Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells

doi:10.1111/j.1432-1033.2004.04164.x

Eur. J. Biochem. 271, 2417–2427 (2004) (cid:3) FEBS 2004

Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells

Elizabeth H. Moore1, Mariarosaria Napolitano2, Michael Avella1, Fatos Bejta1, Keith E. Suckling3, Elena Bravo2 and Kathleen M. Botham1 1Department of Veterinary Basic Sciences, The Royal Veterinary College, London, UK; 2Istituto Superiore di Sanita, Department of Hematology, Oncology and Molecular Medicine, Viale Regina Elena, Rome, Italy; 3Glaxo SmithKline, Medicines Research Centre, Stevenage, Herts., UK

compared to CRLPs without probucol, but phospholipid and cholesteryl ester formation from [3H]oleate was unaf- fected. In addition, no differences between the effects of CRLPs and pCRLPs on the expression of mRNA for a range of genes believed to be involved in lipoprotein uptake, intracellular lipid metabolism and the efflux of cholesterol from macrophages was detected. These results suggest that antioxidants carried in chylomicron remnants enhance lipid accumulation in macrophages by increasing the rate of uptake of the particles and raising the intracellular synthesis of triacylglycerol, but not cholesteryl ester, and that these effects are brought about by changes at the post-transcrip- tional level. Antioxidants carried in chylomicron remnants therefore may promote the development of atherosclerosis, and this is likely to be particularly important in conditions where clearance of remnants from the circulation is delayed.

Keywords: chylomicron remnants; probucol; macrophages; lipid accumulation; antioxidants.

The effects of protection of chylomicron remnants from oxidation on their uptake and induction of lipid accumula- tion in macrophages were investigated using chylomicron remnant-like particles (CRLPs) containing the lipophilic antioxidant drug, probucol, and macrophages derived from the human monocyte cell line, THP-1. The total lipid content of THP-1 macrophages was markedly higher (·2.2) after 48 h of incubation of THP-1 macrophages with CRLPs containing probucol (pCRLPs) when compared to CRLPs without probucol, and this was because of increases in tri- acylglycerol (·2.3) and cholesterol (·1.8) levels, while cho- lesteryl ester concentrations were not significantly changed. Determination of the uptake of CRLPs and pCRLPs by the cells using particles labelled with the fluorescent probe 1,1¢- dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlo- rate showed that pCRLPs are taken up at a faster rate than CRLPs. The synthesis of triacylglycerol, as measured by the incorporation of [3H]oleate and [3H]glycerol, was also increased in macrophages incubated with pCRLPs as

Atherosclerotic lesions are intiated by the formation of fatty streaks in the artery, which form when macrophages in the vessel wall take up lipoproteins from the subendothelial space and eventually become so engorged with lipid that they take on a foamy appearance and are termed foam cells [1,2]. Evidence from a large number of previous studies has indicated that low density lipoprotein (LDL) has a major role in the generation of foam cells, but it is also clear that oxidation of the lipoprotein particles, a process which can occur within the artery wall, is necessary before extensive lipid accumulation is induced [3], and this has led to the development of the hypothesis that antioxidants have a beneficial effect in the prevention of atherosclerosis and related cardiovascular disease.

There is considerable epidemiological evidence to indicate that diets rich in fruits and vegetables (for example, the Mediterranean diet), which contain relatively high levels of natural antioxidants such as vitamin E and carotenoids, reduce the risk of heart disease [4–6]. A number of prospective studies have also suggested that consumption of antioxidant vitamins, such as vitamin E and b-carotene, may be beneficial [7,8], and randomized clinical trials with vitamin E supplementation have supported this view [9,10].

Correspondence to K. M. Botham, Department of Veterinary Basic Sciences, The Royal Veterinary College, Royal College St., London NW1 0TU, UK. Fax: + 44 20 7388 1027, Tel.: + 44 20 7468 5274, E-mail: kbotham@rvc.ac.uk Abbreviations: ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; acLDL, acetylated low-density lipoprotein; apoE, apolipoprotein E; CRLPs, chylomicron remnant-like particles; DGAT1, acyl coenzyme A: diacylglycerol acyl transferase 1; DiI, 1,1¢-dioctadecyl-3,3,3¢3¢-tetra- methylindo-carbocyanine perchlorate; HMDM, human monocyte- derived macrophages; HNE, 4-hydroxy-2(E)-nonenal; LDL, low- density lipoprotein; LDLr, low-density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; lycCRLPs, chylo- micron remnant-like particles containing lycopene; MDA, malondialdehyde; oxLDL, oxidized low-density lipoprotein; pCRLPs, chylomicron remnant-like particles containing probucol; PMA, 4b-phorbol 12-myristate 13-acetate; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1; TBARS, thiobarbituric acid reactive substances; VLDL, very-low-density lipoprotein. Enzymes: acyl coenzyme A: cholesterol acyltransferase (EC 2.3.1.26); acyl coenzyme A: diacylglycerol acyl transferase (EC 2.3.1.20). (Received 27 February 2004, revised 7 April 2004, accepted 16 April 2004)

2418 E. H. Moore et al. (Eur. J. Biochem. 271)

(cid:3) FEBS 2004

Despite these strong indications of potential benefits, however, a recent review of large-scale trials of dietary supplementation with b-carotene or vitamin E in healthy human populations has concluded that the results fail to confirm any protective effects of these compounds against cardiovascular disease [11].

could not rule out the possibility that the findings were a result of properties specific to the lycopene molecule, rather than its antioxidant effects. In the present work therefore we investigated the effects of the incorporation of the phenolic lipophilic drug, probucol, which is structurally unrelated to lycopene [36], into CRLPs on lipid accumulation in THP-1 macrophages. After confirming that the induction of lipid accumulation in the cells by the particles is enhanced when they are protected from oxidation, we investigated the mechanism of this effect by comparing the influence of CRLPs and CRLPs containing probucol (pCRLPs) on the uptake of the particles by the cells, intracellular lipid synthesis, and the expression of mRNA for genes believed to play a part in foam cell formation, including those regulating lipoprotein uptake [such as the LDL receptor (LDLr), the low-density lipoprotein receptor-related protein (LRP), scavenger receptor A (SR-A), and CD36], intracel- lular lipid metabolism [acyl coenzyme A: cholesterol acyl- transferase 1 (ACAT1), acyl coenzyme A: diacylglycerol acyltransferase 1 (DGAT1)], the efflux of cholesterol from the cells [scavenger receptor B1 (SR-B1)], and the ATP- binding cassette transporter A1 (ABCA1).

Materials and methods

Dietary lipids, including fats, cholesterol and lipid-soluble antioxidants, are absorbed in the intestine and secreted into lymph in chylomicrons, large triacylglycerol-rich lipopro- teins which pass into the blood via the thoracic duct and are then rapidly metabolized by lipoprotein lipase in extra- hepatic capillary beds, removing some of the triacylglycerol and leaving smaller remnant particles. The chylomicron remnants retain all the cholesterol and minor lipid compo- nents, such as antioxidants, and deliver them to the liver for processing [12]. There is now a large and growing body of evidence indicating that chylomicron remnants are strongly atherogenic. They have been shown to be taken up into the artery wall [13–15] as efficiently as LDL [16], and remnant- like particles containing apolipoprotein E (apoE) have been isolated from human aortic intima and atherosclerotic plaque [17,18]. In addition, delayed clearance of remnants from the circulation is correlated with the development of atherosclerotic lesions [19,20]. Previous work in our labor- atory and by others has demonstrated that chylomicron remnants are able to induce foam cell formation in human monocyte-derived macrophages (HMDM) [21] and in human and murine macrophage cell lines [22–24], and that, in striking contrast to LDL, the remnant particles do not require prior oxidation to bring about this effect.

