Báo cáo khoa học: A novel Takeout-like protein expressed in the taste and olfactory organs of the blowfly, Phormia regina

A novel Takeout-like protein expressed in the taste and olfactory organs of the blowfly, Phormia regina Kazuyo Fujikawa, Keiji Seno and Mamiko Ozaki

Department of Applied Biology, Faculty of Textile Science, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto, Japan

Keywords chemoreceptor; fly; olfaction; takeout; taste

Correspondence M. Ozaki, Kobe University, Rokkodai, Nada-ku, Kobe, 657-8501, Japan Fax: +81 803 5718 Tel: +81 78 803 5718 E-mail: mamiko@port.kobe-u.ac.jp

(Received 19 December 2005, revised 27 June 2006, accepted 24 July 2006)

doi:10.1111/j.1742-4658.2006.05422.x

In insects, the functional molecules responsible for the taste system are still obscure. The gene for a 28.5 kDa protein purified from taste sensilla of the blowfly Phormia regina belongs to a gene family that includes takeout of Drosophila melanogaster. Molecular phylogenetic analysis revealed that the Phormia Takeout-like protein is most similar to the protein encoded by a member of the Drosophila takeout gene family, CG14661, whose expression and function have not been identified yet. Western blot analyses revealed that Phormia Takeout-like protein was exclusively expressed in antennae and labellum of the adult blowfly in both sexes. Immunohistochemical experiments demonstrated that Takeout-like protein was localized around the lamella structure of the auxiliary cells and in the sensillar lymph of the labellar taste sensillum. In antennae, Takeout-like protein was distributed at the base of the olfactory sensilla as well. No significant differences in Takeout-like protein expression were found between the sexes. Our results suggest that Phormia Takeout-like protein is involved in some early events concerned with chemoreception in both the taste and olfactory systems.

NO, is a second messenger in the transduction cascade of sugar receptor cells [13,14]. On the other hand, the Gqa subunit and inositol 1,4,5-trisphosphate have been suggested to be involved in the adaptation process of sugar receptor cells [15,16]. However, except for the Gqa subunit, the molecular components of Phormia taste reception or transduction have not yet been identi- fied, such as taste receptors, NO synthase, soluble guan- ylyl cyclase and the cyclic nucleotide-gated channel.

compounds

In the present study, we isolated various proteins expressed in the labellar chemosensilla of Phormia and analyzed their N-terminal amino acid sequences in order to identify the functional proteins involved in the taste reception or transduction of insects. A soluble 28.5 kDa protein purified from the chemosensilla showed similarity to the protein encoded by a member of the Drosophila takeout gene family.

By a PCR-based cDNA subtraction between wild- type and cyc01 mutant flies takeout was first cloned and identified as a novel circadian clock-regulated gene

The contact chemosensilla on the labellum, which are major taste organs of the fly, are in the form of a hair housing four taste receptor cells and one mechanorecep- tor cell [1]. Taste transduction is triggered by the recep- tion of tastants on the receptor membrane of the taste receptor cells, but the molecular mechanisms of signal transduction in the taste system are still unclear. In Drosophila, 68 Gr genes, which encode G-protein-cou- pled receptors, have been identified from the Drosophila genome database [2–6]. Among these Gr genes, Gr5a encodes a receptor for trehalose [7,8], and Gr66a encodes a receptor [9–11]. for bitter Gr68a encodes a male-specific receptor for nonvolatile female pheromones [12]. Thus, it has been suggested that in Drosophila, the G-protein-coupled transduction cascade exists in the sugar and bitter compound recep- tor cells and the pheromone receptor cells of male-speci- fic taste bristles on the forelegs. In the blowfly Phormia regina, it has been suggested that cGMP, which may be synthesized via soluble guanylate cyclase activation by

Abbreviations BPB, bromophenol blue; CRLBP, chemical sense-related lipophilic ligand-binding protein; JH, juvenile hormone; JHBP, juvenile hormone- binding protein; OBP, odorant-binding protein; TOL, Takeout-like protein.

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4311

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

containing various proteins. Proteins of the soluble frac- tion were separated by two-dimensional SDS ⁄ PAGE analysis, and isolated from the SDS polyacrylamide gel; their N-terminal amino acid sequences were then deter- mined. Sixty-four spots of soluble proteins were isolated from the SDS polyacrylamide gel. Among these pro- teins, the N-terminal sequences of 17 spots or 16 pro- teins (one protein appeared as two separate spots for an unknown reason) showed similarities to proteins in the database (Table 1). N-terminal sequences of 20 spots were determined but no homologs were found in the database, and those of 27 spots were not identified, possibly due to N-terminal blocking. Every protein spot seemed to be localized in the receptor or perireceptor region of the taste organ, because of the tissue-limited sample preparation. Among the 16 proteins identified, we focused on a protein whose apparent molecular mass was 28.5 kDa and pI was 5.65, because, as mentioned below, it had a particular similarity to a Takeout homo- log of Drosophila melanogaster.

