses and neurons in the hippo- campus of neuropsin-deficient mice. Mol Cell Neurosci 17, 600–610.

5 Puente XS, Sanchez LM, Overall CM & Lopez-Otin C (2003) Human and mouse proteases: a comparative genomic approach. Nat Rev Genet 4, 544–558.

6 Yamaguchi N, Okui A, Yamada T, Nakazato H &

Total RNA and polyA+ RNA were prepared from cultured cells using Trizol reagent (Invitrogen) and a Quick Prep mRNA Purification Kit (Amersham Pharmacia Biotech), respectively, according to the manufacturers’ manuals. PolyA+ RNAs from various human tissues were purchased from Clontech. cDNA synthesis was performed as des- cribed above. The PCR was performed for 35 cycles of 95 (cid:1)C for 30 s, 56 (cid:1)C for 30 s, and 72 (cid:1)C for 30 s, using the forward primer 5¢-GTGAGCATCCAGAAGAATGG-3¢, and the reverse primer 5¢-AAGTAGCCGGCACACAG CAT-3¢. PCR products were analyzed by 1% (w ⁄ v) agarose gel electrophoresis.

RT-PCR

Mitsui S (2002) Spinesin ⁄ TMPRSS5, a novel transmem- brane serine protease, cloned from human spinal cord. J Biol Chem 277, 6806–6812.

7 Yamamura Y, Yamashiro K, Tsuruoka N, Nakazato H, Tsujimura A & Yamaguchi N (1997) Molecular cloning of a novel brain-specific serine protease with a kringle-like structure and three scavenger receptor cysteine-rich motifs. Biochem Biophys Res Commun 239, 386–392.

8 Iijima N, Tanaka M, Mitsui S, Yamamura Y, Yamagu- chi N & Ibata Y (1999) Expression of a serine protease (motopsin PRSS12) mRNA in the mouse brain: in situ hybridization histochemical study. Mol Brain Res 66, 141–149.

9 Mitsui S, Yamada T, Okui A, Kominami K, Uemura H & Yamaguchi N (2000) A novel isoform of a kallikrein- Iike protease TLSP ⁄ Hippostasin (PRSS20) is expressed in the human brain & prostate. Biochem Biophys Res Commun 272, 205–211.

10 Yamshiro K, Tsuruoka N, Kodama S, Tsujimoto M,

Paraffin-embedded specimens were cut into 4 lm sections. Sections had paraffin removed by passage through xylene and a graded series of ethanol (100–70%), and the slides were treated in STUF solution (Serotec, Oxford, UK) at 95 (cid:1)C for 10 min to activate the immunoantigen. The slides were incu- bated in methanol containing 0.3% (v ⁄ v) H2O2 for 30 min at room temperature and washed with NaCl ⁄ Pi-Tween three times. The immunodetection of prosemin was performed using a Vectastain ABC kit (Vector Laboratories Inc., Bur- lingame, CA). The slides were blocked with normal horse serum for 60 min. Diluted antibody directed against recom- binant prosemin was placed on the slides overnight. Slides were washed with NaCl ⁄ Pi-Tween, and covered with biotin- ylated horse anti-rabbit secondary antibody for 1 h. The slides were washed, and reacted with an avidin–horseradish peroxidase–biotin complex for 1 h. The immunoreaction was in 20 mm Tris ⁄ HCl detected by incubating the slides (pH 7.5) containing 3,3¢-diaminobenzidine and aliquots of H2O2.

Yamamura Y, Tanaka T, Nakazato H & Yamaguchi N (1997) Molecular cloning of a novel trypsin-like serine protease (neurosin) preferentially expressed in brain. Biochim Biophys Acta 1350, 11–14.

Immunohistochemistry

Acknowledgements

11 Ogawa K, Yamada T, Tsujioka Y, Taguchi J, Takaha-

shi M, Tsuboi Y, Fujino Y, Nakajima M, Yamamoto T, Akatsu H, Mitsui S & Yamaguchi N (2000) Localiza- tion of a novel type trypsin-like serine protease, neuro- sin, in brain tissues of Alzheimer’s disease and Parkinson’s disease. Psychiatry Clin Neurosci 54, 419–426.

12 Mitsui S, Tsuruoka N, Yamashiro K, Nakazato H &

We thank Drs Sugimoto and Dawson for providing neuroblastoma and oligodendroglioma, respectively. This work was supported in part by a Grant-in-Aid for Scientific Research (B) from Japan Society for Pro- motion of Science.

References

Yamaguchi N (1999) A novel form of human neuropsin, a brain-related serine protease, is generated by alterna- tive splicing and is expressed preferentially in human adult brain. Eur J Biochem 260, 627–634.

1 Turgeon VL & Houenou LJ (1997) The role of thrombin- like (serine) proteases in the development, plasticity and pathology of the nervous system. Brain Res Rev 25, 85–95.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4922

S. Mitsui et al.

A novel serine protease in various cancer cells

13 Underwood LJ, Tanimoto H, Wang Y, Shigemasa K,

26 Ellis RJ (1998) Steric chaperones. Trends Biochem Sci

23, 43–45.

Parmley TH & O’Brien TJ (1999) Cloning of tumor- associated differentially expressed gene-14, a novel serine protease overexpressed by ovarian carcinoma. Cancer Res 59, 4435–4439.

14 Magklara A, Scorila A, Katsaros D, Massobiro M,

27 Yu JX, Chao L & Chao J (1994) Prostasin is a novel human serine proteinase from seminal fluid. Purifica- tion, tissue distribution, and localization in prostate gland. J Biol Chem 269, 18843–18848.