RPMI-1640, fetal bovine serum, L-alanyl-L-glutamine (glutamax), penicillin/streptomycin and 2-mercaptoethanol were obtained from Gibco. Fetal bovine serum was heat inactivated by incubation at 56 (cid:4)C for 30 min before use. Trypan blue, fatty acid-free BSA, phospholipids, choles- terol, cholesteryl oleate, probucol, lycopene and 4b-phorbol 12-myristate 13-acetate (PMA) were supplied by Sigma. The fluorescent probe 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo- carbocyanine perchlorate (DiI) was purchased from Cambridge Bioscience. The radioisotopes L-3 phosphatidyl- choline 1-palmitoyl-2-[114C]linoleoyl and [1(3)-3H]glycerol were purchased NEN Life Science Products Inc., and [9,10(n)-3H]oleate was from Amersham International.

Preparation of CRLPs

Information about the effects of antioxidants on macro- phage foam cell formation has come mainly from studies with vitamin E and the synthetic lipophilic antioxidant drug, probucol, and the results have been inconsistent. Vitamin E has been reported to decrease lipid accumulation and/or the uptake of oxidized LDL (oxLDL) or acetylated LDL (acLDL) in HMDM and the murine macrophage cell line J774, both when added to the medium [25,26], or incorpor- ated into the LDL particles [27], but in other studies no effects of pretreatment with the vitamin could be detected in experiments with HMDM [28], or mouse macrophages [29,30]. Similarly, Yamamoto et al. [31] found that probu- col, either in the free form or bound to the lipoprotein, suppressed lipid accumulation and the uptake of acLDL by human macrophage cell lines, while other workers have found either no effect [32,33] or increased lipid accumula- tion [30,34] with probucol pretreatment in rabbit or mouse peritoneal macrophages.

Although it is clear that transport in the blood in chylomicron remnants provides dietary lipid-soluble anti- oxidants with the opportunity to interact directly with the artery wall to influence atheroma development, little is known about how the incorporation of antioxidants into the remnant particles influences their effects on macro- phages. In the first study in this area, we have demonstrated recently that chylomicron remnant-like particles (CRLPs) containing lycopene cause markedly increased lipid accu- mulation in macrophages derived from the human mono- cyte cell line, THP-1, suggesting that, contrary to what might be expected, protection of chylomicron remnants from oxidation enhances, rather than inhibits, their induc- tion of foam cell formation [35]. Our experiments, however,

CRLPs were prepared by sonication of a lipid mixture containing 70% trilinolein, 2% cholesterol, 5% cholesteryl ester and 25% phospholipids, in Tricine buffer (20 mM, pH 7.4) containing 0.9% NaCl, followed by density-gradi- ent centrifugation and binding to human apoE, as described previously [37]. Sonication was performed at 22–24 lm for 20 min at 56 (cid:4)C, and the resulting emulsion was adjusted to a density of 1.21 gÆmL)1 with KBr, layered under a stepwise density gradient, and centrifuged at 17 000 g for 20 min at 20 (cid:4)C. The upper layer of grossly emulsified lipids was then removed and replaced with an equal volume of 0.9% NaCl (d ¼ 1.006 gÆmL)1) and the tubes were centrifuged at 70 000 g for 1 h (20 (cid:4)C). Lipid particles harvested from the top layer were incubated with the dialysed (18 h, 4 (cid:4)C), d > 1.063 gÆmL)1, fraction of human plasma (obtained from the National Blood Service, North London Centre, London, UK) at 37 (cid:4)C with shaking for 5 h [lipid particles/ plasma, 1 : 1, (v/v)]. CRLPs were then isolated by ultra- centrifugation (120 000 g, 16 h, 12 (cid:4)C), harvested from the top layer and stored at 4 (cid:4)C under argon until required. the particles Analysis by SDS–PAGE showed that

Foam cell induction by chylomicron remnants (Eur. J. Biochem. 271) 2419

(cid:3) FEBS 2004

contained apoE and no other lipoproteins. For the prepar- ation of CRLPs containing antioxidants and/or the DiI fluorescent label, probucol, lycopene and/or DiI was added to the lipid mixture prior to sonication. Taking into account the amount of probucol or lycopene added to the lipid mixture for sonication and the percentage recovery of the starting lipids in the CRLPs, we estimate that the concen- trations of probucol or lycopene used in our experiments did not exceed 10 lM.

Culture of THP-1 cells

ester, and nonesterified fatty acids (visualized with iodine vapour) were scraped into vials for determination of the radioactivity by liquid scintillation counting using Lumagel- safe scintillant (Perkin Elmer Life Sciences). Preliminary experiments showed that [3H]oleate incorporation into lipids was linear over a period of 2 h under the conditions used. Incorporation of [3H]glycerol into triacylglycerol was determined using a modification of the method described by Davis et al. [38]. Cells were incubated for 6 h at 37 (cid:4)C in 95% air/5% CO2 in serum-free medium containing CRLPs or pCRLPs (20 lgÆmL)1 cholesterol) in the presence of [3H]glycerol (148 KBqÆmL)1, 20 lM). After incubation, the cells were washed twice with NaCl/Pi. [14C]Phosphatidyl- choline (900 d.p.m.) was added to each tube as an internal standard and the lipids were extracted and separated by TLC, as described previously [22]. Proteins were harvested from the plates, after extraction of the lipids, by the addition of 1 mL of NaOH (1 M).

mRNA analysis

THP-1 monocytes were maintained in suspension in RPMI- 1640 containing 10% fetal bovine serum, 2 mM glutamine, 100 UÆmL)1 penicillin, 100 mgÆmL)1 streptomycin and 50 mM 2-mercaptoethanol (culture medium), at a density of 3–9 · 105 cells per mL at 37 (cid:4)C in 5% air/95% CO2. The cells were induced to differentiate into macrophages by incubation for 72 h in the presence of PMA (200 ngÆmL)1). Then, cells adhering to the culture plates, and the medium containing the PMA and any remaining monocytes, were removed. Viability of THP-1 macrophages, as assessed by Trypan blue exclusion, was > 95%.

For studies on lipid accumulation, CRLPs or pCRLPs (30 lgÆmL)1 cholesterol), were added to the macrophages and the incubation was continued for a further 48 h before the cells were harvested and their lipid content determined. For uptake studies, DiI-labelled CRLPs or pCRLPs (30 lgÆmL)1 cholesterol) were incubated with THP-1 macrophages for various time-periods and the cells were then viewed with a Zeiss LMS 510 laser-scanning confocal microscope.

The relative abundance of transcripts for the LDLr, LRP, SR-A, SR-B1, CD36, ACAT1, DGAT1, and ABCA1 was determined by RT-PCR. Total mRNA was extracted from the cells using a kit from Promega UK, and first-strand synthesis was carried out using Avian myeloblastosis virus reverse transcriptase. The primers used and the product sizes for the genes tested are shown in Table 1. Amplifica- initial denaturation at 95 (cid:4)C for tion conditions were: 15 min, followed by 30 cycles (LDLr, ACAT1, DGAT1), 33 cycles (SR-A, SR-B1, CD36, ABCA1) or 34 cycles (LRP) consisting of denaturation at 94 (cid:4)C for 30 s, annealing at 58 (cid:4)C for 1 min and extension at 72 (cid:4)C for 1 min, with the final extension at 72 (cid:4)C for 10 min. The products were analysed by electrophoresis on an agarose gel [1.2%, (w/v)] containing ethidium bromide (0.5 lgÆmL)1) and the bands were quantified by absorbance volume analysis using values for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) obtained simultaneously in the same system. The linearity of the assay for each gene was established in preliminary experiments.

