The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex Rachel V. Dunn1, Ker R. Marshall2, Andrew W. Munro1 and Nigel S. Scrutton1
1 Faculty of Life Sciences, Manchester Interdisciplinary Biocentre, University of Manchester, UK 2 Department of Biochemistry, University of Leicester, UK
Keywords kinetic isotope effect; mechanism; monoamine oxidase; pH dependence
Correspondence N. S. Scrutton, Faculty of Life Sciences, Manchester Interdisciplinary Biocentre, University of Manchester, 131 Princess Street, Manchester M1 7DN, UK Fax: +44 161 3068918 Tel: +44 161 3065152 E-mail: nigel.scrutton@manchester.ac.uk
(Received 10 April 2008, revised 25 May 2008, accepted 2 June 2008)
doi:10.1111/j.1742-4658.2008.06532.x
A common feature of all the proposed mechanisms for monoamine oxidase is the initiation of catalysis with the deprotonated form of the amine sub- strate in the enzyme–substrate complex. However, recent steady-state kinetic studies on the pH dependence of monoamine oxidase led to the sug- gestion that it is the protonated form of the amine substrate that binds to the enzyme. To investigate this further, the pH dependence of monoamine oxidase A was characterized by both steady-state and stopped-flow tech- niques with protiated and deuterated substrates. For all substrates used, there is a macroscopic ionization in the enzyme–substrate complex attrib- uted to a deprotonation event required for optimal catalysis with a pKa of 7.4–8.4. In stopped-flow assays, the pH dependence of the kinetic isotope effect decreases from approximately 13 to 8 with increasing pH, leading to assignment of this catalytically important deprotonation to that of the bound amine substrate. The acid limb of the bell-shaped pH profile for the rate of flavin reduction over the substrate binding constant (kred ⁄ Ks, report- ing on ionizations in the free enzyme and ⁄ or free substrate) is due to deprotonation of the free substrate, and the alkaline limb is due to unfa- vourable deprotonation of an unknown group on the enzyme at high pH. The pKa of the free amine is above 9.3 for all substrates, and is greatly per- turbed (DpKa (cid:2) 2) on binding to the enzyme active site. This perturbation of the substrate amine pKa on binding to the enzyme has been observed with other amine oxidases, and likely identifies a common mechanism for increasing the effective concentration of the neutral form of the substrate in the enzyme–substrate complex, thus enabling efficient functioning of these enzymes at physiologically relevant pH.
fore important pharmaceutical targets for the develop- ment of antidepressants and neuroprotective agents [2]. The catalytic cycle for monoamine oxidase activity is shown in Scheme 1.
The mammalian monoamine oxidases (MAO) (EC 1.4.3.4) are flavoproteins localized to the outer mito- chondrial membrane, and contain a FAD cofactor covalently linked via the 8a-methyl group to an active site cysteine residue [1]. They catalyse the oxidative deamination of neurotransmitters (e.g. dopamine and serotonin) and exogenous alkylamines, and are there-
A number of mechanisms for MAO-catalysed amine oxidation have been proposed over the years, and sev- eral reviews are available [3–5]. There are currently
Abbreviations ES, enzyme–substrate; KIE, kinetic isotope effect; MAO, monoamine oxidase; PEA, phenylethylamine; TMADH, trimethylamine dehydrogenase.
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3850
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
Results and Discussion
Catalytically influential macroscopic ionizations
Scheme 1. Catalytic cycle of monoamine oxidase.
The pH dependence of the catalytic rate was studied by both stopped-flow and steady-state techniques. Although the catalytic activity of MAO A has been shown to be dominated by the reductive half-reaction, this may change with pH, leading to a different pH dependence for the reductive half reaction compared to complete catalytic turnover. Also, a range of sub- strates were analysed to establish whether the observed kinetic trends were applicable for all amine substrates. For example, although benzylamine is a well character- ized substrate for MAO A, all naturally occurring sub- strates contain an ethylamine group in the structure.