in Drosophila. This gene product was thought to be a secretory protein because of its putative signal peptide sequence [17]. It has been reported that takeout RNA is expressed in the brain-associated fat body of males, cardia, crop and antennae. These tissues are related to food-seeking, feeding or digestion. However, Takeout was not expressed in the proboscis, which contains the taste organ [17–19]. The takeout null mutant showed an abnormal behavioral response to starvation [17]. Dauwalder et al. [19] have shown that a loss-of-func- tion mutation in the takeout gene reduced male court- ship behavior. These studies suggested that Drosophila Takeout plays a role in regulating the feeding and mat- ing behavior of males. In Aedes aegypti, the takeout gene was isolated from a male antennal cDNA library [20]. Interestingly, a 28.5 kDa protein of Phormia was found in the chemosensilla of labella. The expression of this protein was strikingly different from that of the proteins encoded by the Drosophila and Aedes takeout genes mentioned above. In this study, we examined localization of the expression of Phormia Takeout-like protein (TOL) by western blot and immunohistochemi- cal analyses.

cDNA cloning and sequence analysis of Phormia TOL

Results

Soluble proteins in the taste sensillum

We isolated the chemosensilla from the labellum of the blowfly Phormia regina, and prepared a soluble fraction

We amplified a cDNA sequence of TOL encoding the complete coding region from Phormia. Figure 1 shows the cDNA and amino acid sequences of TOL. The protein consists of 245 amino acids. The N-terminal residue was not Met but Ala, indicating that a putative signal peptide of 18 amino acids at the N-terminus

Table 1. Soluble proteins detected in labellar chemosensilla. Amino acids divided by slash marks: appropriate residues that were not identically determined. Amino acids in parentheses: not absolutely but putatively determined residues. Underscores indicate amino acids not identified.

Molecular mass (kDa)

N-terminal amino acid sequence

Candidate protein or gene

Aconitase Arginine kinase Arginine kinase CG9498 (JHI-26) CG14277 CG14661, Takeout CRLBP Enolase GST Malate dehydrogenase 1 Obp44a PBPRP Protein disulfide isomerase Sod 2 Transferrin Triosephosphate isomerase Yellow-c

81 42 43.5 47.5 19 28.5 26 48.5 27 37 17 19.5 57 25.5 71 28 49

_K ⁄ VVA ⁄ Q_KKF ⁄ ADP(A)V ⁄ KFL VDAAVLAKLEEG_A(H)L_A_D _DAAVLAKLE (T)(R ⁄ I)KNDNNIFVPDKLL ⁄ (N)EK_FI ⁄ SNA ⁄ L_LE (Y)N ⁄ DG ⁄ P_ ⁄ EK ⁄ AARV ⁄ (A)I ⁄ (P)G ⁄ KA_ ⁄ EN_ ⁄ AG_ ⁄ (N)DAIIT(H)(E) AQLPD_IKV ELTKEEAITIATECKEEAGASD PIKKIFAAQ(I)FD(T)N TKLTL_GLDA YKVTVCGASGGIGQPL(F)DL(L)S ⁄ AE (E)_KLRN ⁄ (K)(Q)EDLVKARKE(H)MKA(K)KV(E)T_(L) FDK ⁄ LK ⁄ DA ⁄ N ⁄ TA ⁄ V ⁄ LI ⁄ QAA ⁄ DFLAQMDD(C)_(A)E_(V) DKEVKTED(G)V_V(E)_T(K) KHTL_(P) E(I)EQIYRMCVPQK(Y)YED(C)LN(L)LKDP_(E) TR ⁄ VK ⁄ PF ⁄ (E)C ⁄ RV ⁄ KGG ⁄ AN_ ⁄ RKMNGDKQVIAE_(A)(K)(N) KLEEKF(Q)_K_L(V)(F)N

CRLBP, chemical sense-related lipophilic ligand-binding protein; GST, glutathione S-transferase; PBPRP, pheromone-binding protein-related protein.

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4312

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Fig. 1. cDNA and amino acid sequences of Phormia Takeout-like protein (TOL). The amino acid numbers are given on the right side of each line. The predicted signal peptide is underlined. The stop codon at the 3¢-end of TOL is indicated by an asterisk. The in-frame stop codons at the 5¢-untranslated region of TOL are also indicated by asterisks. The two Cys residues are indicated by arrowheads.

(indicated by SignalP V3.0)

was processed. This is consistent with a predicted clea- vage site between amino acids 18 and 19 in Drosophila Takeout [20,21]. The cDNA sequence of the putative signal peptide was obtained by 5¢RACE. The nucleotide sequence data of TOL are available in the NCBI database with acces- sion number AB183150.

In a molecular phylogenetic tree of Takeout family proteins shown in Fig. 2, TOL is clustered with Dro- sophila CG14661. The amino acid identity of TOL with Drosophila CG14661 was 65%, whereas the iden- tities with other Takeout members were below 30%.

