intTypePromotion=1

Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS

Chia sẻ: Năm Tháng Tĩnh Lặng | Ngày: | Loại File: PDF | Số trang:11

0
94
lượt xem
5
download

Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục đích của nghiên cứu này ngoài việc đánh giá lại các đặc điểm nông học của một số dòng TGMS, tập trung chính vào việc xác định gen tms của một số dòng TGMS nhằm định hướng cho việc khai thác chúng làm nguồn vật liệu để chọn tạo dòng TGMS mới và giống lúa lai hai dòng mới ở Việt Nam.

Chủ đề:
Lưu

Nội dung Text: Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS

J. Sci. & Devel. 2015, Vol. 13, No. 1: 12-22 Tạp chí Khoa học và Phát triển 2015, tập 13, số 1: 12-22<br /> www.vnua.edu.vn<br /> <br /> <br /> <br /> ĐÁNH GIÁ ĐẶC ĐIỂM NÔNG HỌC VÀ XÁC ĐỊNH GEN MẪN CẢM NHIỆT ĐỘ<br /> CỦA MỘT SỐ DÒNG TGMS<br /> Phạm Văn Thuyết1, Đàm Văn Hưng2, Nguyễn Quốc Trung3<br /> Trần Văn Quang2*, Lê Quốc Doanh1<br /> <br /> 1<br /> Cục Trồng trọt, Bộ Nông nghiệp và PTNT; 2Khoa Nông học, Học viện Nông nghiệp Việt Nam<br /> 3<br /> Khoa Công nghệ sinh học, Học viện Nông nghiệp Việt Nam<br /> <br /> Email*: tvquangnn1@gmail.com<br /> <br /> Ngày gửi bài: 08.08.2014 Ngày chấp nhận: 22.01.2015<br /> <br /> TÓM TẮT<br /> <br /> Lúa lai hai dòng đã và đang được nghiên cứu chọn tạo và phát triển ở Việt Nam. Đến năm 2013, có 11 giống<br /> lúa lai hai dòng được công nhận giống. Dòng mẹ của các giống lúa lai hai dòng này đều là dòng bất dục đực di<br /> truyền nhân mẫn cảm nhiệt độ (TGMS). Một số dòng TGMS trên được chúng tôi lựa chọn để đánh giá đặc điểm<br /> nông sinh học và xác định gen điều khiển tính mẫn cảm với nhiệt độ (tms). Kết quả đánh giá cho thấy các dòng<br /> TGMS có thời gian sinh trưởng trong vụ xuân biến động từ 140-163 ngày, có số lá trên thân chính từ 14-16 lá, cây<br /> thấp (62,2- 84,6cm), bông dài trung bình (19,5-25,8cm), lá đòng ngắn, trỗ nghẹn, có kiểu đẻ nhánh gọn hoặc chụm,<br /> tỷ lệ vươn vòi nhụy rất cao, thời gian nở hoa trên bông khá dài (4-10 ngày), có số hạt trên bông khác cao (168,8-<br /> 208,8 hạt), khối lượng 1.000 hạt của các dòng biến động từ 19,3-26,2g. Tất cả 16 dòng TGMS hiện đang sử dụng ở<br /> Việt Nam đều mang gen tms5, duy nhất có dòng 827S đồng thời mang 2 gen là tms4 và tms5.<br /> Từ khóa: Gen tms, lúa lai hai dòng, TGMS.<br /> <br /> <br /> Evaluation of Agronomic Traits and Thermo-sensitive Gene(s) of Some TGMS lines<br /> <br /> ABSTRACT<br /> <br /> Two-line hybrid rice has been developing in Vietnam. By 2013, 11 two-line hybrid varieties have been<br /> recognized as national varieties. This study aimed to characterize agronomic traits, yield characters and tms<br /> genotypes of TGMS lines. In spring season 2013, the TGMS lines showed following performances: 140-163 days<br /> growth duration, 14-16 leaves, 62.2-84.6cm in plant height, 19.5-25.8 cm in panicle length, short flag leaf, incomplete<br /> panicle exsertion, compact architecture, high rate of long filament, long flowering duration (4-10 days), 168.8-208.8<br /> seed per panicle and, 19.3-26.2 gram in 1000 seed weight. All 16 TGMS lines were genotyped with tms5 while 827S<br /> line had both tms4 and tms5 gene.<br /> Keywords: TGMS, tms gene, two-line hybride rice.