All
three main mechanistic proposals for MAO catalysis. These comprise: (a) the concerted polar nucleophilic mechanism; (b) the direct hydride transfer mechanism; and (c) the single electron transfer mechanism. Recent support for the concerted polar nucleophilic mecha- nism has come from kinetic and structural studies on tyrosine mutants of MAO B [6], and also from compu- tational studies [7,8]. However, analysis of nitrogen isotope effects conducted on a related amine oxidase, N-methyltryptophan oxidase, supported either a direct hydride transfer mechanism or, possibly, a discrete electron transfer mechanism [9]. Support for a modi- fied single electron transfer mechanism came following the identification of a stable tyrosyl radical in partially reduced MAO A [10]. More recent EPR studies have questioned this assignment and suggested that the rad- ical species detected in partially reduced MAO is due solely to the covalently linked flavin semiquinone, for the direct hydride transfer leading to support mechanism [11].
steady-state kinetic measurements were per- formed in air-saturated buffers, which have been shown to saturate the enzyme with the second sub- strate, oxygen [16]. The kcat values for benzylamine (see supplementary Fig. S1) and kynuramine exhibit a sigmoidal dependence upon pH, as shown in Fig. 1A for kynuramine, indicating the presence of a single macroscopic ionization with a pKa value of 7.9 ± 0.1 obtained from curve fitting for both substrates. The to a observed macroscopic ionization corresponds group in the ES complex that must be deprotonated for optimal activity. The kcat ⁄ Km values exhibit a bell- shaped pH profile with corresponding pKa values of 8.5 ± 0.1 and 9.2 ± 0.1 for benzylamine (see supple- mentary Fig. S1), and 8.0 ± 0.2 and 8.8 ± 0.2 for kynuramine (Fig. 1B). These results indicate that, with increasing pH, a favourable deprotonation step is followed by an unfavourable deprotonation event, either in the free enzyme or free substrate, to produce the bell-shaped pH profile.
A common feature of all the proposed mechanisms is the initiation of catalysis with the deprotonated form of the amine substrate, and it is widely accepted that it is the deprotonated form of the substrate that binds in the functional enzyme–substrate (ES) com- plex [12–14]. By contrast, recent kinetic studies on the pH dependence of the steady-state kinetic param- eters for MAO A were interpreted to indicate that it is the protonated form of the substrate that binds to the enzyme [15]. Due to the conflicting evidence from the relatively few studies on the effects of pH on MAO catalysis, a more comprehensive analysis is required.
The present study reports on the pH dependence of recombinant human liver MAO A as characterized by both steady-state and stopped-flow techniques. The effect of pH on the kinetic isotope effect (KIE) of the reductive half-reaction is also presented. The results obtained provide insight into how monoamine oxidases are able to function efficiently at physiological pH with the deprotonated amine substrate, despite the high pKa values of common substrates.
At pH 7.5 and below, the flavin monitored reductive half-reaction transients from stopped-flow assays were fitted using a single exponential function to determine the apparent rate constants for FAD reduction. How- ever, above pH 7.5, the reaction traces were fitted instead with a double-exponential function, as a second, slower process was resolved in the flavin reductive reac- tion. This biphasic behaviour has been observed previ- ously with para-substitued phenylethylamines, and the slow phase was attributed to the release of the imine product from the reduced enzyme [17]. Because the slow phase was only a minor component of the total ampli- tude change (20–30% at most) and did not vary with substrate concentration, only the substrate dependence of the fast phase was analysed further. As expected, the pH dependence of the kinetic parameters for the reduc- tive half-reaction of benzylamine oxidation exhibited
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3851
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
50
3.0A
B
2.5
40
) 1 – M m
2.0
30
) 1 – s (
1.5
20
t a c k
1 – s ( m K
/
1.0
10
t a c k
0.5
0
0.0
6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 pH
6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 pH
C
D
) 1 – M m
) 1 – s (
1 – s (
d e r
k
/
s K d e r k
140 120 100 80 60 40 20 0 -20
4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0
6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0
6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0
pH
pH
Fig. 1. (A, B) pH dependence of the steady- state kinetic parameters of MAO A-cataly- sed oxidation of kynuramine at 20 (cid:2)C. (C, D) pH dependence of the reductive half-reac- tion of MAO A-catalysed oxidation of phen- ylethylamine at 20 (cid:2)C.
Table 1. pKa values obtained from curve fitting for MAO A at 20 (cid:2)C. ND, not determined.