TOL in tissues of 5-day-old adult flies (Fig. 4A). The antibody in the antiserum used recognized a single band of 28 kDa in the antennae of both sexes. In the labella, a 28.5 kDa band was primarily detected in both sexes, and an additional 27.5 kDa band was detectable in males only. No specific signals were detected in the compound eye or the other parts of head, thorax or abdomen (signals at 38 kDa in the other parts of the male head and at 42 kDa in the thorax of both sexes were probably due to the non- specific immunoreactions with peptides that are abun- dant in those tissues). In addition, no specific signals were detectable in any parts of the head in the con- trol experiment using preimmune serum instead of the antiserum (Fig. 4B). These results indicated that TOL is exclusively distributed in the chemosensory organs of both sexes.

Figure 3 shows the sequence alignment of TOL together with CG14661 and Takeout of Drosophila. Sequences of some other Takeout members of Dro- sophila, Aedes aegypti and Anopheles gambiae are also aligned for comparison. TOL contains two Cys resi- dues in the N-terminal region (Figs 1 and 3, arrow- heads). These residues are highly conserved in Takeout family proteins and might be involved in disulfide bond formation and ligand binding [17,19].

Chemosensory tissue-specific distribution of TOL

the polypeptide of

the N-terminal

In order to investigate the tissue distribution of TOL, immunoblot analysis using serum we carried out against region. Using the antiserum, we examined the expression of

We further examined the expression of TOL in labella of the pupa and younger adult flies. The labella isolated from the pupa (2 days before eclosion) and the adult flies (0, 2 and 5 days after eclosion) were used for the experiment. As shown in Fig. 4C, the pre- dominant peptide of 28.5 kDa was increased after eclo- sion in an age-dependent manner in both sexes. On the other hand, the 27.5 kDa band was detectable on days 2 and 5 in the adult male, but only on day 2 in the adult female. This result is consistent with the above immunoblot analysis (Fig. 4A). No signals were identi-

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4313

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Fig. 2. Phylogenetic tree of the takeout gene family. Phormia TOL (bold) clusters with Drosophila melanogaster CG14661 (DmelCG14661). The phylogenetic tree was constructed by the neighbor-joining method using the CLUSTALW program. Dmel, Drosophila melanogaster (fruit fly); Preg, Phormia regina (blowfly); Agam, Anopheles gambiae (African malarial mosquito); Aaeg, Aedes aegypti (yellow fever mosquito); Dyak, Drosophila yakuba (fruit fly); Msex, Manduca sexta (tobacco hornworm). Msex Moling [24] and Msex JHBP-pre are the putative juven- ile hormone (JH)-binding protein and the JH-binding protein precursor-like protein of Manduca sexta, respectively. Dmel CG2650 and Dyak CCCP-pre are genes adjacent to the period gene and encode the circadian clock-controlled protein precursors. Bar ¼ 0.1 evolutionary dis- tance.

We further

investigated the subcellular

fied in the pupae, indicating that TOL expression was induced around eclosion.

Cellular and subcellular localization of TOL in chemosensory organs

the base of

the auxiliary cells at

the base of

localiza- tion of TOL in the labellum by immunoelectron microscopy (Fig. 6). Colloidal gold particles indicat- ing tissue localization of TOL were observed in the lymph cavity surrounded by the lamella sensillar structure of the taste sensillum (Fig. 6A). Again, no significant immu- noreactivity was detected in the receptor cell region. In detail, the signals were localized at the tip of the lamellae of the auxiliary cells and in the sensillar lymph (Fig. 6B). In the control experiment using pre- immune serum, no significant signal was detected in either the auxiliary cells or the receptor cells (data not shown). These results agreed with the immuno- fluorescent staining findings (Fig. 5), suggesting that TOL is secreted to the sensillar lymph from the aux- iliary cells.

Discussion

In the present study, we identified 16 proteins in the contact chemosensillar soluble fraction of Phormia by

We immunohistochemically investigated the localiza- tion of TOL in the chemosensory organs of Phormia. Figure 5 shows the immunofluorescent staining of cry- osections of the labellum and antenna with anti-TOL serum. Fluorescent signals were observed at the base of the taste sensilla in the labellum (Fig. 5B–D) and the olfactory sensilla in the antenna (Fig. 5F,G). In the labellar sensillum, a ring-shaped strong fluores- cence was observed at the sensillum (Fig. 5C,D), whereas no signal was detected inside of sensillar shafts, where dendritic processes of four che- moreceptor cells are housed, or beneath the sensillar shafts, where receptor cell bodies are located. This pat- tern of staining appeared to agree with the distribution of the auxiliary cells, suggesting that TOL was distri- buted in the auxiliary cells.

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4314

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Fig. 3. Comparison of amino acid sequence of Phormia Takeout-like protein (TOL) with its related proteins. Amino acid sequences of Dro- sophila melanogaster (Dmel) Takeout, Aedes aegypti (Aaeg) Takeout, Anopheles gambiae (Agam) Takeout and some other related proteins are aligned together with Phormia regina (Preg) TOL. The amino acid residues identical to those of Preg TOL are shaded. Asterisks indicate the amino acid residues conserved in most members of the Takeout family. The two conserved Cys residues are indicated by arrowheads.

lipophilic

In those proteins, ligand-binding

means of two-dimensional electrophoresis and protein chemical sequencing (Table 1). sense-related protein (CRLBP) has previously been documented as an odor- ant-binding protein (OBP) specifically expressed in the chemosensilla of both the taste and olfactory organs of Phormia [23]. Except for CRLBP, TOL is the first pro- tein for which we demonstrated chemosensillum-speci- fic expression in our two-dimensional PAGE analysis, and the localizations and functions of others will be clarified in the future.

three reasons: (a) the sequence of the polypeptide used as antigen was chosen from the definitive motifs for the Takeout family [18], and similar sequences to this polypeptide were not found in the N-terminal regions of any other Takeout family members; (b) we could not find any Takeout family members other than TOL in the present two-dimensional gel; and (c) no specific signals were detected in the negative control experi- ments using the preimmune serum instead of the anti- serum (Figs 4 and 5). Therefore, we are sure of the specificity of the antiserum.