<br /> <br /> <br /> nhận, 60 giống (84,5%) là giống lúa lai ba dòng,<br /> 1. ĐẶT VẤN ĐỀ<br /> chỉ có 11 giống là giống lúa lai hai dòng (15,5%).<br /> Diện tích lúa lai năm 2013 của Việt Nam Trong số giống lúa lai hai dòng được công nhận,<br /> đạt 607 nghìn ha, năng suất bình quân đạt 64,2 hầu hết là chọn tạo trong nước như: VL20, TH3-<br /> tạ/ha và cao hơn 8,4 tạ/ha so với lúa thuần 3, TH3-4, TH3-5, VL24, LC270, LC212, TH7-2,<br /> (Nguyen Tri Hoan et al., 2014). Từ năm 2002- HC1, TH5-1, TH7-2, TH8-3, HYT108, TH7-5,<br /> 2013, Việt Nam đã công nhận chính thức 71 TH3-7… Để tạo ra các giống lúa lai hai dòng<br /> giống lúa lai trong đó nhập nội 52 giống và chọn trên, các nhà khoa học Việt Nam đã chọn tạo<br /> tạo trong nước 19 giống. Trong số giống đã công được các dòng TGMS như: 103S, T1S-96, T7S,<br /> <br /> <br /> 12<br /> Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS<br /> <br /> <br /> <br /> 827S,… (Cục Trồng trọt, 2014). Tuy nhiên, các triển cây trồng, Học viện Nông nghiệp Việt Nam<br /> dòng TGMS trên mới chỉ được các nhà khoa học chọn tạo; các dòng 103BB7 và 103BB4 do Bộ<br /> tập trung vào đánh giá đặc điểm nông học, đặc môn Di truyền và Chọn giống cây trồng, Khoa<br /> điểm tính dục, mức độ chống chịu sâu bệnh và Nông học, Học viện Nông nghiệp Việt Nam chọn<br /> khả năng nhân dòng và sản xuất F1 dựa trên tạo; các dòng T827S và BoS do Trung tâm<br /> kiểu hình. Đến nay, chưa có những nghiên cứu Nghiên cứu lúa lai, Viện Cây lương thực và Cây<br /> xác định gen tms điều khiển mẫn cảm nhiệt độ thực phẩm chọn tạo; dòng SE21 nhập nội từ<br /> của các dòng mới chọn tạo trong nước (Nguyen Trung Quốc.<br /> Tri Hoan et al., 2014).<br /> Dạng bất dục TGMS do yếu tố nhiệt độ tác 2.2. Phương pháp nghiên cứu<br /> động; ở nhiệt độ cao bất dục, ở nhiệt độ thấp Các dòng TGMS được gieo thành 2 thời vụ<br /> hữu dục bình thường (Chen, 2010; Zhou, 2012). khác nhau, cụ thể: thời vụ 1 gieo ngày<br /> Di truyền TGMS do cặp gen lặn tms trong nhân 21/12/2013 gồm các dòng 103BB4, 103BB7,<br /> kiểm soát (Peng, 2010; Zhang, 2013). Các gen E13-2, E13-5, E15, E17, E26, E30, SE21, T1S-<br /> tms của các dòng TGMS đã được các nhà khoa 96, T7S, T827S, TG1, AT-1, AT-2, AT-3, AT-4,<br /> học trên thế giới công bố, cụ thể: gen tms1 nằm AT-5; thời vụ 2 gieo ngày 28/12/2013 gồm các<br /> trên nhiễm sắc thể số 1 thuộc dòng 5460S của dòng E15 và BoS. Các dòng TGMS được cấy theo<br /> Trung Quốc (Wang, 1995), gen tms2 nằm trên phương pháp khảo sát tập đoàn tuần tự không<br /> nhiễm sắc thể số 7 thuộc dòng Norin PL12 của<br /> có nhắc lại, diện tích mỗi dòng là 10m2, mật độ<br /> Nhật Bản (Yamagushi, 1997), gen tms3 nằm<br /> 40 khóm/m2, cấy 1 dảnh/khóm. Đánh giá đặc<br /> trên nhiễm sắc thể số 6 thuộc dòng IR32364 của<br /> điểm nông sinh học, hình thái, mức độ nhiễm<br /> Viện Nghiên cứu lúa quốc tế (IRRI) (Subudhi,<br /> sâu bệnh, năng suất theo tiêu chuẩn đánh giá<br /> 1997), gen tms4-1 nằm trên nhiễm sắc thể số 2<br /> nguồn gen cây lúa của Viện nghiên cứu Lúa<br /> thuộc dòng TGMS-VN1 của Việt Nam (Dong,<br /> 2000), gen tms4-2 nằm trên nhiễm sắc thể số 2 quốc tế (IRRI, 2002). Đánh giá đặc điểm bất dục<br /> (Reddy, 2000), gen tms5 và tms6-1 đều nằm theo phương pháp của Yuan (1995). Bố trí thí<br /> trên nhiễm sắc thể số 2 thuộc dòng AnnongS-1 nghiệm theo phương pháp của Gomez và Gomez<br /> của Trung Quốc (Wang, 2003), gen tms6-2 nằm (1984). Mùi thơm trên lá được đánh giá theo<br /> trên nhiễm sắc thể số 5 thuộc dòng Sokcho-MS phương pháp của Sood và Siddiq (1978), mùi<br /> của Hàn Quốc (Lee, 2005). thơm nội nhũ đánh giá theo phương pháp của<br /> Mục đích của nghiên cứu này ngoài việc Kibria (2008).