ES complex
Free E or S
Substrate
Method
pKa1
pKa2
pKa1
pKa2
Benzylamine Kynuramine Benzylamine PEA
Steady-state Steady-state Stopped-flow Stopped-flow
7.9 ± 0.1 7.9 ± 0.1 7.4 ± 0.1 8.4 ± 0.2
– – – 8.7 ± 0.2
8.5 ± 0.1 8.0 ± 0.2 8.6 ± 0.7 ND
9.2 ± 0.1 8.8 ± 0.2 8.3 ± 0.7 ND
similar pH profiles to those obtained for the equivalent steady-state parameters (see supplementary Fig. S2). At each pH, the value of kred was found to be less than that of kcat, which has been observed previously in kinetic studies with MAO A [12]. This was attributed to aggregation of the detergent solubilized enzyme at the high concentrations required for stopped-flow assays. To minimize this potential effect, the same concentra- tion of MAO A was used in all stopped-flow experi- ments. The kred exhibited a single ionization with a corresponding pKa of 7.4 ± 0.1, and the kred ⁄ Ks exhib- ited a bell-shaped profile with pKa values of 8.6 ± 0.7 and 8.3 ± 0.7 obtained from curve fitting.
the different pH dependence. From quantitative struc- ture activity studies with MAO A, it has been shown that different factors influence the correct positioning of para-substituted phenylethylamines compared to para-substituted benzylamines, and that these are required for efficient catalysis [12,17]. It was suggested that the greater steric flexibility of the ethylamine side chain allows efficient aC-H bond cleavage without con- fining the phenyl ring to a specific orientation. There- fore, the greater flexibility of the substrate when bound to the active site may allow it to contact additional ionizable residues that influence the correct orientation for catalysis and affect the resulting pH profile. The kred ⁄ Ks data also exhibit a bell-shaped pH profile, but meaningful pKa values cannot be determined due to the large errors associated with these data (Fig. 1D). A summary of all pKa values is given in Table 1.
pH dependence of KIEs identifies substrate ionization in the ES complex
As the amine substrates are able to ionize over the pH range investigated, some of the observed macroscopic
By contrast to all other substrates, the pH depen- dence of kred for MAO A-catalysed phenylethylamine (PEA) oxidation displayed a bell-shaped profile, with corresponding pKa values of 8.4 ± 0.2 and 8.7 ± 0.2 (Fig. 1C). The cause of the additional macroscopic ioni- zation on the alkaline side of the pH profile for PEA is unknown. For benzylamine and PEA, it has been estab- lished that the rate-limiting step of flavin reduction is due to aC-H bond cleavage, and it is unlikely that a dis- tinct catalytic step affects flavin reduction to produce
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3852
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
' k1
+
+
ES + SH
ESH
' k2
S KA
ES KA
kred
E + S
E + P
k1 ES k2
Scheme 2. Control of flavin reduction by substrate ionization.
greater increase in substrate pKa upon perdeuteration of trimethylamine (DpKa = 0.3) [18] compared to a-C deuteration of benzylamine (expected DpKa = 0.032) [19]. A mechanism describing the ionization of the sub- strate and its effect on flavin reduction is shown in ES are the dissociation S and KA Scheme 2, where KA constants for the free substrate and the enzyme-bound substrate, respectively [22]. It is assumed that the rate of flavin reduction (kred) is slow relative to the dissoci- ation steps, so that they remain in thermodynamic equilibrium. It can be seen that if the pKa of the amine substrate is increased (e.g. in the deuterated analogue), this will lead to a greater proportion of the unreactive ESH+ form relative to ES at a given pH. Therefore, the observed KIE will appear inflated at low pH, and be greater than that due purely to bond breakage effects.
Perturbation of amine pKa mechanism of monoamine oxidase
ionizations may be due to the substrate rather than to groups on the enzyme. A potential way to identify sub- strate ionizations is to perturb the substrate pKa (e.g. by deuteration) and to observe a corresponding shift the in the macroscopic ionization. Deuteration of atoms bonded to the amine nitrogen is known to cause an increase in the amine pKa; in part due to: (a) the shorter C-D bond length leading to a greater charge density on the carbon and hence greater nitrogen lone pair availability and (b) the greater reduced mass of the deuterated analogue for the N-H stretching fre- quency, causing it to lie lower in the asymmetric potential energy well (lower zero point energy) relative to the protiated substrate [18–20]. The pH dependence of the reductive half-reaction of benzylamine oxidation was determined at a saturating substrate concentration of 5 mm, for both the protiated and deuterated forms. The pH profile of kred for both substrates is shown in Fig. 2, and a small alkaline shift is observed for deu- terated benzylamine relative to protiated benzylamine, which results in a decrease of the calculated KIE from 13 to 8 with increasing pH (Fig. 2, inset). A similar effect has been seen in studies with trimethylamine dehydrogenase (TMADH), where substrate perdeutera- tion caused a shift in the observed macroscopic ioniza- resulting in a strong tion in the ES complex, dependence of the KIE upon pH [21]. This result, com- bined with mutagenesis work on TMADH, led to the assignment of the ionization as that of bound sub- strate. It is likely that a similar effect is observed with MAO A, where the observed macroscopic ionization is due to deprotonation of the bound amine substrate. The effect of substrate deuteration was more signifi- for TMADH, and may be explained by the cant
0.09
0.012
0.08
I
0.010
E K
0.07
0.06
0.008
18 16 14 12 10 8 6
k r e d
0.05
6.5 7.0 7.5 8.0 8.5 9.0 9.5 pH
) 1 – s (
0.006
0.04
d e r k
( s – 1 )
0.004
0.03
0.02
0.002
0.01
0.000
0.00
6
7
9
10
8 pH
Fig. 2. pH dependence of the reductive half-reaction of MAO A-ca- talysed oxidation at 20 (cid:2)C with 5 mM benzylamine (filled circles, left axis) or 5 mM deuterated benzylamine (open circles, right axis). Inset: calculated KIE as a function of pH.