Although the specificity of the antiserum used was not strictly confirmed, it may not crossreact with other Takeout-related proteins in Phormia for the following

Phylogenetic analysis of Takeout proteins indicated that TOL and CG14661 belong to the same cluster. The amino acid identities of TOL with Drosophila

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4315

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

A

B

C

Fig. 4. Immunoblot analysis of Takeout-like protein (TOL) expression in Phormia tissues. (A) Distribution of TOL in male and female Phormia head and body (5 days after eclo- sion). Soluble fractions from two antennae (a), two labella (l), one-fifth compound eye (c), one-fifth other parts of head (o), one- hundredth of thorax (T) and one-hundredth of abdomen (A) were applied to the lanes, respectively, and proteins transferred onto a nitrocellulose membrane were stained either with Coomassie brilliant blue (left) or with anti-TOL serum (right). (B) Control experi- ment using preimmune serum instead of anti-TOL serum. Equal amounts of proteins from the head tissues indicated in (A) were applied to each lane and reacted with pre- immune serum. (C) TOL expression in male and female Phormia labella from pupae (2 days before eclosion) and adult flies (0, 2 and 5 days after eclosion). The soluble frac- tion from a single labellum was applied to each lane.

other Drosophila Takeout family members also showed male head-specific expression. Thus, Drosophila Take- out and some other Takeout family members might be involved in regulation of some male-specific behaviors such as courtship behavior.

lacking. Recently,

In contrast, Phormia TOL was expressed in both males and females, but exclusively expressed in chemo- sensory organs and not in other parts of heads, thorax and abdomen (Fig. 4). These results suggest that Phor- mia TOL and probably Drosophila CG14661, the most similar protein to TOL, have nonsex-specific functions, unlike Drosophila Takeout, although information on the expression and function of Drosophila CG14661 is in Nasutitermes takasagoensis, still it has been reported that a soldier-specific protein, Ntsp1, has some homologies with JHBP or Takeout- related proteins of other insects [27]. Expression of the Ntsp1 gene was found in the frontal gland, and it was suggested that Ntsp1 binds terpenoids or fatty acids. However, the amino acid identities of Ntsp1 with Dro- sophila CG14661 or Phormia TOL were less than 30%. Thus, it is difficult to predict the biological function and putative ligand of TOL by comparison with known related proteins.

CG14661 were higher than 80% (less than 65% with other Takeout members) in both the two motifs that define the Takeout family [18]. This suggests that Dro- sophila CG14661 is a homolog of Phormia TOL. Addi- tionally, the genes encoding a lipophilic ligand-binding protein, Moling, and the hemolymph juvenile hor- mone-binding protein (JHBP) of Manduca sexta [24], are in the same gene family (Fig. 2). TOL contains two Cys residues at the N-terminal region, which are completely conserved in this family (Fig. 3). The hemolymph JHBP of Manduca is synthesized in the fat body, secreted into the hemolymph, and then binds the lipophilic JH molecule and transports it to the target tissues [25,26]. The two Cys residues at the N-terminal region of JHBP were demonstrated to be important in disulfide bond formation and ligand-binding ability [26]. Thus, Phormia TOL and Drosophila Takeout fam- ily members might have some ligand-binding proper- ties. Even in Drosophila Takeout family proteins, no putative ligands have been reported yet. However, it has been suggested that Drosophila Takeout or other Takeout family members associate with JH or some other lipophilic ligands similar to JH, because takeout RNA was exclusively expressed in the head fat body of male flies [19]. In addition, Dauwalder et al. [19] demonstrated that a loss-of-function mutation in the takeout gene reduced male courtship behavior. Some

A noteworthy characteristic of TOL is the localiza- tion to the sensillar lymph cavity at the base of the chemosensillar shafts. The signal peptide at the

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4316

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Fig. 5. Immunohistochemical localization of Takeout-like protein (TOL) in taste and olfac- tory organs of Phormia. Frozen sections of labella (A–D) and antennae (E–G) were stained with anti-TOL serum and visualized with rhodamine-conjugated secondary anti- body. (A, E) Control experiments using pre- immune serum instead of antiserum. Bar ¼ 100 lm. (B, F) Longitudinal sections of the labellum and the antenna stained with anti-TOL serum. Bar ¼ 100 lm. (C, D) Higher-power magnification images of label- lar sensilla (arrowhead in B). Bar ¼ 20 lm. (G) Higher-power magnification image of the antenna in (F). Bar ¼ 20 lm.