<br /> đánh giá lại các đặc điểm nông học của một số Qui trình PCR để xác định gen tms: Tách<br /> dòng TGMS, tập trung chính vào việc xác định chiết ADN theo qui trình CTAB rút gọn (De la<br /> gen tms của một số dòng TGMS nhằm định Cruz, 1997) sử dụng các cặp mồi (Bảng 1) tương<br /> hướng cho việc khai thác chúng làm nguồn vật ứng với các gen với IR24 làm đối chứng âm. Chu<br /> liệu để chọn tạo dòng TGMS mới và giống lúa trình nhiệt cho PCR: 940C trong 2’ và 30 chu kỳ:<br /> lai hai dòng mới ở Việt Nam. 940C trong 5’’, 33-550C trong 30’’, 720C trong 30’’<br /> và 720C trong 7’.<br /> 2. VẬT LIỆU VÀ PHƯƠNG PHÁP Điện di: Sản phẩm chạy PCR được điện di<br /> 2.1. Vật liệu nghiên cứu trên gel agarose 4%, 100V trong 60’ và nhuộm<br /> <br /> Bao gồm 18 dòng TGMS: TG1 của Trung với Ethilium Bromide 0,5 µg/ml, sau đó quan<br /> tâm Khảo kiểm nghiệm giống cây trồng quốc sát bằng máy soi gel UV. Các chỉ thị trong bảng<br /> gia; các dòng T7S, E13S-2, E13S-5, E15S, E17S, 1 bao gồm: 01 chỉ thị RAPD (OPB19), 01 chỉ thị<br /> E26S, E30S, AT-1, AT-2, AT-3, AT-4, AT-5 STS (F18F/F18RM) và 04 chỉ thị SSR (RM11,<br /> T1S-96 (Đối chứng) do Viện Nghiên cứu và Phát RM257, C365-1 và RM3351).<br /> <br /> <br /> <br /> 13<br /> Phạm Văn Thuyết, Đàm Văn Hưng, Nguyễn Quốc Trung Trần Văn Quang, Lê Quốc Doanh<br /> <br /> <br /> <br /> Bảng 1. Tên, trình tự và nhiệt độ gắn của các marker sử dụng trong phản ứng PCR<br /> Gene Marker Mồi xuôi Mồi ngược Nhiệt độ Tài liệu tham<br /> gắn mồi khảo<br /> (0C)<br /> tms1 OPB-19 ACCCCCGAAG 33 Wang, 1995<br /> (TGMS1.2)<br /> tms2 RM11 TCTCCTCTTCCCCCGATC ATAGCGGGCGAGGCTTAG 50 Lopez, 2003<br /> tms3 F18F/F18RM TTCCCGGGTTCC ACTAGGAT GCGGACCGTGGAAGCTGGGG 53 Lang, 1999<br /> tms4 RM257 CCGTGCAACTTAAATCCAAAC GGAATCCTATATGAGCCAGTGA 52 Reddy, 2000<br /> AGG TGG<br /> tms5 C365-1 ATTTTGGTTGCGCATTAGAGG GAATATGCCAAGTACGGAGGAT 52 Yang, 2007<br /> tms6 RM3351 GTCGAAACGTAGCCAGGCAA CCATGGAAGGAATGGAGGTGA 55 Lee, 2005<br /> TGG GG<br /> <br /> Ghi chú: Xử lý số liệu bằng chương trình IRRISTAT 5.0, Microsoft Excel 2003.<br /> <br /> <br /> <br /> 3. KẾT QUẢ VÀ THẢO LUẬN đối chứng từ 12-14 ngày. Dòng T827S, AT-3,<br /> AT-4, SE21 và AT-2 có thời gian từ gieo đến trỗ<br /> 3.1. Đánh giá đặc điểm nông học của các 10% dài hơn so với đối chứng 7-10 ngày. Các<br /> dòng TGMS dòng còn lại trỗ bằng hoặc hơn đối chứng từ 1-5<br /> Kết quả bảng 2 cho thấy thời gian từ gieo ngày. Các dòng có thời gian trỗ của quần thể<br /> đến trỗ 10% của các dòng TGMS dao động từ biến động trong khoảng từ 7-14 ngày. Trong đó<br /> 120-133 ngày, ngoại trừ, hai dòng BoS và E15S đa số các dòng có thời gian trỗ của quần thể<br /> có thời gian từ gieo đến trỗ 10% ngắn hơn so với ngắn hơn từ 1-6 ngày hoặc bằng so với đối<br /> <br /> Bảng 2. Thời gian qua các giai đoạn sinh trưởng<br /> của các dòng TGMS trong vụ xuân 2014 (ngày)<br /> Dòng Tuổi Thời gian từ gieo đến