Analytical methods

To determine the incorporation of [3H]oleate into cellular lipids, THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgÆmL)1 cholesterol) for 48 h. The medium was then removed and, after washing the cells three times with 2 mL of warm phosphate-buffered saline (NaCl/Pi), containing replaced with culture medium (1 mL) [9,10-3H]oleic acid (37 KBqÆmL)1, 55 000 d.p.m.Ælmol)1) and 2% fat-free BSA. The incubation was continued for 1 h, the cells were washed three times with 2 mL of NaCl/Pi, and the lipids were extracted with isopropanol/hexane (3 : 2, v/v) (2 mL · 30 min, then 1 mL · 20 min repeated four times), separated by TLC (hexane/diethyl ether/formic acid, 80 : 20 : 2, v/v/v) and the bands corresponding to triacylglycerol, diacylglycerol, phospholipid, cholesteryl

The total cholesterol (cholesterol + cholesteryl ester), cholesterol, triacylglycerol and phospholipid content of

Table 1. Primer sequences and product sizes for RT-PCR. ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A: cholesterol acyltransferase 1; DGAT1, acyl coenzyme A: diacylglycerol acyl transferase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDLr, low- density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1.

AGTTGGCTGCGTTAATGTGAC CCCAGGTGTCTACCATCACAC

TTCCTCACACTGGCACTTGTA GGGGTTGTAGAGTTCCAGGTC

ATTGCCCTTTACCTCCTCGT AGATGCAGCCTCATTTCCAC

ATGAGGTTGGCTTCCATGTC TGGGTTTTCAACTGGAGAGG

GAAACTGCAGCTGAGCCTCT

ACCTACTTGGCTCCGGATTT

CTACAAGGCAGGCAGTATTGG CCTGTGTTGAGGGAGTACCTG

TAAGCGTCCTGTTCATTTCGT GGGCGAAACCAATGTATTTCT

Forward primer Reverse primer Product size (bp) Gene

AACAGTTTGTGGCCCTTTTG AATGACCCCTTCATTGACCTC

AGTTCCAGGCTGGGGTACTT GTTCACACCCATGACGAACAT

LDLr LRP SR-A CD36 SR-B1 ACAT1 DGAT1 ABCA1 GAPDH 343 326 248 175 250 334 328 157 309

2420 E. H. Moore et al. (Eur. J. Biochem. 271)

(cid:3) FEBS 2004

(P < 0.05) than those in CRLPs (62.1 ± 15.4). Little conjugated diene formation, as measured by the increase in absorbance at 234 nm, was observed when CRLPs or pCRLPs were incubated at 30 (cid:4)C for periods of up to 420 min, but on incubation with CuSO4 (50 lM), CRLPs showed a marked rise in diene formation, which was not seen with pCRLPs (Fig. 1).

Effect of CRLPs containing probucol on lipid accumulation in THP-1 macrophages

CRLPs and cell samples was determined by enzymatic analysis using kits supplied by Sigma. Cholesteryl ester levels were calculated by subtracting the values for choles- terol from those for total cholesterol. The thiobarbituric acid reactive substances (TBARS) content of the prepara- tions was determined as described by Steinbrecher et al. [39]. Tetraethoxypropane, which yields malondialdehyde (MDA), was used as a standard. The levels of MDA and 4-hydroxy-2(E)-nonenal (4-HNE) were assayed using Bioxytech LPO-586 (Oxis International Inc, Portland, OR, USA). For the determination of conjugated diene formation, CRLPs or pCRLPs (50 nmolÆmL)1 triacylglycerol) were incubated at 30 (cid:4)C in the presence or absence of CuSO4 (50 lM) and the change in absorbance at 234 nm was measured.

Exposure of THP-1 macrophages to either CRLPs or pCRLPs caused a considerable increase in the total lipid accumulated in the cells after 48 h (Table 3). Comparison of the effects of the two types of particles, however, showed that pCRLPs had a markedly greater effect. The total lipid content in pCRLP-treated cells was 221% that of CRLP- treated macrophages (Table 3), and this was a result of increases in both triacylglycerol (+132%) and total choles- terol (+73%) levels. Cholesteryl ester levels, however, were not significantly changed; thus the increase in the total cholesterol fraction was entirely the result of higher cholesterol concentrations (+84%) (Table 3).

Fluorescence per cell in macrophages treated with DiI- labelled CRLPs or pCRLPs was quantified by absorbance volume analysis. The fluorescence for the entire field was assessed, the background deducted and the value divided by the number of cells in the field. Two or three fields with approximately equivalent numbers of cells were analysed in each experiment. Values were normalized for variations in the fluorescence of different preparations using the fluorescence units per lmol of cholesterol, measured in a fluorimeter.

Uptake of CRLPs and pCRLPs by THP-1 macrophages

Significance limits were calculated using the Student’s

t-test, Student’s paired t-test or ANOVA, as indicated.

Results

Characteristics of CRLPs and pCRLPs

THP-1 macrophages were incubated with DiI-labelled CRLPs or pCRLPs for periods between 1 and 24 h, and the cells were then viewed by confocal microscopy. The amount of fluorescence associated with the cells increased markedly, with time, in experiments with both types of particles, but there was clearly more in pCRLP-treated macrophages, even at early time-points (Fig. 2). Quantifi- cation of the cell-associated fluorescence (Fig. 3) confirmed that the rate of uptake of pCRLPs was considerably higher than that of CRLPs.

The lipid content of the CRLPs and pCRLPs used is shown triacylglycerol and in Table 2. The total cholesterol, phospholipid content, and the triacylglycerol/total choles- terol ratio, were not significantly different in the two types of particles. TBARS values, however, were significantly lower in pCRLPs than in CRLPs. The lipid and TBARS content of the CRLPs and pCRLPs was not affected by the incorporation of the DiI fluorescent label. After incubation with CuSO4 (10 lM, 18 h), the levels of the lipid peroxida- tion products MDA and 4-HNE (pmolÆnmol)1 triacylglyc- erol) in pCRLPs (7.2 ± 1.7) were also markedly lower

Table 2. Lipid and thiobarbituric acid reactive substances (TBARS) content of chylomicron remnant-like particles (CRLPs). Standard CRLPs, and CRLPs containing probucol (pCRLPs), were prepared as described in the Materials and methods and the triacylglycerol (TG), total cholesterol (TC), phospholipid (PL) and TBARS levels were determined. Data shown represent the mean ± SEM from eight preparations. MDA, malondialdehyde.

Parameter CRLPs pCRLPs

a P < 0.01 vs. CRLPs (Student’s t-test).