a major Phormia OBP, CRLBP, and TOL in their distribution in the sensillar lymph cavity; CRLBP was uniformly distributed [23] but TOL was particularly localized around the auxiliary cell membranes. This might suggest not only that TOL is secreted from the auxiliary cells, but also that TOL carries something to the auxiliary cells.

secretion to the

N-terminus suggests that TOL is a secretory protein, and this is consistent with its extracellular localization. Furthermore, this result is reminiscent of the localiza- tion of insect OBPs. OBPs are small, water-soluble proteins that are widely found in chemosensory sys- tems of most terrestrial animals [28–30]. In insects, many OBPs have been reported. They are specifically expressed in the hydrophilic sensillum lymph surround- ing olfactory neurons [31–34]. The OBPs are involved in the first specific biochemical step in odor reception and are thought to carry lipophilic odorants to the olfactory receptor cells through hydrophilic surround- ings [28,29,35–40]. Some OBPs are expressed in both taste and olfactory tissues [23,33,41]. Therefore, TOL might also be involved in the early event in perception of the chemical signals in both the taste and olfactory systems. However, we noted a clear difference between

In Phormia, it has been reported that JH affects the sensitivity of the labellar chemosensilla [42]. This sug- gests that the JH analog stimulates mucopolysaccha- sensillum lymph from the ride accessory cells. The mucopolysaccharide could affect the electrical resistance of the labellar chemosensilla. However, it was not mentioned how JH could target the auxiliary cells. One possible explanation is that TOL might carry endogenous lipophilic ligands with to the auxiliary cells like JH, hormonal

functions,

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4317

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Fig. 6. Electronmicrographs of immunocytochemical localization of Takeout-like protein (TOL) in labellar taste sensillum of Phormia. (A) Sec- tion through the basement of a sensillum. TOL signals are found in the sensillar lymph cavity (SL), but not in the receptor cell region (R). (B) Higher-power magnification image of the sensillar lymph cavity. Signals are found in the extracellular sensillum lymph and around the lamella structure (L) of the auxiliary cells. Standard bars indicate 1 lm.

sensilla by repeated freezing and vortexing in a plastic tube, and the sensilla adhering to the inner wall of the tube were collected.

through hydrophilic sensillar lymph. The chemosenso- ry systems of the flies might be under regulation by ligands of TOL during their adult stage.

Two-dimensional electrophoresis of soluble proteins

rotor

Our study provides the first suggestion that a mem- ber of the Takeout family is involved in chemosensory perception in both the taste and olfactory systems. The proposal that Drosophila Takeout may bind an endog- enous lipophilic ligand relevant to feeding and olfac- tion [17–19] overlaps with our assumption. In order to obtain a more detailed understanding of chemosensory systems, which can presumably be influenced by unknown hormonal regulation, however, it is import- ant to identify the putative ligand and to examine the behavioral effect of Phormia TOL or Drosophila CG14661.

Experimental procedures

Flies

The blowflies, Phormia regina, originally donated from Morita’s laboratory in Kyushu University, were reared in our laboratory at 22 ± 2 (cid:2)C, and after emergence, fed with 0.1 m sucrose and water.

Purification of taste hairs

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4318

Isolated sensilla were homogenized on ice and washed twice with 0.1 mL of Mops buffer (10 mm Mops ⁄ HCl, pH 7.2, 1 mm EDTA, 0.2 mm phenylmethanesulfonyl fluoride) each. After every centrifugation (452 000 g, 1 h at 4 (cid:2)C, Hitachi CS120GX, Hitachi, Tokyo, Japan, type S55A2), the supernatant was subsequently placed in a tube. Proteins in this supernatant were precipitated with the Plus One 2-D Clean-Up kit (Amersham Bioscience, Piscataway, NJ, USA) with a standard protocol and resolubilized with 200 lL of urea ⁄ Chaps buffer [7 m urea, 2 m thiourea, 2% Chaps, 0.5% IPG buffer (pH 3–10), 18 mm dithiothreitol and a trace of bromophenol blue (BPB)]. The resolubilized sample was applied to immobiline dry strip (pH 3–10, 11 cm, Amersham Bioscience) and the dry strip was reswelled overnight. Isoelectric focusing of the reswelled strip was performed with the IPGphor Isoelectric Focusing System (Amersham Bioscience), using the standard proto- the strip was incubated in 50 mm col. After the IEF, Tris ⁄ HCl buffer (pH 8.8), 6 m urea, 30% glycerol, 2% SDS, trace of BPB and 65 mm dithiothreitol for 15 min, and subsequently incubated in 50 mm Tris ⁄ HCl (pH 8.8), 6 m urea, 30% glycerol, 2% SDS, trace of BPB and 135 mm iodoacetamide for 15 min, and the strip was We cut the proboscises of flies by hand and collected them in a dry plastic tube on ice. Using a previously reported freeze–vortex method [43], we isolated the labellar chemo-

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

Kubota, Osaka, Japan, rotor type RM-79J2), the superna- tant was separated by 12% SDS ⁄ PAGE. After electro- phoresis, proteins were electrophoretically blotted onto nitrocellulose membrane (Bio-Rad, Hercules, CA, USA), and incubated with anti-TOL serum at 4 (cid:2)C overnight. subjected to two-dimensional SDS ⁄ PAGE using 12% acryl- amide. Proteins separated by two-dimensional PAGE were blotted on PVDF membrane (Immobilon-PSQ; Millipore, Billerica, MA, USA) and stained with Coomassie brilliant blue. Protein spots were excised and analyzed with a protein sequencer (Procise model 494; ABI, Foster City, CA, USA).