trỗ…. Thời gian trỗ của..... Thời gian<br /> mạ sinh trưởng<br /> 10% 50% 80% Quần thể Khóm<br /> 103BB4 47 124 128 131 11 8 155<br /> 103BB7 47 126 129 132 13 13 155<br /> AT-1 46 127 132 133 9 5 159<br /> AT-2 46 133 135 137 7 5 162<br /> AT-3 46 132 136 137 9 7 162<br /> AT-4 46 131 134 136 11 7 162<br /> AT-5 46 128 132 133 9 7 159<br /> S<br /> Bo 40 111 116 119 12 9 143<br /> E13S-2 47 122 126 128 9 9 152<br /> E13S-5 47 126 129 131 8 7 155<br /> E15S 40 109 112 117 12 13 140<br /> E17S 47 121 125 129 12 8 152<br /> E26S 47 127 134 137 10 5 160<br /> E30S 47 128 133 136 9 5 160<br /> SE21 47 133 137 138 8 7 163<br /> T1S96 (Đ/C) 47 123 129 131 13 13 155<br /> T7S 47 123 129 131 13 6 155<br /> T827 47 130 133 134 9 7 158<br /> TG1 47 124 130 133 14 15 158<br /> <br /> <br /> <br /> <br /> 14<br /> Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS<br /> <br /> <br /> <br /> chứng, trừ dòng TG1 có thời gian trỗ dài nhất là còn lại có chiều cao cây thấp hơn dòng đối<br /> 14 ngày. Hầu hết các dòng TGMS được nghiên chứng. Dòng có chiều cao cây ngắn nhất là<br /> cứu có thời gian trỗ của khóm biến động từ 5-9 dòng T7S với chiều dài là 62,2±3,6cm. Chiều<br /> ngày, ngoại trừ các dòng 103BB7, E15S, T1S- dài bông của các dòng biến động trong khoảng<br /> 96, TG1 có thời gian trỗ của khóm khá dài từ từ 18,7±1,6cm (Dòng T827S) đến 23,4±2,0cm<br /> 13-15 ngày, trong đó dòng TG1 có thời gian trỗ (Dòng SE21). Các dòng 103BB7, AT-1, E13-2,<br /> dài nhất là 15 ngày. Kết quả trình bày ở bảng 2 E13S-5, T7S, T827S, TG1 có chiều dài bông dài<br /> cho thấy thời gian sinh trưởng của các dòng hơn đối chứng; các dòng còn lại đều ngắn hơn<br /> tương đối đồng đều, thời gian sinh trưởng của đối chứng. Chiều dài cổ bông của các dòng khảo<br /> các dòng dao động từ 140-163 ngày. Trong đó, sát biến động từ -1,6±0,4cm đến 6,6±1,1cm.<br /> dòng có thời gian sinh trưởng ngắn nhất là dòng Các dòng 103BB4, 103BB7, T7S, TG1 có chiều<br /> E15S (140 ngày), dài nhất là dòng SE21 (163 dài cổ bông lớn hơn so với đối chứng, các dòng<br /> ngày). Các dòng BoS, E13S-2, E15S, E17S có còn lại có chiều dài cổ bông nhỏ hơn so với đối<br /> thời gian sinh trưởng ngắn hơn so với đối chứng; chứng. Tất cả các dòng chiều dài đòng ngắn<br /> các dòng còn lại có thời gian sinh trưởng dài hơn hơn so với lá giáp lá đòng và chiều rộng lá đòng<br /> hoặc bằng so với đối chứng. nhỏ hơn so với lá giáp lá đòng. Chiều dài lá<br /> Qua bảng 3, chiều cao cây cuối cùng của đòng của cây biến động từ 30,4±6,8cm (Dòng<br /> các dòng đều dưới 100cm, thuộc dạng thấp cây. E30S) đến 48,8±8,3cm (Dòng AT-4) với hệ số<br /> Các dòng có chiều cao cây lớn hơn so với đối biến động nhỏ nhất ở dòng AT-1 là 8,9% và cao<br /> chứng là các dòng AT-1, AT-2, AT-3, AT-4, nhất ở dòng E30S là 22,4%. Các dòng AT-2,<br /> AT-5, BoS, E13S-2, E15S, SE21 (Dòng AT-2 với AT-3, AT-4, BoS, E13S-2, SE21, TG1 có chiều<br /> chiều dài cây lớn nhất là 84,8±7,1cm). Các dòng dài lá đòng dài hơn đối chứng.