The accuracy of the derived pKa values from the bell- shaped pH profiles for kred ⁄ Ks or kcat ⁄ Km is quite low. This is partly due to the error associated with fitting the particular functions to narrow plots because the width of the curve is relatively insensitive to the differ- ence in pKa values when pKa1)pKa2 is < 0.6 [22]. Despite this drawback, the pH profiles are still of qual- itative value. Based upon the assignment of the ioniza- tion in the ES complex to that of the bound substrate, it follows that the acid limb of the bell-shaped kred ⁄ Ks or kcat ⁄ Km profile is due to deprotonation of the free substrate and that the alkaline limb is due to the unfa- vourable deprotonation of an unknown group on the enzyme at high pH. The stated pKa values of the free substrates (9.3–9.9) are higher than those obtained from curve fitting (8.0–8.6) and may simply reflect the error in curve fitting as mentioned above. The main effect of substrate binding is to perturb the amine pKa to more acidic values; as the bound substrate has a pKa of 7.4–8.4, this corresponds to a DpKa of approxi- mately 2 relative to the free substrate. Such an effect has been seen with other amine oxidases. For example,
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3853
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
trimethylamine dehydrogenase, mouse polyamine oxi- dase and monomeric sarcosine oxidase exhibit acidic shifts in substrate pKa values of 3.3–3.6, 0.8 and 2.6, respectively, upon substrate binding to the active site [18,23,24]. Therefore, the active site of each of these enzymes is organized to stabilize the neutral form of the amine substrate by approximately 11 kJÆmol)1 rela- tive to the charged, protonated form.
pKm or pKs values are plotted as a function of pH (results not shown), the initial slope at low pH is < 1, which may simply reflect that the relevant macroscopic ionizations are not sufficiently separated to be individ- ually identified. There are too few points at high pH to accurately calculate the change of slope that occurs above pH 9 for all substrates, although it is clear that the Km and Ks values are increased.
The
Conclusions
function of
Despite the suggestion that it is the protonated form of the substrate that binds the enzyme, it is difficult to envisage specific binding of the charged substrate when the active site is organized for binding and activation of the neutral form. In addition, the pH dependence of the KIE and the observation of similar perturbation effects on substrate pKa values with other amine oxid- ases further support the catalytic significance of the deprotonated form. Thus, we propose that binding of the substrate to the active site leads to a perturbation of the pKa, effectively increasing the concentration of the neutral amine species. We do not propose that it is only the protonated form that initially binds, but rather that preferential binding of the deprotonated form to the active site leads to a shift in the equilib- rium of the substrate ionization. The present study emphasizes the benefits of using deuteration of com- pounds in conjunction with standard stopped-flow and steady-state analyses to provide deeper insight into reaction mechanism. In the case of the amine oxidases, the perturbation of the substrate pKa upon binding to the active site appears to be a general feature, allowing the enzyme at physiologically efficient relevant pH values.