0.97 ± 0.23 3.74 ± 0.88 0.53 ± 0.12 3.98 ± 0.23 2.54 ± 1.1 0.93 ± 0.19 3.93 ± 0.76 0.61 ± 0.11 4.33 ± 0.29 0.65 ± 0.57a TC (lmolÆmL)1) TG (lmolÆmL)1) PL (lmolÆmL)1) TG : TC TBARS (nmol of MDA per lmol of TG)

Fig. 1. Conjugated diene formation after incubation of CRLPs or pCRLPs in the presence or absence of CuSO4. Chylomicron remnant- like particles (CRLPs) or CRLPs containing probucol (pCRLPs) (50 nmolÆmL21 triacylglycerol) were incubated in the presence or absence of CuSO4 (50 mM) at 30 (cid:4)C and the absorbance at 234 nm was measured, at the intervals indicated, for 420 min. n, CRLPs; m, CRLPs + CuSO4; s, pCRLPs; d, pCRLPs + CuSO4. Data are expressed as the change in absorbance with time. Each point represents the mean of four experiments performed with separate CRLP prepa- rations, and error bars show the SEM.

Foam cell induction by chylomicron remnants (Eur. J. Biochem. 271) 2421

(cid:3) FEBS 2004

Table 3. Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the cholesterol (C), cholesteryl ester (CE) and triacylglycerol (TG) content of THP-1 macrophages. THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgÆmL)1 of total cholesterol) for 48 h and the TG, C, CE, and total cholesterol (TC) (C + CE) content of the cells was determined. Data are expressed as nmolÆmg)1 of cell protein and represent the mean ± SEM from five separate experiments.

Lipid Control CRLPs pCRLPs pCRLPs/CRLPs (%)

a P < 0.05 vs. CRLPs (Student’s paired t-test).

Effect of pCRLPs on lipid synthesis in THP-1 macrophages

work, we therefore measured the effects of lycCRLPs on levels of mRNA for SR-A, CD36, SR-B1, adipophilin and ABCA1. The results were generally similar to those obtained with pCRLPs (Table 6), with mRNA levels for CD36 and ABCA1 levels not significantly changed, and decreases of a similar extent observed in those for SR-A ()39%) and SR-B1 ()21%), although, in this case, the change in SR-B1 mRNA did not reach significance.

Total lipid (TG + TC) TG TC C CE 164.4 ± 38.3 90.6 ± 22.7 73.8 ± 15.9 72.0 ± 16.4 1.8 ± 1.0 556.7 ± 75.0 453.7 ± 60.6 103.0 ± 17.0 83.6 ± 12.2 19.4 ± 5.5 1291.5 ± 311.2a 1117.4 ± 308.5a 174.1 ± 33.3a 150.6 ± 25.3a 23.5 ± 10.7 221.1 ± 29.7 232.4 ± 42.5 172.9 ± 27.3 183.7 ± 24.6 111.1 ± 52.8

Discussion

The effects of CRLPs and pCRLPs on lipid synthesis in THP-1 macrophages were investigated by measuring the incorporation of [3H]oleate into triacylglycerol, diacylglyc- erol, phospholipid and cholesteryl ester after incubation of the cells with the particles for 48 h (Table 4). The amount of triacylglycerol formed from [3H]oleate was increased by (cid:2) 50% in macrophages exposed to pCRLPs as compared to CRLPs, while the radioactivity found in diacylglycerol was decreased by (cid:2) 40%. Incorporation of [3H]oleate into phospholipid and cholesteryl ester, and the amount of radioactivity found in nonesterified fatty acids, however, was not significantly different in experiments with the two types of particles.

Similar experiments using [3H]glycerol

(n ¼ 4) also showed that triacylglycerol formation was increased in macrophages treated with pCRLPs (12.02 ± 1.95 pmol of triacylglycerol formed per minute per mg of cell protein) as compared to CRLPs (9.79 ± 0.94 pmol of triacylglycerol formed per minute per mg of cell protein, P < 0.05).

Effect of CRLPs containing probucol or lycopene on mRNA expression in THP-1 macrophages

The aim of this study was to investigate the effects of lipophilic antioxidants carried in chylomicron remnants on the induction of lipid accumulation in macrophages. However, as it is difficult to obtain chylomicron remnants from human blood uncontaminated with lipoproteins of similar density, such as chylomicrons and very-low-density lipoprotein (VLDL), it was necessary to use model CRLPs to mimic the action of the remnant lipoproteins. The size, density and lipid composition of the CRLPs used was similar to that of physiological remnants [40,41], and they also contained human apoE. Extensive previous studies in both humans and experimental animals have shown that model particles of this type are cleared from the blood and metabolized in a similar way to the corresponding physio- logical lipoproteins [42–45], and CRLPs containing apoE from the appropriate species have also been found to have effects which mimic those of physiological remnants in rat hepatocytes and pig endothelial cells [40,46–48]. As lipo- philic antioxidants can easily be incorporated into the model particles, CRLPs provide a suitable and convenient model for our experiments.

THP-1 macrophages were incubated with CRLPs or pCRLPs for 48 h and the levels of mRNA for nine genes believed to play a role in foam cell formation was measured by RT-PCR. The results are shown in Table 5. The relative abundance of transcripts for LDLr, CD36, ACAT1 and ABCA1 was not significantly changed by either type of particle. There was a significant decrease, however, in mRNA levels for the LRP ()71 to )78%), SR-A ()33%) and SR-B1 ()20 to )34%) in experiments with both CRLPs and pCRLPs. In addition, DGAT1 mRNA concentrations were increased by both types of lipoproteins, but because of the large variation in individual samples, these changes did not reach significance. However, all six values from CRLP- treated cells (three for CRLPs and three for pCRLPs) were higher than those from control cells incubated without lipoproteins, with the increases ranging from 35 to 350%. No differences were observed between the effects of CRLPs and pCRLPs on any of the genes investigated.

We have reported the influence of CRLPs containing lycopene (lycCRLPs) on the expression of mRNA for LDLr, LRP, ACAT1 and DGAT1 in THP-1 macrophages in a previous study [35]. In order to compare the effects of pCRLPs and lycCRLPs on all the genes tested in the present

In previous work, we have demonstrated that CRLPs containing lycopene, a carotenoid with antioxidant proper- ties [6], markedly enhance lipid accumulation in THP-1 cells, suggesting that dietary antioxidants carried in chylo- micron remnants may promote, rather than inhibit, macrophage foam cell formation [35]. In order to test the hypothesis that this effect was caused by the protection of the remnants from oxidation, rather than a specific effect of lycopene, and to further investigate the mechanisms involved, we used CRLPs containing probucol, a phenolic antioxidant lipophilic drug that is structurally unrelated to lycopene [36]. Probucol has been used extensively to study the effects of antioxidants on atherosclerosis [49], and has been shown to bind to VLDL and LDL, and to provide the particles with greater antioxidant protection than vitamin E and many other antioxidants [50]. The concentration of

2422 E. H. Moore et al. (Eur. J. Biochem. 271)

(cid:3) FEBS 2004

Fig. 2. THP-1 macrophages were incubated with 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate (DiI)-labelled chylomicron rem- nant-like particles (CRLPs) or pCRLPs (30 lgÆmL21 cholesterol) for 1 h (A, CRLPs; B, pCRLPs), 6 h (C, CRLPs; D, pCRLPs) or 24 h (E, CRLPs; F, pCRLPs), and viewed by confocal microscopy. In each set of three panels, the top left shows the fluorescence, the top right the cells, and the bottom left the two merged. Images shown are from a typical experiment of three performed.