<br /> <br /> Bảng 3. Một số tính trạng số lượng của các dòng TGMS trong vụ xuân 2014<br /> Dòng Chiều cao cây (cm) Chiều dài bông (cm) Chiều dài cổ bông (cm) Chiều dài lá đòng (cm)<br /> Xtb± Sx CV% Xtb± Sx CV% Xtb± Sx CV% Xtb± Sx CV%<br /> (cm) (cm) (cm) (cm)<br /> 103BB4 68,8±5,0 7,3 21,9±2,1 9,6 -6,6±1,1 17,1 35,7±7,5 21,0<br /> 103BB7 62,3±5,5 8,8 21,4±1,9 8,9 -6,0±1,2 20,9 40,4±6,0 14,9<br /> AT1 79,7±6,1 7,7 20,9±2,3 11,0 -2,0±0,6 32,0 40,7±3,6 9,0<br /> AT2 84,8±7,2 8,5 23,3±1,4 6,0 -1,8±0,6 32,5 45,7±7,6 16,6<br /> AT3 84,6±4,7 5,6 21,9±1,6 7,8 -1,9±0,4 21,4 43,6±6,3 14,5<br /> AT4 84,1±6,1 7,2 22,3±1,9 12,0 -1,9±0,4 21,6 48,8±8,3 17,1<br /> AT5 82,6±2,7 3,3 22,4±2,6 14,4 -1,6±0,4 21,7 42,3±6,1 14,4<br /> S<br /> Bo 79,0± 9,4 11,9 22,0±2,0 9,1 -2,1±0,5 26,7 47,0±6,9 14,8<br /> E13S-2 78,3±8,0 10,2 20,5±1,7 8,3 -3,4±0,5 14,7 46,6±6,9 14,7<br /> E13S-5 74,1±5,2 7,1 19,5±1,7 8,7 -4,2±0,9 21,7 40,4±7,5 18,6<br /> E15S 80,6±9,8 12,1 25,8±1,9 7,4 -4,9±1,4 27,9 35,6±3,9 10,9<br /> E17S 64,0±3,2 5,0 22,9±2,0 8,7 -5,1±1,2 24,1 34,8±5,6 16,1<br /> E26S 64,4±3,3 5,2 22,9±2,0 8,7 -4,9±1,0 20,8 34,9±5,4 15,4<br /> E30S 64,5±36 5,6 23,3±2,7 11,6 -3,5±0,8 24,0 30,4±6,8 22,4<br /> SE21 81,5±2,1 2,6 23,4±2,0 8,6 -3,6±0,9 24,7 42,9±6,6 15,5<br /> T1S-96 (Đ/C) 74,4±5,4 7,3 21,9±2,1 9,1 -5,5±1,0 17,4 42,5±7,2 16,9<br /> T7S 62,2±3,6 5,9 20,0±2,0 10,0 -5,8±0,9 15,8 38,7±4,8 12,5<br /> T827S 69,2±1,7 2,4 18,7±1,6 8,6 -3,6±0,9 24,7 36,1±6,3 17,5<br /> TG1 64,0±3,2 5,0 19,3±1,6 8,3 -6,4±0,9 14,8 43,7±7,7 17,5<br /> <br /> <br /> <br /> 15<br /> Phạm Văn Thuyết, Đàm Văn Hưng, Nguyễn Quốc Trung Trần Văn Quang, Lê Quốc Doanh<br /> <br /> <br /> <br /> Bảng 4. Một số đặc điểm hình thái của các dòng TGMS trong vụ xuân 2014<br /> Dòng Kiểu đẻ nhánh Màu sắc thân Màu sắc nhụy Râu đầu hạt<br /> 103BB4 Gọn Xanh nhạt Trắng Râu ngắn<br /> 103BB7 Gọn- yếu Xanh nhạt Trắng Râu ngắn<br /> AT-1 Chụm- khỏe Xanh nhạt Trắng Không râu<br /> AT-2 Chụm- khỏe Xanh nhạt Trắng Không râu<br /> AT-3 Chụm- khỏe Xanh nhạt Trắng Không râu<br /> AT-4 Chụm- khỏe Xanh nhạt Trắng Râu ngắn<br /> AT-5 Chụm- khỏe Xanh nhạt Trắng Không râu<br /> S<br /> Bo Chụm- khỏe Xanh nhạt Tím Không râu<br /> E13S-2 Gọn Tím Tím Không râu<br /> E13S-5 Gọn- khỏe Tím Tím Không râu<br /> E15S Chụm Tím Tím Râu dài<br /> E17S Chụm Xanh nhạt Trắng Râu ngắn<br /> E26S Chụm Xanh nhạt Trắng Râu ngắn<br /> E30S Chụm Xanh nhạt Trắng Râu ngắn<br /> SE21 Chụm Xanh nhạt Trắng Râu ngắn<br /> T1S-96 (Đ/C) Gọn Xanh nhạt Trắng Râu dài<br /> T7S Chụm Xanh nhạt Tím Không râu<br /> T827S Gọn- khỏe Xanh nhạt Trắng Râu ngắn<br /> TG1 Chụm Xanh nhạt Tím Râu ngắn<br /> <br /> <br /> <br /> Các dòng AT-1, AT-2, AT-3, AT-4, AT-5 và thơm ở lá và nội nhũ ở mức không thơm. Các<br /> S<br /> Bo trong thí nghiệm có kiểu đẻ nhánh chụm - dòng còn lại có mùi thơm trên lá được đánh giá ở<br /> khỏe; dòng 103BB4, E13S-2 và đối chứng có mức thơm và trên nội nhũ được đánh giá ở mức<br /> kiểu đẻ nhánh gọn; dòng 103BB7 có kiểu đẻ không thơm trừ dòng E13S-2 có mùi thơm trên<br /> nhánh gọn - yếu; dòng E13-5 và T827S có kiểu nội nhũ là thơm nhẹ.<br /> đẻ nhánh gọn - khỏe; các dòng cong lại đều có<br /> kiểu đẻ nhánh chụm. Hầu hết các dòng TGMS 3.3. Đặc điểm tính dục của các dòng TGMS<br /> thân màu xanh nhạt, có 3 dòng TGMS có màu Kết quả trình bày ở bảng 6 cho thấy tỷ lệ<br /> tím là E13S-2, E13S-5 và E15S. Màu sắc vòi vươn vòi nhụy một phía và hai phía ở tất cả các<br /> nhụy cái chủ yếu có màu trắng trừ các dòng dòng rất cao. Tỷ lệ vươn vòi nhụy hai phía của<br /> E13S-2, E13S-5, E15S, BoS, T7S và TG1 có màu các dòng AT-2, E30S, SE21, T7S, T827S thấp<br /> nhụy cái là màu tím. Hầu hết các dòng nghiên hơn đối chứng, còn lại cao hơn so với đối chứng.