The crystal structure of MAO A has recently been resolution [25], allowing a more the active site geometry of
solved to 2.2 A˚ detailed knowledge of
steady-state oxidation of kynuramine by MAO A has been studied previously, and the overall trends of the data are very similar to those reported in the present study, which suggests that variations in buffer composition have minimal effect [15]. However, the interpretation of the results was different in the previous study. It was suggested that, due to the initial increase in rate with increasing pH and the relative invariance of the Km values over the same pH range (in which the concentration of the neutral form of the substrate would be insignificant compared to the pro- tonated form), it must be the protonated form of the substrate that binds to the enzyme, with subsequent substrate deprotonation required for catalysis to pro- ceed. Therefore, the macroscopic ionization in the ES complex was assigned to a group on the enzyme, rather than to the ionization of bound substrate, as indicated by data reported in the present study. The invariance of the Km values at low pH makes this a plausible explanation, although it may be over simplis- tic to assume that an exponential dependence of Km with pH is required to indicate the binding of the deprotonated form because the pH dependence of Km or Ks is affected by all macroscopic ionizations occur- ring in the system [22]. The variations in the Km or Ks values with pH for all substrates used in the present study are shown in Table 2. Unlike the values for the Km or Ks values for all other kynuramine, substrates tested exhibited a general decrease with increasing pH in the range from (cid:2) 6.5–8.5. When the
Table 2. pH dependence of Km and Ks values determined for MAO A at 20 (cid:2)C.
Km (mM)
Ks (mM)
Benzylamine
Kynuramine
Benzylamine
PEA
pH
–
0.31 ± 0.04
–
6.5 7.0 7.2 7.5 8.0 8.5 9.0 9.2 9.5
0.20 ± 0.02 0.10 ± 0.01 0.077 ± 0.002 0.087 ± 0.004 – 0.137 ± 0.003
0.042 ± 0.003 0.047 ± 0.003 – 0.041 ± 0.002 0.044 ± 0.003 0.045 ± 0.002 0.082 ± 0.005 – 0.261 ± 0.028
0.213 ± 0.012 0.134 ± 0.032 0.136 ± 0.007 0.138 ± 0.014 0.034 ± 0.004 0.033 ± 0.004 0.039 ± 0.004 0.079 ± 0.019 0.424 ± 0.108
0.019 ± 0.017 0.145 ± 0.007 – 0.122 ± 0.015 0.078 ± 0.003 0.048 ± 0.002 0.028 ± 0.002 0.042 ± 0.016 0.268 ± 0.125
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3854
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
MAO A. Inspection of the active site suggests that there are several candidates responsible for the unfa- vourable deprotonation event that occurs at alkaline pH, including multiple tyrosine residues, the covalently linked FAD, and possibly Lys305 that is co-ordinated to the flavin via a water molecule. To be confident about any assignment, future work combining muta- genesis studies with stopped-flow kinetic analysis is required.
Experimental procedures
Materials
Expression and purification of MAO A
Enzyme assays
Bis-Tris propane buffer, reduced Triton X-100, kynur- amine, benzylamine, and b-phenylethylamine were obtained from Sigma (St Louis, MO, USA). Deuterated benzylamine HCl (C6D5CD2NH2, 99.2 atom % D) was obtained from CDN Isotopes (Quebec, Canada). determined coefficient extinction using 100 lgÆmL)1 of Zeocin. Multiple integrants were selected by growth on plates with increasing Zeocin concentrations, and screened for MAO A expression. Typically, 8 L of cul- ture were grown in baffled flasks in an orbital incubator at 30 (cid:2)C. The cells were harvested for 48 h after methanol induction by centrifugation at 2000 g for 10 min. The cells were resuspended in Pichia breakage buffer to approxi- mately 200 gÆL)1 and then lysed by passing twice through a cell disruptor at 40 000 psi (TS-series 1.1 kW model; Con- stant Systems Ltd, Daventry, UK) followed by cooling on ice. MAO A was then purified essentially as described pre- viously [27]. Active fractions eluted from the DEAE-Sepha- rose column were concentrated by ultrafiltration and stored at )80 (cid:2)C. Prior to use, the enzyme was dialysed extensively against 20 mm potassium phosphate (pH 7.0), containing 20% glycerol, to remove the competitive inhibitor d-amp- hetamine that is present during the later stages of purifica- tion. Typical yields from an 8 L growth were between 80–120 mg of purified MAO A. Enzyme concentration was of an 12 000 m)1Æcm)1 at 456 nm [27].
Routine activity measurements were conducted using a continuous spectrophotometric assay with kynuramine as substrate. Assays were performed at 25 (cid:2)C in 50 mm potassium phosphate (pH 7.5), containing 0.5% (w ⁄ v) Triton X-100 and 0.2 mm kynuramine. The activity was calculated by following the initial increase of A316 due to production of 4-hydroxyquinone and using an extinction coefficient of 12 000 m)1Æcm)1 [28]. One unit of enzyme activity is defined as the amount of enzyme required to oxidize 1 lmol of kynuramine in 1 min.