Foam cell induction by chylomicron remnants (Eur. J. Biochem. 271) 2423

(cid:3) FEBS 2004

to acLDL in the human cell lines UE-12 and THP-1 is suppressed by probucol, when added to the medium either in its free form or in acLDL prepared from patients given the drug, and vitamin E has also been reported to decrease the induction of lipid accumulation by oxLDL or acLDL in HMDM and in J774 cells in both these conditions [25–27]. In other studies, however, no effect on the induction of foam cell formation by acLDL or oxLDL in the presence of probucol or vitamin E was detected [28,29,32], and two investigations have shown an increase in macrophage cholesteryl ester content after incubation with acLDL in the presence of probucol [30,34]. Despite this inconsistency, there have been no reports of antioxidants causing massive increases in the induction of lipid accumulation in macro- phages by acLDL or oxLDL comparable to those found in the present study with CRLPs containing probucol or lycopene. These findings suggest that the effects of dietary lipophilic antioxidants on macrophages differ markedly, depending on the lipoprotein in which they are carried, so that during their transport from the gut to the liver in chylomicron remnants they promote foam cell formation, and their beneficial effects are only apparent after their incorporation into LDL, as oxidation of these particles greatly enhances their atherogenic effects [3].

(CRLPs) (m) or pCRLPs

One possible explanation for the raised lipid content of macrophages treated with pCRLPs, as compared to CRLPs, is that protection of the particles from oxidation increases their uptake by the cells. We investigated this hypothesis using CRLPs and pCRLPs labelled with the DiI fluorescent probe, and the results clearly demonstrate that the presence of probucol in CRLPs markedly increases their rate of uptake by THP-1 macrophages (Figs 2 and 3). These findings are again in contrast to those on the effects of antioxidants on the uptake of acLDL or oxLDL, which has been reported (in experiments using DiI fluorescence- labelled or radiolabelled lipoproteins) to be decreased after incubation of macrophages pretreated with or in the [31,53], or vitamin E [25,26,53], presence of probucol although Ku et al. [33] found no effect of probucol on acLDL uptake in rabbit peritoneal macrophages.

probucol added to the macrophages (not exceeding 10 lM) in our experiments was comparable to [32,34,51] or lower than [31,33,52,53] the levels used in previous work to study the effects of the drug on foam cell formation in vitro. Furthermore, the pCRLPs were significantly more resistant to oxidation than CRLPs, as indicated by the lower concentration of TBARS in the particles (Table 2), the markedly lower levels of MDA and 4-HNE after their exposure to CuSO4, and their resistance to copper-induced conjugated diene formation (Fig. 1).

In agreement with our previous work on physiological chylomicron remnants and CRLPs [21–23], incubation of macrophages with CRLPs caused a considerable increase in intracellular total lipid accumulation without prior oxida- tion of the particles (Table 3). When probucol was incor- porated into the CRLPs, however, this effect was enhanced by more than twofold, and this was caused by an increase in triacylglycerol (·2.3) and cholesterol (·1.8) levels, while the cholesteryl ester content was unaffected. These results are strikingly similar to those obtained in our previous work with CRLPs containing lycopene [35], and thus strongly suggest that the protection of chylomicron remnants from oxidation enhances, rather than inhibits, their induction of lipid accumulation in macrophages.

The mechanisms mediating the uptake of chylomicron remnants in macrophages are not yet clearly defined. The LDLr appears to play a role, but other receptors (such as the LRP) and various scavenger receptors (such as SR-A and CD36) may also be involved [54]. The faster rate of uptake of pCRLPs suggests that probucol may promote interaction with the receptor protein, or possibly that different receptors mediate their uptake. Investigation of the effects of CRLPs and pCRLPs on the expression of mRNA for the LDLr and the LRP in the present work showed that both types of particles suppressed mRNA levels for the LRP, but had no effect on those for the LDLr (Table 5), and this is generally consistent with the results obtained in our previous study with CRLPs containing lycopene [35]. In addition, we found that the expression of mRNA for SR-A was decreased by both pCRLPs and lycCRLPs, while that for the class B scavenger receptor, CD36, was essentially unaffected (Table 5). There were no significant differences, however, in mRNA levels for any of the receptors tested in macrophages treated with CRLPs, with or without anti- oxidants. We conclude therefore that the increased rate of uptake of pCRLPs, as compared to CRLPs, unequivocally

The enhancement of lipid accumulation in macrophages by CRLPs containing probucol and lycopene contrasts sharply with the effects of antioxidants on the induction of foam cell formation by acLDL or oxLDL. Yamamoto et al. [31,52] have found that foam cell formation in response

Fig. 3. THP-1 macrophages were incubated with 1,1¢-dioctadecyl- 3,3,3939-tetramethylindo-carbocyanine perchlorate (DiI)-labelled chyl- (d) omicron remnant-like particles (30 lgÆmL21 cholesterol) for the times indicated. The amount of fluorescence associated with the cells was determined by optical vol- ume density analysis and normalized for variations in the fluorescence in different preparations using the fluorescence units per lmol of cholesterol. Each point shows the mean of three separate experiments, and error bars show the SEM. The difference between the two curves was highly significant (P < 0.001; ANOVA repeated measures).

2424 E. H. Moore et al. (Eur. J. Biochem. 271)

(cid:3) FEBS 2004

Table 4. Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the incorporation of [3H]oleate into lipids in THP-1 macrophages. THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgÆmL)1 of cholesterol) for 48 h. The medium containing lipoproteins was then removed, the cells were incubated with [3H]oleate (37 KBqÆmL)1) for 1 h and the incorporation of radioactivity into triacylglycerol (TG), diacylglycerol (DG), cholesteryl ester (CE) and phospholipid (PL) during a 1 h incubation was determined. Data are expressed as pmol lipid formed min)1Æmg)1 of cell protein and represent the mean ± SEM from three separate experiments. NEFA, nonesterified fatty acids.

Lipid CRLPs pCRLPs pCRLPs/CRLPs (%)

a P < 0.05, b P < 0.01 vs. CRLPs (Student’s paired t-test).

TG DG PL CE NEFA 8.73 ± 0.55 2.35 ± 0.12 14.54 ± 0.97 0.84 ± 0.15 1.67 ± 0.28 12.99 ± 0.61b 1.35 ± 0.08a 17.29 ± 4.13 0.72 ± 0.02 1.08 ± 0.34 149.1 ± 4.6 58.4 ± 5.7 116.4 ± 22.8 92.7 ± 20.0 87.6 ± 11.5

Table 5. Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on mRNA levels for genes involved in foam cell formation. THP-1 macrophages were incubated with or without CRLPs or pCRLPs (30 lgÆmL)1 of cholesterol) for 48 h, and the levels of mRNA for the genes indicated were determined by RT-PCR. The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system. Data are expressed as OD units and as the percentage of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments. ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; DGAT1, acyl coenzyme A : diacylglycerol acyl transferase 1; LDLr, low-density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1.

Control CRLPs pCRLPs

Gene OD units OD units % Control OD units % Control

a P < 0.05, bP < 0.01 vs. control macrophages (ANOVA).