Immunofluorescence microscopy

Molecular cloning and cDNA sequencing

for amplification of

Dissected labella and antennae of Phormia were immedi- ately fixed with 4% paraformaldehyde in 0.1 m phosphate buffer (NaCl ⁄ Pi) at pH 7.4 on ice for 2 h, and washed with a graded series of sucrose-containing NaCl ⁄ Pi [5, 10, 15, 20% (w ⁄ v) sucrose in 0.1 m NaCl ⁄ Pi], each step taking 4–12 h at 4 (cid:2)C. The fixed tissues were embedded in a mix- ture of Tissue-Tek OCT Compound (Sakura, Tokyo, Japan) and 20% sucrose-containing NaCl ⁄ Pi (1 : 1), and frozen in liquid nitrogen. Cryosections 10 lm thick were mounted on gelatin-coated glass slides and incubated over- night at 4 (cid:2)C with anti-TOL serum diluted 1 : 100 in 10 mm NaCl ⁄ Pi, 5% goat normal serum, pH 7.4. Sections were then incubated with goat anti-rabbit secondary IgG coupled to Alexa Fluor 594 (Molecular Probes, Carlsbad, CA, USA) diluted 1 : 300 with NaCl ⁄ Pi at 4 (cid:2)C for 5 h. Images were analyzed with a Zeiss confocal laser scanning microscope (LSM510, Zeiss, Gottingen, Germany).

Immunoelectron microscopy

reverse primer vector and

Labella were dissected out from approximately 320 blow- flies (3 days after eclosion), frozen in liquid nitrogen and dehydrated in cold acetone ()30 (cid:2)C) for 1 week. Poly(A)+ RNA was extracted using a PolyATtract system 1000 (Promega, Madison, WI, USA). Single-stranded cDNA was synthesized using an RNA PCR kit (AMV) v. 2.1 (Takara, Otsu, Japan). We designed two oligonucleotide primers [TO-F1, CC(AGTC)GA(TC)TA(TC)AT(ATC)AA (AG)G; TO-R1, TC(AGTC)CC(AG)TT(AG)AA(AGTC)A (AG)(AG)TT] the cDNA partially encoding TOL. The forward primer (TO-F1) was designed on the basis of the determined amino acid sequence, and the reverse primer (TO-R1) was designed on the basis of the conserved amino acid sequence in the members of the Drosophila Takeout family. The amplified cDNA fragment of about 500 bp was subcloned in pGEM-T Easy vector DNA (Promega) and sequenced using a BigDye Termina- tor v. 3.0 Cycle Sequencing Kit and a 310 Genetic Analyz- er (Applied Biosystems, Foster City, CA, USA). In order to obtain the 5¢-end and 3¢-end sequences of TOL, we used the 5¢RACE and 3¢RACE methods. In the 5¢RACE method, double-stranded cDNAs with pTTQ18 [23] vector DNA were used as template. PCR was performed with the forward primer designed from the sequence of the pTTQ18 (TO-R2, the GCATGCCATTATTGGAAGCC). In the 3¢RACE method, a single-stranded cDNA pool was used as a template. PCR was performed with the forward primer (TO-F2, CGTCTTCAGGGAGAAGG) and M13 Primer M4 (Takara), whose sequence was primed to the Oligo(dT)15)18 adapter primer. The PCR products were subcloned and sequenced as described above. The sequences of the cDNA fragment, 5¢RACE and 3¢RACE were combined to obtain the entire TOL sequence.

Western blotting

Labella were dissected out of the flies (5 days after eclosion), and immediately fixed with 4% paraformaldehyde and 0.1% glutaraldehyde in 0.1 m NaCl ⁄ Pi (pH 7.4) on ice for 2 h. After several rinses with NaCl ⁄ Pi, tissues were dehydrated through a graded series of ethanol, and then embedded in medium-grade LRWhite resin (London Resin Co. Ltd, Lon- don, UK). Ultrathin sections 70 nm in thickness were collec- ted on formvar-coated nickel grids, and incubated with (4% BSA, 0.5 m NaCl and gelatin-containing NaCl ⁄ Pi 0.25% gelatin in 0.1 m NaCl ⁄ Pi) at 20 (cid:2)C for 30 min. The sections were then incubated overnight with anti-TOL serum diluted 1 : 30 in gelatin-containing NaCl ⁄ Pi at 4 (cid:2)C. After several rinses with gelatin-containing NaCl ⁄ Pi, the sec- tions were incubated with goat anti-(rabbit) IgG conjugated with 15 nm colloidal gold particles (British Biocell, Cardiff, UK) at 20 (cid:2)C for 30 min. After several rinses with gelatin- containing NaCl ⁄ Pi and subsequently with distilled water, the sections were stained with lead hydroxide, and then observed with a JEM1220 electron microscope (JEOL Ltd, Tokyo, Japan).