<br /> cứu đều không có râu hoặc có râu ngắn, trừ Tỷ lệ vươn vòi nhụy một phía của các dòng cao<br /> dòng E15S và đối chứng có râu dài. hơn đối chứng trừ các dòng AT-1, AT-2, AT-4,<br /> BoS, E17S, E30S thấp hơn đối chứng. Tỷ lệ vươn<br /> 3.2. Đánh giá mùi thơm trên lá và nội nhũ vòi nhụy của tất cả các dòng đều cao hơn đối<br /> của các dòng TGMS chứng trừ dòng E30S và SE21 thấp hơn so với<br /> Qua bảng 5, các dòng AT-1, AT-2, AT-3, AT- đối chứng. Dòng AT-4 vừa có tỷ lệ vươn vòi<br /> 4, AT-5, E15 có mùi thơm trên lá được đánh giá ở nhụy hai phía cao nhất (72,01%), cao hơn so với<br /> mức thơm đậm và trên nội nhũ ở mức thơm. Các đối chứng là 21,48%, vừa là dòng có tỷ lệ vươn<br /> dòng 103BB4, T1S-9, T7S được đánh giá mùi vòi thấp nhất (15,49%), thấp hơn so với đối<br /> <br /> <br /> <br /> 16<br /> Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS<br /> <br /> <br /> <br /> Bảng 5. Bảng đánh giá điểm mùi thơm trên lá và trên nội nhũ<br /> của các dòng TGMS trong vụ xuân 2014<br /> Dòng Mùi thơm trên<br /> Lá Nội nhũ<br /> 103BB4 Không thơm Không thơm<br /> 103BB7 Thơm Không thơm<br /> AT-1 Thơm đậm Thơm<br /> AT-2 Thơm đậm Thơm<br /> AT-3 Thơm đậm Thơm<br /> AT-4 Thơm đậm Thơm<br /> AT-5 Thơm đậm Thơm<br /> S<br /> Bo Thơm Không thơm<br /> E13S-2 Thơm Thơm nhẹ<br /> E13S-5 Thơm Không thơm<br /> E15S Thơm đậm Thơm<br /> E17S Thơm Không thơm<br /> E26S Thơm Không thơm<br /> E30S Thơm Không thơm<br /> SE21 Thơm Không thơm<br /> T1S-96 (Đ/C) Không thơm Không thơm<br /> T7S Không thơm Không thơm<br /> T827S Thơm Không thơm<br /> TG1 Thơm Không thơm<br /> <br /> <br /> <br /> chứng là 7,75%. Tỷ lệ vươn vòi nhụy hai phía sức sinh trưởng của cây mạ. Sâu đục thân hai<br /> nhỏ nhất là dòng SE21 (42,32%), thấp hơn so với chấm gây hại chủ yếu khi cây lúa ở giai đoạn làm<br /> đối chứng là 8,21%. Tỷ lệ vươn vòi nhụy một đòng và trỗ với mức độ nhiễm rất nhẹ (dòng AT-<br /> phía cao nhất ở dòng T7S (32,8%), cao hơn đối 1, AT-2, AT-3, AT-4, AT-5, BoS, E13-2, E13-5 và<br /> chứng là 9,56%. Thời gian hoa nở trên bông của SE21) và không nhiễm. Sâu cuốn lá nhỏ xuất<br /> dòng AT-2 nở ngắn nhất là 4 ngày, dài nhất là hiện ở giai đoạn đẻ nhánh đến giai đoạn trỗ với<br /> dòng T827S (nở trong 10 ngày). Các dòng mức độ từ không nhiễm đến nhiễm rất nhẹ. Các<br /> 103BB7, AT-1, AT-2, BoS, E13S-5, SE21 có thời dòng bị nhiễm gồm AT-1, AT-2, AT-3, AT-4, AT-<br /> gian nở hoa trên bông ngắn hơn so với đối chứng 5, BoS, E13S-2, E13S-5 và đối chứng. Rầy nâu<br /> từ 1-3 ngày; các dòng còn lại có thời gian nở hoa xuất hiện ở tất cả các dòng khi cây lúa trong giai<br /> trên bông bằng hoặc dài hơn so với đối chứng từ đoạn chín với mức độ gây hại rất nhẹ. Bệnh đạo<br /> 2-3 ngày. ôn xuất hiện ở tất cả các giai đoạn sinh trưởng<br /> 3.4. Mức độ nhiễm sâu bệnh trong điều của cây lúa, đặc biệt là giai đoạn mạ và giai đoạn<br /> kiện tự nhiên của các dòng TGMS từ đẻ nhánh đến trỗ nhưng mức độ gây hại rất<br /> Kết quả trình bày ở bảng 7 cho thấy bọ trĩ nhẹ và không gây hại (dòng 103BB4, 103BB7,<br /> xuất hiện chủ yếu ở giai đoạn mạ và giai đoạn BoS, E17S và TG1). Tất cả các dòng mẹ đều<br /> lúa mới cấy nhưng không ảnh hưởng nhiều đến không bị nhiễm bệnh khô vằn.