LDLr LRP SR-A CD36 SR-B1 ACAT1 DGAT1 ABCA1 0.41 ± 0.19 1.06 ± 0.19 1.59 ± 0.44 1.75 ± 0.67 2.45 ± 0.23 0.43 ± 0.15 0.34 ± 0.11 1.31 ± 0.46 0.47 ± 0.16 0.33 ± 0.11 1.12 ± 0.37 1.69 ± 0.54 1.55 ± 0.14 0.41 ± 0.06 0.86 ± 0.06 1.35 ± 0.35 168.1 ± 63.5 28.9 ± 6.1a 67.9 ± 5.9a 101.3 ± 7.5 63.6 ± 2.2b 126.2 ± 49.1 305.9 ± 87.1 108.5 ± 10.7 0.48 ± 0.25 0.25 ± 0.14 1.17 ± 0.49 1.89 ± 0.45 1.94 ± 0.19 0.55 ± 0.08 0.90 ± 0.21 1.39 ± 0.60 86.3 ± 48.7 21.8 ± 10.2b 67.2 ± 11.9a 122.6 ± 27.8 80.2 ± 7.3a 151.3 ± 34.5 290.3 ± 85.1 101.5 ± 15.3

Table 6. Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing lycopene (lycCRLPs) on mRNA levels of genes involved in foam cell formation. THP-1 macrophages were incubated with or without CRLPs or lycCRLPs (30 lgÆmL)1 cholesterol) for 48 h, and mRNA levels of the genes indicated were determined by RT-PCR. The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system. Data are expressed as OD units and as the percentage of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments. ABCA1, ATP-binding cassette transporter A1; SR-A, scavenger receptor A, SR-B1, scavenger receptor B1.

Control CRLPs pCRLPs

Gene OD units OD units % Control OD units % Control

a P < 0.05, vs. control macrophages (ANOVA).

demonstrated in the experiments with fluorescent-labelled particles, is not caused by regulation of these proteins at the transcriptional level.

with vitamin E, as well as incorporation of vitamin E into LDL, has been found to decrease cholesteryl ester synthesis from radiolabelled oleate in the presence of oxLDL or acLDL [25,27], although Asmis et al. [29] did not detect any effect of the vitamin on cholesteryl ester formation in the murine macrophage cell line, PD388D1. Takemura et al.

Another mechanism by which antioxidants may influence lipid accumulation in macrophages is by altering intracel- lular lipid metabolism. Pretreatment of J774 macrophages

SR-A CD36 SR-B1 ABCA1 1.61 ± 0.18 2.19 ± 0.13 2.78 ± 0.23 1.74 ± 0.20 1.03 ± 0.27 1.35 ± 0.19 2.05 ± 0.24 1.01 ± 0.19 61.6 ± 9.4a 61.6 ± 8.6 73.2 ± 3.0 59.1 ± 11.6 1.01 ± 0.25 2.13 ± 0.53 2.15 ± 0.58 1.32 ± 0.33 61.3 ± 11.5a 96.5 ± 23.4 79.4 ± 25.8 80.6 ± 27.6

Foam cell induction by chylomicron remnants (Eur. J. Biochem. 271) 2425

(cid:3) FEBS 2004

[34], on the other hand, have reported increased cholesteryl ester production and the activity of ACAT, the enzyme responsible for cholesterol esterification, in mouse perito- neal macrophages exposed to probucol in the presence and absence of acLDL. In our experiments, the presence of probucol in CRLPs did not change the rate of formation of cholesteryl ester in THP-1 macrophages (Table 4). In addition, there was no significant effect on the expression of mRNA for ACAT1, the isoform of the enzyme found in macrophages (Table 5), and this is consistent with our previous findings with CRLPs containing lycopene [35].

lipid accumulation in macrophages, and that this is caused by a markedly increased rate of uptake of the particles and by a raised intracellular synthesis of triacylglycerol, but not of cholesteryl ester. Furthermore, the effect does not appear to be caused by changes in the transcription of genes involved in the regulation of the uptake of the lipoprotein particles, cholesteryl ester or triacylglycerol synthesis, or the efflux of cholesterol from the cells. These findings suggest that the type of lipoprotein carrier of dietary antioxidants is crucial for their effects on macrophages. Thus, when they are carried in LDL, oxidation and the subsequent detri- mental effects of the particles are inhibited, but lipid accumulation is promoted during their transport postpran- dially in chylomicron remnants. This may be particularly important in conditions where the clearance of remnants from the circulation is delayed, and may also provide part of the explanation for the failure to demonstrate beneficial effects of dietary lipophilic antioxidants in large-scale intervention studies [11].

Acknowledgements

This work was supported by grants from the Istituto Superiore di Sanita` (ISS Art.524; fasc 2147/RI and C3BP). E. H. M. and F. B. were supported by BBSRC CASE studentships sponsored by Glaxo SmithKline.

References

1. Ross, R. (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362, 801–809.

In contrast to the lack of any effect of pCRLPs, as compared to CRLPs, on cholesteryl ester synthesis in macrophages, triacylglycerol synthesis was increased signi- ficantly, as demonstrated in experiments with both [3H]ole- ate (Table 5) and [3H]glycerol. The accompanying decrease in the amount of radioactivity from [3H]oleate found in diacylglycerol suggests that the activity of DGAT1, the enzyme which controls the final and only committed step in triacylglycerol synthesis in macrophages, using diacylglyc- erol as the substrate [55], may be increased. The expression of DGAT1 mRNA, however, was raised by both pCRLPs and CRLPs, suggesting that any effect of probucol occurs at a post-transcriptional level. The increase in DGAT1 mRNA levels found here differs from our previous study, where we found that CRLPs containing lycopene caused a significant decrease, which was not observed with control CRLPs [35]. This is the only major difference we have found, to date, between the effects of CRLPs containing probucol or lycopene, and thus may be related to specific effects of the molecules, rather than their antioxidant properties. In general, our findings on intracellular lipid synthesis show that increased triacylglycerol synthesis, but not cholesteryl ester formation, contributes to the enhancement of lipid accumulation by antioxidants carried in chylomicron remnants.

2. Libby, P., Geng, Y.J., Aikawa, M., Schoenbeck, U., Mach, F., Clinton, S.K., Sukhova, G.K. & Lee, R.T. (1996) Macrophages and atherosclerotic plaque stability. Curr. Opin. Lipidol. 7, 330–335.

Cholesterol efflux from macrophages is mediated by the ABCA1 [56], and the scavenger receptor SR-B1, which binds the high-density lipoprotein cholesterol acceptor [57]. The expression of mRNA for ABCA1 was not changed by CRLPs or CRLPs containing probucol or lycopene, while that for the SR-B1 was decreased by all three types of particles to a similar extent (Tables 5 and 6). We found no evidence therefore that antioxidants carried in chylomicron remnants influence the transcription of genes involved in the efflux of cholesterol from macrophages.

3. Steinberg, D. (1997) Low density lipoprotein oxidation and its pathobiological significance. J. Biol. Chem. 272, 20963–20966. 4. Trichopoulou, A. & Vasilopoulou, E. (2000) Mediterranean diet and longevity. Br. J. Nutr. 84, 205–209. 5. de Lorgeril, M. (1998) Mediterranean diet in the prevention of coronary heart disease. Nutrition 14, 55–57. 6. Rao, A.V. (2002) Lycopene, tomatoes and the prevention of coronary heart disease. Exp. Biol. Med. 227, 908–913.

7. Kohlmeier, L., Kark, J.D., Gomez-Garcia, E., Matin, B.C., Steck, S.E., Kardinaal, A.F.M., Ringstad, J., Thamm, M., Masaev, V., Riemersma, R., Martin-Moreno, J.M., Huttunen, J.K. & Kok, F. (1997) Lycopene and myocardial infarction risk in the EURAMIC study. Am. J. Epidemiol. 146, 618–626. 8. Agarwal, S. & Rao, A.V. (2000) Carotenoids and chronic diseases. Drug Metab. Drug Interact. 17, 189–209.

lipid accumulation in macrophages

that

9. Virtamo, J., Rapola, J.M., Ripatti, S., Heinonen, O.P., Taylor, P.R., Albanes, D. & Huttenen, O.P. (1998) Effect of vitamin E and beta-carotene on the incidence of primary nonfatal myocardial infarction and fatal coronary heart disease. Arch. Intern. Med. 158, 668–675.