28 Reseland JE, Larsen F, Solheim J, Eriksen JA, Hanssen LE & Prydz H (1997) A novel human chymotrypsin-like digestive enzyme. J Biol Chem 272, 8099–8104.

Yousef GM, Fracchioli S, Danese S & Diamandis EP (2001) The human KLK8 (Neuropsin ⁄ Ovasin) gene: Iden- tification of two novel splice variants and its prognostic value in ovarian cancer. Clin Cancer Res 7, 806–811.

15 Diamandis EP, Yousef GM, Soosaipillai AR &

Bunting P (2000) Human kallikrein 6 (zyme ⁄ protease M ⁄ neurosin): a new serum biomarker of ovarian carcinoma. Clin Biochem 33, 579–583.

29 Sarath G, Zeece MG & Penheiter AR (1989) Protease assay methods. In Proteolytic Enzymes: a Practical Approach, 2nd ed. (Baynon RJ & Bond JS, eds), pp. 45–76. Oxford University Press, Oxford, UK. 30 Lee R, Kermani P, Teng KK & Hempstead BL (2002) Regulation of cell survival by secreted proneurotro- phins. Science 294, 1945–1948.

16 Nakamura T, Mitsui S, Okui A, Kominami K, Nomoto T, Ukimura O, Kawauchi A, Miki T & Yamaguchi N (2001) Alternative splicing isoforms of hippostasin (PRSS20 ⁄ KLK11) in prostate cancer cell lines. Prostate 49, 72–78.

31 Shigemasa K, Underwood LJ, Beard J, Tanimoto H, Ohama K, Parmley TH & O’Brien TJ (2001) Overex- pression of testisin, a serine protease expressed by testi- cular germ cells, in epithelial ovarian tumor cells. J Soc Gynecol Invest 7, 358–362.

17 Diamandis EP, Okui A, Mitsui S, Luo L-Y, Soosaipillai A, Grass L, Nakamura T, Howarth DJC & Yamguchi N (2002) Human kallikrein 11: a new biomarker of prostate and ovarian carcinoma. Cancer Res 62, 295–300.

32 Mok SC, Chao J, Skates S, Wong K-K, Yiu GK, Muto MG, Berkowitz RS & Cramer DW (2001) Prostasin, a potential serum marker for ovarian cancer: identifica- tion through microarray technology. J Natl Cancer Inst 93, 1458–1464.

18 Yousef GM & Diamandis EP (2001) The new human tissue kallikrein gene family: structure, function, and association to disease. Endocr Rev 22, 184–204. 19 Borgon˜ o CA, Michael IP & Diamandis EP (2004)

Human tissue kallikreins: Physiologic roles and applica- tions in cancer. Mol Cancer Res 2, 257–280.

33 Okui A, Kominami K, Uemura H, Mitsui S & Yamagu- chi N (2001) Characterization of a brain-related serine protease, neurosin (human kaillikrein 6), in human cere- brospinal fluid. Neuroreport 12, 1345–1350.

20 Boron˜ o CA & Diamandis EP (2004) The emerging roles of human tissue kallikreins in cancer. Nat Rev Cancer 4, 876–890.

21 Kozak M (1981) Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes. Nucleic Acids Res 8, 5233–5262.

34 Sugimoto T, Ueyama H, Hosoi H, Inazawa J, Kato T, Kemshead JT, Reynolds CP, Gown AM, Mine H & Sawada T (1991) Alpha-smooth-muscle actin and des- min expressions in human neuroblastoma cell lines. Int J Cancer 48, 277–283.

22 Caughey GH, Raymond WW, Blount JL, Hau LW-T, Pallaoro M, Wolaters PJ & Verghese GM (2000) Char- acterization of human gamma-tryptases, novel members of the chromosome 16p mast cell tryptase and prostasin gene families. J Immunol 164, 6566–6575.

35 Chatzaki E, Bax CM, Eidne KA, Anderson L, Grud- zinskas JG & Gallagher CJ (1996) The expression of gonadotropin-releasing hormone and its receptor in endometrial cancer, and its relevance as an autocrine growth factor. Cancer Res 56, 2059–2065.

36 Sato K, Fujii Y, Kakiuchi T, Kasano K, Imamura H, Kondo Y, Mano H, Okabe T, Asano S, Takaku F, Tsuchima T & Shizume K (1989) Paraneoplastic syn- drome of hypercalcemia and leukocytosis caused by squamous carcinoma cells (T3M-1) producing parathyr- oid hormone-related protein, interleukin 1 alpha, and granulocyte colony-stimulating factor. Cancer Res 49, 4740–4746.

23 Hooper JD, Bowen N, Marshall H, Cullen LM, Sood R, Daniels R, Stuttgen MA, Normyle JF, Higgs DR, Kastner DL, Ogbourne SM, Pera MF, Jazwinska EC & Antalis TM (2000) Localization, expression and geno- mic structure of the gene encoding the human serine protease testisin. Biochim Biophys Acta 1492, 63–71. 24 Yu JX, Chao L, Ward DC & Chao J (1996) Structure and chromosomal localization of the human prostasin (PRSS8) gene. Genomics 32, 334–340.

Supplementary material

25 Wong GW, Li L, Madhusudhan MS, Krilis SA, Gurish MF, Rothenberg ME, Sali A & Stevenes RL (2001) Human tryptase epsilon (PRSS22), a new member of the chromosome 16p13.3 family of human serine pro- teases expressed in airway epithelial cells. J Biol Chem 276, 20648–20658.

FEBS Journal 272 (2005) 4911–4923 ª 2005 FEBS

4923

The following supplementary material is available for this article online: Fig. S1.