<br /> <br /> <br /> <br /> <br /> 17<br /> Phạm Văn Thuyết, Đàm Văn Hưng, Nguyễn Quốc Trung Trần Văn Quang, Lê Quốc Doanh<br /> <br /> <br /> <br /> Bảng 6. Tỷ lệ vươn vòi nhụy và thời gian nở hoa trên bông<br /> của các dòng TGMS trong vụ xuân 2014<br /> Dòng Tỷ lệ vòi nhụy vươn ra ngoài vỏ trấu (%) Thời gian nở hoa<br /> Vươn hai phía Vươn một phía Tổng số trên bông (ngày)<br /> <br /> 103BB4 57,65 24,01 81,66 7<br /> 103BB7 56,86 26,85 83,71 6<br /> AT-1 62,77 21,45 84,22 6<br /> AT-2 50,19 21,71 71,90 4<br /> AT-3 56,68 27,24 83,92 8<br /> AT-4 72,01 15,49 87,50 7<br /> AT-5 54,31 27,29 81,59 7<br /> BoS 67,87 19,98 87,85 6<br /> E13S-2 61,76 25,75 87,51 7<br /> E13S-5 63,68 25,44 89,12 5<br /> E15S 53,42 27,25 80,67 9<br /> E17S 69,27 21,65 90,91 8<br /> E26S 51,35 25,06 76,40 7<br /> E30S 50,00 22,81 72,81 8<br /> SE21 42,32 26,76 69,09 6<br /> T1S-96 (Đ/C) 50,53 23,24 73,77 7<br /> T7S 50,18 32,80 82,98 8<br /> T827S 50,40 23,76 74,16 10<br /> TG1 55,10 28,94 84,04 7<br /> <br /> <br /> <br /> Bảng 7. Mức độ nhiễm sâu bệnh tự nhiên của các dòng TGMS trong vụ xuân 2014<br /> Dòng Sâu hại Bệnh hại<br /> Bọ trĩ Sâu cuốn lá nhỏ Sâu đục thân Rầy nâu Dòi đục lá Đạo ôn Khô vằn<br /> 103BB4 0 0 0 1 0 0 0<br /> 103BB7 0 0 0 1 0 0 0<br /> AT-1 0 1 1 1 1 1 0<br /> AT-2 0 1 1 1 1 1 0<br /> AT-3 0 1 1 1 1 1 0<br /> AT-4 0 1 1 1 1 1 0<br /> AT-5 0 1 1 1 1 1 0<br /> S<br /> Bo 0 0 1 1 0 0 0<br /> E13S-2 0 1 1 1 0 1 0<br /> E13S-5 0 1 1 1 0 1 0<br /> E15S 0 0 0 1 0 1 0<br /> E17S 0 0 0 1 0 0 0<br /> E26S 0 0 0 1 0 1 0<br /> E30S 0 0 0 1 0 1 0<br /> SE21 0 0 1 1 1 1 0<br /> T1S-96 (Đ/C) 0 1 0 1 1 1 0<br /> T7S 0 0 0 1 0 1 0<br /> T827S 0 0 0 1 0 1 0<br /> TG1 0 0 0 1 0 0 0<br /> <br /> Ghi chú: Điểm 0- không nhiễm; điểm 1- rất nhẹ; điểm 3- nhẹ; điểm 5- trung bình<br /> <br /> <br /> 18<br /> Đánh giá đặc điểm nông học và xác định gen mẫn cảm nhiệt độ của một số dòng TGMS<br /> <br /> <br /> <br /> 3.5. Các yếu tố cấu thành năng suất và E13S-2 (26,2g), cao hơn đối chứng 1,6g. Các<br /> năng suất của các dòng TGMS dòng còn lại thấp hơn đối chứng; dòng có khối<br /> Bảng 8 cho thấy các dòng AT-1, AT-2, AT-3, lượng 1.000 hạt thấp nhất là TG1 (19,3g), thấp<br /> AT-4, AT-5, BoS, E13S-2, E13S-5, T827S có số hơn đối chứng 5,3g. Tỷ lệ hạt chắc của các dòng<br /> bông trên khóm cao hơn đối chứng, trong đó biến động khá lớn từ 0-91%. Các dòng E26S,<br /> dòng AT-4 cao nhất với 8 bông trên khóm (cao E30S, SE21, T827S không có chắc vì giai đoạn<br /> hơn đối chứng 3,3 bông/khóm). Các dòng còn lại phân hóa hình thành tế bào mẹ hạt phấn có<br /> có số bông trên khóm ít hơn so với đối chứng; nhiệt độ cao trên ngưỡng chuyển hóa tính dục<br /> dòng 103BB4 có số bông trên khóm ít nhất là nên khi trỗ đều bất dục 100%, không xác định<br /> 2,7 bông/khóm (thấp hơn so với đối chứng 2 được khối lượng 1.000 hạt và năng suất cá thể.