10. Stephens, N.G., Parsons, A., Schodiel, P.M., Kelly, F., Cheese- man, K. & Mitchison, M.J. (1996) Radomised controlled trial of vitamin E in patients with coronary disease: Cambridge heart antioxidant study (CHAOS). Lancet 347, 781–786.

Probucol has been used extensively to investigate the effects of antioxidants on atherosclerosis development, and the results generally have provided strong support for the beneficial effects of such compounds. A number of studies, however, have shown consistently that probucol promotes atherogenesis in apoE- or LDLr-deficient mice [49]. Our findings, is enhanced by probucol carried in chylomicron remnants, provide a possible explanation for this apparently para- doxical effect, as both apoE and the LDLr have an important role in the removal of chylomicron remnants from the blood, and studies have demonstrated that remnant levels in plasma are raised and clearance is delayed in mice deficient in either of these two proteins [58–60].

In conclusion, the experiments reported here demonstrate that antioxidants carried in chylomicron remnants enhance

11. Clarke, R. & Armitage, J. (2002) Antioxidant vitamins and risk of cardiovascular disease. Review of large scale randomised trials. Cardiovasc. Drugs Ther. 16, 411–415. 12. Redgrave, T.G. (1983) Formation and metabolism of chylo- microns. Int. Rev. Physiol. 28, 103–130.

2426 E. H. Moore et al. (Eur. J. Biochem. 271)

(cid:3) FEBS 2004

13. Mamo, J.C., Proctor, S.D. & Smith, D. (1998) Retention of chy- lomicron remnants by arterial tissue; importance of an efficient clearance mechanism from plasma. Atherosclerosis 141, S63– S69.

29. Asmis, R., Llorente, V.C. & Gey, K.F. (1995) Prevention of cholesteryl ester accumulation in P388D1 macrophage-like cells by increased cellular vitamin E depends on species of extracellular cholesterol. Conventional heterologous non-human cell cultures are poor models of human atherosclerotic foam cell formation. Eur. J. Biochem. 233, 171–178.

14. Proctor, S.D. & Mamo, J.C.L. (1998) Retention of fluorescent- labelled chylomicron remnants within the intima of the artery wall – evidence that plaque cholesterol may be derived from post- prandial lipoproteins. Eur J. Clin. Invest. 28, 497–503.

30. Trach. C.C., Wulfroth. P.M., Severs, N.J. & Robenek, H. (1996) Influence of native and modified lipoproteins on migration of mouse peritoneal macrophages and the effect of the antioxidants vitamin E and probucol. Eur. J. Cell Biol. 71, 199–205.

31. Yamamoto, A., Hara, H., Takaichi, S., Wakasugi, S. & Tomi- kawa, M. (1988) Effect of probucol on macrophages, leading to regression of xanthomas and atheromatous vascular lesions. Am. J. Cardiol. 62, 31B–36B.

32. Nagano, Y., Kita, T., Yokode, M., Ishii, K., Kume, N., Otani, H., Arai, H. & Kawai, C. (1989) Probucol does not affect lipoprotein metabolism in macrophages of Watanabe heritable hyperlipidemic rabbits. Arteriosclerosis 9, 453–461. 15. Grieve, D.J., Avella, M.A., Elliott, J. & Botham, K.M. (1998) Influence of chylomicron remnants on endothelial cell function in the isolated perfused rat aorta. Atherosclerosis 139, 273–281. 16. Mamo, J.C.L. & Wheeler, J.R. (1994) Chylomicrons or their remnants penetrate rabbit thoracic aorta as efficiently as do smaller macromolecules, including low density lipoprotein, high density lipoprotein and albumin. Coronary Artery Dis. 5, 695–705. 17. Yla-Herttuala, S., Jaakkola, O., Enholm, C., Tikkanen, M.J., Solakivi, T., Sarkioja, T. & Nikkari, T. (1988) Characterisation of two lipoproteins containing apolipoproteins B and E from lesion- free human aortic intima. J. Lipid Res. 29, 563–572.

33. Ku, G., Schroeder, K., Schmidt, L.F., Jackson, R.L. & Doherty, N.S. (1990) Probucol does not alter acetylated low density lipo- protein uptake by murine peritoneal macrophages. Atherosclerosis 80, 191–197.

18. Rapp, J.H., Lespine, A., Hamilton, R.L., Colyvas, N., Chaume- ton, A.H., Tweedie-Harman, J., Kotite, L., Kunitake, S.T., Havel, R.J. & Kane, J.P. (1994) Triglyceride-rich lipoproteins isolated by selective affinity anti-apolipoprotein B immunosorption from human atherosclerotic plaque. Arterioscler. Thromb. 14, 1767–1774.

34. Takemura, T., Sakai, M., Matsuda, H., Matsumura, T., Biwa, T., Anami, Y., Nishikawa, T., Sasahara, T. & Shichiri, M. (2000) Effects of probucol on cholesterol metabolism in mouse peritoneal inhibition of HDL mediated cholesterol efflux. macrophages: Atherosclerosis 152, 347–357.

19. Benlian, P., De Gennes, P.L., Foubert, L., Zhang, H., Gagne, S.E. & Hayden, M. (1996) Premature atherosclerosis in patients with familial chylomicronemia caused by mutations in the lipoprotein lipase gene. N Engl. J. Med. 335, 848–854.

35. Moore, E.H., Napolitano, M., Prosperi, A., Avella, M., Suckling, K.E., Bravo, E. & Botham, K.M. (2003) Incorporation of lyco- pene into chylomicron remnant-like particles enhances their lipid accumulation in macrophages. Biochem. induction of Biophys. Res. Commun. 312, 1216–1219.

20. Groot, P.H.E., van Stiphout, W.A.H., Krauss, X.H., Jansen, H., van Tol, A., van Ramshorst, E., Chin-On, S., Hofmann, A., Cresswell, S.R. & Havekes, L. (1991) Postprandial lipoprotein metabolism in normolipidemic men with and without coronary heart disease. Arterioscler. Thromb. 11, 653–662. 36. Niguchi, N. & Niki, E. (2000) Phenolic antioxidants: a rationale for design and evaluation of novel antioxidant drugs for athero- sclerosis. Free Rad. Biol. Med. 28, 1538–1546.

21. YUK, C. & Mamo, J.C. (2000) Chylomicron remnant-induced foam cell formation and cytotoxicity: a possible mechanism of cell death in atherosclerosis. Clin. Sci. (London) 98, 183–192.

37. Napolitano, M., Batt, K.V., Avella, M., Bravo, E. & Botham, K.M. (2001) Lipid synthesis in macrophages derived from the human cell line THP-1: modulation of the effects of native and oxidised chylomicron remnant-like particles by estrogen. Clin. Sci. (London) 101, 403–413. 22. Napolitano, M., Rivabene, R., Avella, M., Botham, K.M. & Bravo, E. (2001) The internal redox balance of cells influences the metabolism of lipids of dietary origin by J774 macrophages: implications for foam cell formation. J. Vasc. Res. 38, 350–360.

38. Davis, R.A., Engelhorn, S.C., Pangburn, S.H., Weinstein, D.B. & Steinberg, D. (1979) Very low density lipoprotein synthesis and secretion by cultured rat hepatocytes. J. Biol. Chem. 254, 2010– 2016. 23. Batt, K.V., Botham, K.M., Jackson, B. & Suckling, K.E. (2001) Comparison of the effects of low density lipoprotein and chylo- micron remnants on foam cell formation in the human monocytic cell line THP-1. Atherosclerosis Suppl. 2, 109.