Acknowledgements

TOL antiserum was generated in rabbits, using as antigen a polypeptide originating from the determined amino acid sequence at the N-terminus of TOL (amino acid residues 19–28), fused to amino acid KLH. The polyclonal antibody was generated by Shibayagi (Gunma, Japan) and was used for the subsequent work.

We thank Ms Chiyo Tada for her technical assistance in the proteome analysis. This study was supported by a grant from the PROBRAIN to MO.

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4319

The tissue isolated from frozen flies was homogenized on ice and dissolved in SDS-containing buffer. After centrifu- gation at 16 000 g for 5 min (Kubota 1710 centrifuge,

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

References

receptor cell of the blowfly, Phormia regina. J Gen Phys- iol 100, 867–879.

16 Seno K, Fujikawa K, Nakamura T & Ozaki M (2005) Gqa subunit mediates receptor site-specific adaptation in the sugar taste receptor cell of the blowfly, Phormia regina. Neurosci Lett 377, 200–205. 1 Ozaki M & Tominaga Y (1999) Chemoreceptors. In Atlas of Arthropod Sensory Receptors (Eguchi E & Tominaga Y, eds), pp. 143–154. Springer-Verlag, Tokyo. 17 Sarov-Blat L, So WV, Liu L & Rosbash M (2000) The 2 Clyne PJ, Warr CG & Carlson JR (2000) Candidate

taste receptors in Drosophila. Science 287, 1830–1834. 3 Scott K, Brady R Jr, Cravchik A, Morozov P, Rzhetsky Drosophila takeout gene is a novel molecular link between circadian rhythms and feeding behavior. Cell 101, 647–656. 18 So WV, Sarov-Blat L, Kotarski CK, McDonald MJ, A, Zuker C & Axel R (2001) A chemosensory gene family encoding candidate gustatory and olfactory receptors in Drosophila. Cell 104, 661–673.

Allada R & Rosbash M (2000) takeout, a novel Droso- phila gene under circadian clock transcriptional regula- tion. Mol Cell Biol 20, 6935–6944.

4 Dunipace L, Meister S, McNealy C & Amrein H (2001) Spatially restricted expression of candidate taste recep- tors in the Drosophila gustatory system. Curr Biol 11, 822–835.

19 Dauwalder B, Tsujimoto S, Moss J & Mattox W (2002) The Drosophila takeout gene is regulated by the somatic sex-determination pathway and affects male courtship behavior. Genes Dev 16, 2879–2892. 20 Bohbot J & Vogt RG (2005) Antennal expressed genes 5 Robertson HM, Warr CG & Carlson JR (2003) Mole- cular evolution of the insect chemoreceptor gene super- family in Drosophila melanogaster. Proc Natl Acad Sci USA 100, 14537–14542. 6 Amrein H & Thorne N (2005) Gustatory perception of the yellow fever mosquito (Aedes aegypti L.); charac- terization of odorant-binding protein 10 and takeout. Insect Biochem Mol Biol 35, 961–979. and behavior in Drosophila melanogaster. Curr Biol 15, R673–R684. 7 Ueno K, Ohta M, Morita H, Mikuni Y, Nakajima S,

21 Nielsen H, Engelbrecht J, Brunak S & von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng 10, 1–6. 22 Bendtsen JD, Nielsen H, von Heijne G & Brunak S Yamamoto K & Isono K (2001) Trehalose sensitivity in Drosophila correlates with mutations in and expression of the gustatory receptor gene Gr5a. Curr Biol 11, 1451–1455. (2004) Improved prediction of signal peptides: SignalIP 3.0. J Mol Biol 340, 783–795. 8 Dahanukar A, Foster K, van der Goes van Naters WM

& Carlson JR (2001) A Gr receptor is required for response to the sugar trehalose in taste neurons of Drosophila. Nat Neurosci 4, 1182–1186. 9 Thorne N, Chromey C, Bray S & Amrein H (2004) 23 Ozaki M, Morisaki K, Idei W, Ozaki K & Tokunaga F (1995) A putative lipophilic stimulant carrier protein commonly found in the taste and olfactory systems. A unique member of the pheromone-binding protein superfamily. Eur J Biochem 230, 298–308. Taste perception and coding in Drosophila. Curr Biol 14, 1065–1079. 10 Wang Z, Singhvi A, Kong P & Scott K (2004) Taste

24 Du J, Hiruma K & Riddiford LM (2003) A novel gene in the takeout gene family is regulated by hormones and nutrients in Manduca larval epidermis. Insect Biochem Mol Biol 33, 803–814. representations in the Drosophila brain. Cell 117, 981– 991.