Steady-state kinetic measurements
the using primer and
translation initiation of
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3855
protocols following standard [26]. Steady-state kinetic measurements were performed at 20 (cid:2)C in 20 mm Bis-Tris propane buffer containing 0.5% (w ⁄ v) reduced Triton X-100, 50 mm NaCl and 20% glycerol. The pH of the buffer was set by the addition of small amounts of concentrated HCl or NaOH, and was in the range 6.5– 9.5. The rate of enzymatic activity was determined by moni- toring the initial linear increase in absorbance at 250 nm due to the production of benzaldehyde, employing an extinction coefficient 12 800 m)1Æcm)1 [29], and using a Varian Cary 50 Bio spectrophotometer (Varian Inc., Palo Alto, CA, USA). The concentration of benzylamine was typically in the range 0.02–2 mm, and the assay was started by the addition of MAO A to a final concentration of 0.6 lm. Michaelis–Menten kinetic behaviour was observed at each pH studied; the only exception was at pH 6.5, where the rate of enzymatic activity was only assayed at saturating substrate concentrations due to the slow rate The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG G-3¢ and 5¢-GAGAGCTCGAGAACAGAACTTCAAGAC CGTGGCAGGAGC-3¢. The NcoI and XhoI sites used for further cloning are shown underlined. The amplified DNA was first cloned into pGem-T Easy (Promega, Madison, WI, USA) following A-tailing using standard techniques. A modified version of the pPICZA plasmid (Invitrogen, Carls- bad, CA, USA) was used as the final expression vector, in which the NcoI site upstream of the Zeocin resistance gene 5¢-GGTGAGGAAC was mutated TAAAACATGGCCAAGTTGACCAGTGC-3¢ its reverse complement. A unique NcoI site was then intro- the multiple cloning site generating a Kozak duced at the sequence to allow efficient inserted gene, using the primer 5¢-CAACTAATTATTCG reverse AAACCATGGATTCACGTGGCCC-3¢ and its complement. The modified pPICZA vector was then digested with NcoI and XhoI, and similarly digested maoA inserted following gel purification. The sequence of the cloned gene was confirmed by DNA sequencing. All site- directed mutagenesis reactions were performed using the Stratagene QuikChange site-directed mutagenesis kit (Strat- gene, La Jolla, CA, USA) with Pfu Turbo DNA polymer- ase; except that the DNA was transformed into Novablue competent cells (Novagen, Madison, WI, USA). The pPICZAmaoA plasmid was linearized with PmeI and trans- formed into Pichia pastoris strain KM17H by electropora- tion Successful transformants were selected on agar plates containing
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
ð1Þ y ¼ EH (cid:3) 10ð(cid:4)pHÞ þ E (cid:3) 10ð(cid:4)pKaÞ 10ð(cid:4)pHÞ þ 10ð(cid:4)pKaÞ
y ¼
ð2Þ
Tmax 1 þ 10ðpKa1(cid:4)pHÞ þ 10ðpH(cid:4)pKa2Þ
Single wavelength anaerobic stopped-flow kinetic experiments
observed. Identical experiments were performed with kynur- amine as substrate, but the reaction was monitored at A316, as described above, and the final concentration of MAO A in the assay was 0.1 lm.
Where EH and E are the limiting catalytic activities of the the ionization protonated and deprotonated forms of group, respectively; and Tmax is the theoretical maximal value. For the pH profile in which a double ionization is observed, it is assumed that the observed parameter is dependent upon the singly protonated species, therefore producing a bell-shaped profile tending towards zero at the extremes of pH. Examples of the reaction transients and further details regarding treatment of the data are given in supplementary Figs S3–S5.
Acknowledgements
This work was funded by the UK Biotechnology and is a Biological Sciences Research Council. N.S.S. BBSRC Professorial Research Fellow.
References
1 Binda C, Newton-Vinson P, Hubalek F, Edmondson DE & Mattevi A (2002) Structure of human mono- amine oxidase B, a drug target for the treatment of neurological disorders. Nat Struct Biol 9, 22–26. The reductive half-reaction of MAO A was studied using an Applied Photophysics SX.18MV stopped-flow spectro- photometer (Applied Photophysics Ltd, Leatherhead, UK) housed in a Belle Technology glove box (< 5 p.p.m. oxygen) (Belle Technology, Portesham, UK). Studies were performed in 20 mm Bis-Tris propane buffer containing 0.5% (w ⁄ v) Triton X-100, 50 mm NaCl and 20% glycerol. Buffer solutions were purged with nitrogen for 1 h and then left to equilibrate overnight in the glove box. Dialy- sed MAO A was exchanged into the appropriate anaerobic exclusion chromatography, and stock buffer by gel solutions of the substrates were also diluted into the appropriate buffer. To remove any final traces of oxygen, 10 units of glucose oxidase (Sigma) and 10 mm glucose were added per mL of solution and left to incubate for 30 min once loaded into the stopped-flow syringes. The reactions were started by rapid mixing of 10 lm oxidized MAO A with various concentrations of either benzylamine or phenylethylamine. A minimum of six substrate concen- trations were used at each pH that spanned almost two orders of magnitude. The rate of flavin reduction was monitored under pseudo first-order conditions by follow- ing the decrease in A456.