39. Steinbrecher, U.P., Parthasarathy, S., Leake, D.S., Witzum, J.L. & Steinberg, D. (1984) Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids. Proc. Natl Acad. Sci. USA 81, 3883–3722. 24. Napolitano, M., Avella, M., Botham. K.M. & Bravo, E. (2003) Chylomicron remnant induction of lipid accumulation in J774 macrophages is associated with up-regulation of triacylglycerol synthesis which is not dependent on oxidation of the particles. Biochim. Biophys. Acta 1631, 255–264.

40. Diard, P., Malewiak, M.-I., Lagrange, D. & Griglio, S. (1994) Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes. Biochem. J. 299, 889–894.

25. Shige, H., Ishikawa, T., Suzukawa, M., Nishiwaki, M., Yamash- ita, T., Nakajima, K., Ito, T., Higashi, K., Ayaori, M., Yonemura, A., Nestel, P. & Nakamura, H. (1998) Vitamin E reduces cho- lesterol esterification and uptake of acetylated low density lipo- protein in macrophages. Lipids 33, 1169–1175. 41. Redgrave, T.G., Fidge, N.H. & Yin, J. (1982) Specific, saturable binding and uptake of rat chylomicron remnants by rat skin fibroblasts. J. Lipid Res. 23, 638–644.

26. Devaraj, S., Hugou, I. & Jialal, I. (2001) Alpha tocopherol decreases CD36 expression in human monocyte-derived macro- phages. J. Lipid Res. 42, 521–527.

27. Suzukawa, M., Abbey, M., Clifton, P. & Nestel, P.J. (1994) Effects of supplementing with vitamin E on the uptake of low density lipoprotein and the stimulation of cholesteryl ester formation in macrophages. Atherosclerosis 110, 77–86.

42. Redgrave, T.G., Ly, H.L., Quintao, C.R., Ramberg, C.F. & Boston, R. (1993) Clearance from plasma of triacylglycerol and cholesteryl ester after intravenous injection of chylomicron-like lipid emulsions in rats and man. Biochem. J. 290, 843–847. 43. Maranhao, R.C., Fers, M.C., Martins, M.T., Mesquita, C.H., Toffoletto, O., Vinagre, C.G.C., Gianinni, S.D. & Pileggi, F. (1996) Plasma kinetics of a chylomicron-like emulsion in patients with coronary artery disease. Atherosclerosis 126, 15–25.

44. Oliveira, H.C., Hirata, M.H., Redgrave, T.G. & Maranhao, R.C. (1988) Competition between chylomicrons and their remnants for 28. Asmis, R. & Jelk, J. (2000) Vitamin E supplementation of human macrophages prevents neither foam cell formation nor increased susceptibility of foam cells to lysis by oxidized LDL. Arterioscler. Thromb. Vasc. Biol. 20, 2078–2086.

Foam cell induction by chylomicron remnants (Eur. J. Biochem. 271) 2427

(cid:3) FEBS 2004

ium-pyridoxal-5¢-phosphate glutamate. Z. Naturforsch. [C] 52, 97–104. plasma removal: a study with artificial emulsion models of chy- lomicrons. Biochim. Biophys. Acta 958, 211–217. 54. Yu, K.C. & Cooper, A.D. (2001) Postprandial lipoproteins and atherosclerosis. Front. Biosci. 6, D332–D354.

45. Martins, I.J., Vermeulen, R. & Redgrave, T.G. (2002) Relative roles of mitochondrial and peroxisomal fatty acid oxidation in the metabolism of chylomicron remnants in rats and mice as assessed by a stable-isotope breath test. Atherosclerosis 150, 13–20.

55. Cases, S., Smith, S.J., Zheng, Y.W., Myers, H.M., Lear, S.R., Sande, E., Novak, S., Collins, C., Welch, C.B., Lusis, A.J., Erickson, S.K. & Farese, R.V. (1998) Identification of a gene encoding an acyl CoA: diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis. Proc. Natl Acad. Sci. USA 95, 13018–13023. 46. Sultan, F., Lagrange, D., Le Liepvre, X. & Griglio, S. (1989) Chylomicron remnant uptake by freshly isolated hepatocytes. Effects of heparin and of hepatic triacylglycerol lipase. Biochem. J. 258, 587–594. 56. Oram, J.F. (2002) ATP-binding cassette transporter A1 and cho- lesterol trafficking. Curr. Opin. Lipidol. 13, 373–381.

47. Goulter, A.B., Avella, M.A., Elliott, J. & Botham, K.M. (2002) Chylomicron remnant-like particles inhibit receptor-mediated endothelium-dependent vasorelaxation in porcine coronary arteries. Clin. Sci. (London) 103, 450–460.

48. Thuren, T., Sisson, P. & Waite, M. (1991) Hydrolysis of lipid mixtures by rat hepatic lipase. Biochim. Biophys. Acta 1083, 217–220. 57. Chinetti, G., Gbaguidi, F.G., Griglio, S., Mallat, Z., Antonucci, M., Poulain, P., Chapman, J., Fruchart, J.-C., Tedgui, A., Najib- Fruchart, J. & Staels, B. (2000) CLA-1/SR-B1 is expressed in atherogenic lesion macrophages and regulated by activators of peroxisome proliferator-activated receptors. Circulation 101, 2411–2417. 49. Stocker, R. (1999) Dietary and pharmacological antioxidants in atherosclerosis. Curr. Opin. Lipidol. 10, 589–597. 50. Pfuetze, K.D. & Dujovne, C.A. (2000) Probucol. Curr. Ather- oscler. Report 2, 47–57.

58. Ishibashi, S., Perrey, S., Chen, Z., Shimada, M., Ohashi, K., Harada, K., Yazaki, Y. & Yamada, N. (1996) Role of the low density lipoprotein (LDL) receptor pathway in the metabolism of chylomicron remnants. A quantitative study in knock-out mice lacking the LDL receptor, apolipoprotein E, or both. J. Biol. Chem. 271, 22422–22427. 51. Liu, G.X., Ou, D.M., Liu, J.H., Huang, H.L. & Liao, D.F. (2000) Probucol inhibits lipid peroxidation of macrophage and affects its secretory properties. Acta Pharmacol. Sin. 21, 637–640.

59. Mortimer, B.C., Martins, I., Zeng, B.J. & Redgrave, T. (1997) Use of gene manipulated models to study the physiology of lipid transport. Clin. Exp. Pharmacol. Physiol. 24, 281–285. 52. Yamamoto, A., Takaichi, S., Hara, H., Nishikawa, O., Yoko- yama, S., Yamamura, T. & Yamaguchi, T. (1986) Probucol prevents lipid storage in macrophages. Atherosclerosis 62, 209– 217.

60. Zsigmond, E., Fuke, Y., Li, L., Kobayashi, K. & Chan, L. (1998) Resistance of chylomicron and VLDL remnants to post heparin lipolysis in apoE deficient mice: the role of apoE in lipoprotein lipase mediated lipolysis in vivo and in vitro. J. Lipid Res. 39, 1852–1861. 53. Selmer, D., Senekowitsch-Schmidtke, R., Schneider, W. & Elstner, E.F. (1997) Binding and uptake of 125iodine-labelled, oxidized low density lipoprotein by macrophages: comparison of the effects of alpha tocopherol, probucol, pyridoxal-5¢phosphate and magnes-