25 Lerro KA & Prestwich GD (1990) Cloning and sequen- cing of a cDNA for the hemolymph juvenile hormone binding protein of larval Manduca sexta. J Biol Chem 265, 19800–19806. 11 Marella S, Fischler W, Kong P, Asgarian S, Rueckert E & Scott K (2006) Imaging taste responses in the fly brain reveals a functional map of taste category and behavior. Neuron 49, 285–295. 26 Wojtasek H & Prestwich GD (1995) Key disulfide

12 Bray S & Amrein H (2003) A putative Drosophila phero- mone receptor expressed in male-specific taste neurons is required for efficient courtship. Neuron 39, 1019– 1029. bonds in an insect hormone binding protein: cDNA cloning of a juvenile hormone binding protein of Heliothis virescens and ligand binding by native and mutant forms. Biochemistry 34, 5234–5241.

13 Amakawa T, Ozaki M & Kawata K (1990) Effects of cyclic GMP on the sugar taste receptor cell of the fly Phormia regina. J Insect Physiol 36, 281–286. 14 Murata Y, Mashiko M, Ozaki M, Amakawa T &

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4320

27 Hojo M, Morioka M, Matsumoto T & Miura T (2005) Identification of soldier caste-specific protein in the frontal gland of nasute termite Nasutitermes takasagoen- sis (Isoptera: Termitidae). Insect Biochem Mol Biol 35, 347–354. Nakamura T (2004) Intrinsic nitric oxide regulates the taste response of the sugar receptor cell in the blowfly, Phormia regina. Chem Senses 29, 75–81. 15 Ozaki M & Amakawa T (1992) Adaptation-promoting 28 Vogt RG (1995) Molecular genetics of moth olfac- tion: a model for cellular identity and temporal assembly of the nervous system. In Molecular Model effect of IP3, Ca2+, and phorbol ester on the sugar taste

K. Fujikawa et al.

Takeout-like protein in the chemosensory organs

sensillar esterase of Antheraea polyphemus. Proc Natl Acad Sci USA 82, 8827–8831. Systems in the Lepidoptera (Goldsmith MR & Wilkins AS, eds), pp. 341–367. Cambridge University Press, Cambridge. 29 Pelosi P (1996) Perireceptor events in olfaction. J Neu- 36 Prestwich GD, Du G & Laforest S (1995) How is phero- mone specificity encoded in proteins? Chem Senses 20, 461–469. robiol 30, 3–19. 30 Vogt RG, Callahan ME, Rogers ME & Dickens JC

37 Steinbrecht RA (1996) Are odorant-binding proteins involved in odorant discrimination? Chem Senses 21, 719–727.

(1999) Odorant binding protein diversity and distribu- tion among the insect orders, as indicated by LAP, an OBP-related protein of the true bug Lygus lineolaris (Hemiptera, Heteroptera). Chem Senses 24, 481–495. 31 Steinbrecht RA, Laue M & Ziegelberger G (1995) 38 Ziegelberger G (1996) The multiple role of the phero- mone-binding protein in olfactory transduction. Olfac- tion in mosquito–host interactions. CIBA Found Symp 200, 267–280.

Immunolocalization of pheromone-binding protein and general odorant-binding protein in olfactory sensilla of the silk moths Antheraea and Bombyx. Cell Tissue Res 282, 203–217. 39 Kaissling KE (1996) Pheromone deactivation catalyzed by receptor molecules: a quantitative kinetic model. Chem Senses 23, 385–395.

40 Steinbrecht RA (1999) V. Olfactory receptors. In Atlas of Arthropod Sensory Receptors (Eguchi E & Tominaga Y, eds), pp. 155–176. Springer-Verlag, Tokyo. 41 Koganezawa M & Shimada I (2002) Novel odorant- 32 Hekmat-Scafe DS, Steinbrecht RA & Carlson JR (1997) Coexpression of two odorant-binding protein homologs in Drosophila: implications for olfactory coding. J Neu- rosci 17, 1616–1624.

binding proteins expressed in the taste tissue of the fly. Chem Senses 27, 319–332.

33 Shanbhag SR, Park SK, Pikielny CW & Steinbrecht RA (2001) Gustatory organs of Drosophila melanogaster: fine structure and expression of the putative odorant- binding protein PBPRP2. Cell Tissue Res 304, 423–437. 34 Shanbhag SR, Helmat-Scafe D, Kim MS, Park SK,

FEBS Journal 273 (2006) 4311–4321 ª 2006 The Authors Journal compilation ª 2006 FEBS

4321

42 Angioy AM, Liscia A, Crnjar R, Porcu A, Cancedda A & Pietra P (1983) Mechanism of JH influence on the function of labellar chemosensilla in Phormia: experi- mental suggestions. Boll Soc Ital Biol Sper 59, 1453– 1456. 43 Ozaki M, Amakawa T, Ozaki K & Tokunaga F (1993) Carlson JR, Pikielny C, Smith DP & Steinbrecht RA (2001) Expression mosaic of odorant-binding proteins in Drosophila olfactory organs. Microsc Res Tech 55, 297– 306. 35 Vogt RG, Riddiford LM & Prestwich GD (1985) Kinetic properties of pheromone degrading enzyme: the Two types of sugar-binding protein in the labellum of the fly. Putative taste receptor molecules for sweetness. J Gen Physiol 102, 201–216.