Data analysis
2 Cesura AM & Pletscher A (1992) The new generation of monoamine oxidase inhibitors. Prog Drug Res 38, 171–297. 3 Scrutton NS (2004) Chemical aspects of amine
oxidation by flavoprotein enzymes. Nat Prod Rep 21, 722–730. 4 Silverman RB (1995) Radical ideas about monoamine- oxidase. Acc Chem Res 28, 335–342. 5 Edmondson DE, Binda C & Mattevi A (2007)
Structural insights into the mechanism of amine oxidation by monoamine oxidases A and B. Arch Biochem Biophys 464, 269–276. 6 Li M, Binda C, Mattevi A & Edmondson DE (2006)
Functional role of the ‘aromatic cage’ in human monoamine oxidase B: structures and catalytic properties of Tyr435 mutant proteins. Biochemistry 45, 4775–4784. 7 Erdem SS, Karahan O, Yildiz I & Yelekci K (2006) A
computational study on the amine-oxidation mechanism of monoamine oxidase: insight into the polar nucleo- philic mechanism. Org Biomol Chem 4, 646–658.
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3856
8 Akyuz MA, Erdem SS & Edmondson DE (2007) The aromatic cage in the active site of monoamine oxidase B: effect on the structural and electronic properties of Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package (OriginLab Corp., Northampton, MA, USA), and the maximal cata- lytic centre activity (kcat) and the Michaelis constant (Km) determined. The observed rates from stopped-flow data were obtained by fitting the reaction traces to an equation for either single- or double-exponential decay with offset, as appropriate. Analysis was performed by nonlinear least- squares regression on an Acorn RISC PC (Acorn Com- puters, Cambridge, UK) using spectrakinetics software (Applied Photophysics). The observed rate of enzyme reduction was found to have a hyperbolic dependence with respect to substrate concentration at each pH. The limiting rate of flavin reduction (kred) and the substrate binding con- stant (Ks) were determined as described by Strickland et al. [30] using the origin software package. The pH dependence of the kinetic parameters were fitted to an equation descri- bing either a single (Eqn 1) or double (Eqn 2) ionization, as appropriate, to obtain the corresponding macroscopic pKa values.
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
ing in wild-type and mutant enzymes. J Biol Chem 276, 24581–24587. bound benzylamine and p-nitrobenzylamine. J Neural Transm 114, 693–698. 9 Ralph EC, Hirschi JS, Anderson MA, Cleland WW, 22 Tipton KF & Dixon HB (1979) Effects of pH on enzymes. Methods Enzymol 63, 183–234.
Singleton DA & Fitzpatrick PF (2007) Insights into the mechanism of flavoprotein-catalyzed amine oxidation from nitrogen isotope effects on the reaction of N-meth- yltryptophan oxidase. Biochemistry 46, 7655–7664. 10 Rigby SEJ, Hynson RMG, Ramsay RR, Munro AW & Scrutton NS (2005) A stable tyrosyl radical in mono- amine oxidase A. J Biol Chem 280, 4627–4631. 23 Royo M & Fitzpatrick PF (2005) Mechanistic studies of mouse polyamine oxidase with N1,N12-bisethylsper- mine as a substrate. Biochemistry 44, 7079–7084. 24 Zhao G & Jorns MS (2005) Ionization of zwitterionic amine substrates bound to monomeric sarcosine oxidase. Biochemistry 44, 16866–16874.
11 Kay CW, El Mkami H, Molla G, Pollegioni L & Ram- say RR (2007) Characterization of the covalently bound anionic flavin radical in monoamine oxidase a by elec- tron paramagnetic resonance. J Am Chem Soc 129, 16091–16097. 25 Son S-Y, Ma J, Kondou Y, Yoshimura M, Yamashita E & Tsukihara T (2008) Structure of human mono- amine oxidase A at 2.2-A˚ resolution: the control of opening the entry for substrates ⁄ inhibitors. Proc Natl Acad Sci USA 105, 5739–5744. 26 Invitrogen Corporation (1998) EasySelect Pichia
12 Miller JR & Edmondson DE (1999) Structure-activity relationships in the oxidation of para-substituted benzylamine analogues by recombinant human liver monoamine oxidase A. Biochemistry 38, 13670–13683. Expression Kit: A Manual of Methods For Expression of Recombinant Proteins Using pPICZ and pPICZa in Pichia pastoris. Invitrogen Corporation, San Diego, CA. 13 McEwen CM, Sasaki G & Lenz WR (1968) Human
27 Li M, Hubalek F, Newton-Vinson P & Edmondson DE (2002) High-level expression of human liver monoamine oxidase a in Pichia pastoris: comparison with the enzyme expressed in Saccharomyces cerevisiae. Protein Expr Purif 24, 152–162. liver mitochondrial monoamine oxidase. I. Kinetic stud- ies of model interactions. J Biol Chem 243, 5217–5225. 14 Edmondson DE, Bhattacharrya AK & Xu J (2000) Evi- dence for alternative binding modes in the interaction of benzylamine analogues with bovine liver monoamine oxidase B. Biochim Biophys Acta 1479, 52–58.
28 Weyler W & Salach JI (1985) Purification and proper- ties of mitochondrial monoamine-oxidase type-A from human-placenta. J Biol Chem 260, 13199–13207. 29 Walker MC & Edmondson DE (1994) Structure-activ-
15 Jones TZE, Balsa D, Unzeta M & Ramsay RR (2007) Variations in activity and inhibition with pH: the pro- tonated amine is the substrate for monoamine oxidase, but uncharged inhibitors bind better. J Neural Transm 114, 707–712. 16 Ramsay RR (1991) Kinetic mechanism of monoamine ity-relationships in the oxidation of benzylamine analogs by bovine liver mitochondrial monoamine- oxidase-B. Biochemistry 33, 7088–7098. 30 Strickland S, Palmer G & Massey V (1975) Determina- oxidase A. Biochemistry 30, 4624–4629.
tion of dissociation-constants and specific rate of constants of enzyme-substrate (or protein-ligand) inter- actions from rapid reaction kinetic data. J Biol Chem 250, 4048–4052. 17 Nandigama RK & Edmondson DE (2000) Structure- activity relations in the oxidation of phenethylamine analogues by recombinant human liver monoamine oxidase A. Biochemistry 39, 15258–15265. 18 Basran J, Sutcliffe MJ & Scrutton NS (2001) Optimiz-
Supplementary material
is available
ing the Michaelis complex of trimethylamine dehydroge- nase – identification of interactions that perturb the ionization of substrate and facilitate catalysis with trimethylamine base. J Biol Chem 276, 42887–42892. 19 Perrin CL, Ohta BK, Kuperman J, Liberman J &
for MAO A-catalysed
Erdelyi M (2005) Stereochemistry of beta-deuterium isotope effects on amine basicity. J Am Chem Soc 127, 9641–9647. 20 Bary Y, Gilboa H & Halevi EA (1979) Secondary
The following supplementary material online: Fig. S1. pH dependence of the steady-state kinetic parameters of MAO A-catalysed oxidation of benzyl- amine at 20 (cid:2)C. Fig. S2. pH dependence of the reductive half-reaction of MAO A-catalysed oxidation of benzylamine at 20 (cid:2)C. Fig. S3. Reaction transient oxidation of 0.5 mm PEA at pH 9.0 and 20 (cid:2)C. Fig. S4. Reaction for MAO A-catalysed transient oxidation of 0.4 mm benzylamine at pH 8.5 and 20 (cid:2)C.
hydrogen isotope effects .5. Acid and base strengths – corrigendum and addendum. J Chem Soc Perkin Trans 2, 938–942.
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3857
21 Basran J, Sutcliffe MJ & Scrutton NS (2001) Deuterium isotope effects during carbon-hydrogen bond cleavage by trimethylamine dehydrogenase – implications for mechanism and vibrationally assisted hydrogen tunnel-
R. V. Dunn et al.
Isotope effects and their pH dependence in MAO A
Fig. S5. Substrate dependence of the reductive half- reaction of MAO A-catalysed oxidation of PEA at pH 8.5 and 20 (cid:2)C.
This material is available as part of the online article
from http://www.blackwell-synergy.com
Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the corre- sponding author for the article.
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
3858