<br /> bông/khóm). Số hạt trên bông của các dòng biến Các dòng còn lại có tỷ lệ hạt chắc cao hơn so với<br /> động từ 156,3-208,8 hạt/bông, đối chứng có số đối chứng, trừ dòng 103BB7 thấp hơn đối chứng<br /> hạt trên bông là 195,3 hạt/bông. Các dòng AT-2, 0,6%. Dòng có tỷ lệ hạt chắc cao nhất là dòng<br /> AT-3, AT-4, AT-5 E15S, TG1 có số hạt trên BoS, đạt 91%. Năng suất cá thể của các tổ hợp<br /> bông thấp hơn so với đối chứng. Dòng có số hạt biến động từ 0-16 g/khóm, trong đó hầu hết các<br /> trên bông đạt cao nhất là tổ hợp AT-5 (208,8 dòng có năng suất cá thể cao hơn đối chứng, chỉ<br /> hạt/bông), cao hơn đối chứng 15,3 hạt/bông. có 5 dòng năng suất cá thể thấp hơn đối chứng<br /> Dòng BoS có số hạt thấp nhất, ít hơn 39 là: E26S, E30S, SE21, 827S không thu được<br /> hạt/bông so với đối chứng. Khối lượng 1.000 hạt năng suất và dòng 103BB7 có năng suất cá thể<br /> của các dòng 103BB4, AT-4, E13S-2, E13S-5 là 0,5 g/khóm. Dòng có năng suất cá thể cao<br /> cao hơn hoặc bằng đối chứng, dòng cao nhất là nhất là dòng AT-2 với năng suất là 16 g/khóm.<br /> <br /> Bảng 8. Các yếu tố cấu thành năng suất và năng suất của các dòng TGMS<br /> trong vụ xuân 2014<br /> Dòng Số bông/khóm Số hạt/bông (hạt) Tỷ lệ Khối lượng Năng suất cá<br /> hạt chắc (%) 1.000 hạt (g) thể (g/khóm)<br /> 103BB4 3,8 191,2 7,3 24,8 1,0<br /> 103BB7 2,7 169,3 4,2 24,1 0,5<br /> AT-1 5,6 191,2 77,9 21,5 11,8<br /> AT-2 7,5 207,2 67,0 22,8 16,0<br /> AT-3 6,5 205,5 66,5 21,7 13,6<br /> AT-4 8,0 196,5 52,2 24,9 10,3<br /> AT-5 7,8 208,8 41,4 22,9 9,3<br /> S<br /> Bo 4,8 156,3 91,0 20,5 11,7<br /> E13S-2 5,4 173,4 12,9 26,2 1,8<br /> E13S-5 5,2 184,2 25,2 24,6 3,8<br /> E15S 3,5 201,2 37,0 24,3 7,0<br /> E17S 4,3 168,8 18,2 22,9 2,2<br /> E26S 4,4 158,0 0,0 - 0,0<br /> E30S 4,2 175,6 0,0 - 0,0<br /> SE21 4,6 199,4 0,0 - 0,0<br /> T1S-96 (Đ/C) 4,7 195,3 4,8 24,6 0,7<br /> T7S 2,8 179,1 17,5 24,4 2,1<br /> T827S 6,1 176,9 0,0 - 0,0<br /> TG1 3,7 199,8 10,0 19,3 3,0<br /> <br /> <br /> <br /> 19<br /> Phạm<br /> m Văn Thuy<br /> Thuyết, Đàm Văn Hưng, Nguyễn Quốc Trung Trần<br /> n Văn Quang, Lê Quốc Doanh<br /> <br /> <br /> <br /> 3.6. Xác định gen tms của<br /> a các dòng TGMS ADN kích thước khoảng 180bp so với mẫu<br /> Dựa trên các công bố xác định gen tms và IR24 là 160bp, chứng tỏ 16 dòng TGMS<br /> các chỉ thị liên kết chặt nhỏ hơn 5cM được lựa nghiên cứu đều mang gen tms5. Sử dụng chỉ<br /> chọn cho kỹ thuật PCR phát hiện gen. Các mẫu thị RM257 đặc hiệu cho gen tms4 đã xác định<br /> mang gen được xác định dựa trên kích thước sản được 1 mẫu 827S mang gen tms4 có băng<br /> phẩm PCR và so sánh với mẫu đối chứng IR24. ADN kích thước<br /> ớc khoảng 140bp, 15 mẫu còn<br /> Kết quả được trình bày ở bảng 9. lại đều không mang gen tms4 vì cho băng<br /> Kết quả PCR sử dụng chỉ thị C365<br /> C365-1 ở ADN khoảng 155bp, tương tự như IR24<br /> hình 1 cho thấy tất cả 16 mẫu đều cho băng (Hình 2).<br /> <br /> Bảng 9. Kế<br /> ết quả xác định gen tms của<br /> a các dòng TGMS<br /> Dòng tms1 tms2 tms3 tms4 tms5 tms6<br /> (OBP-19) (RM11) (F18F/F18RM) (RM257) (C365-1)<br /> 1) (RM3351)<br /> AT1 - - - - + -<br /> AT2 - - - - + -<br /> AT3 - - - - + -<br /> AT4 - - - - + -<br /> E17S - - - - + -<br /> E26S - - - - + -<br /> E30S - - - - + -<br /> SE21 - - - - + -<br /> 103BB7 - - - - + -<br /> 103BB4 - - - - + -<br /> E15S - - - - + -<br /> S<br /> Bo - - - - + -<br /> 827S - - - + + -<br /> T1S-96 - - - - + -<br /> TG1 - - - - + -<br /> T7S - - - - + -<br /> <br /> Ghi chú: (-)) không gen tms, (+) có gen tms<br /> <br /> <br /> <br /> <br /> Hình 1. Điện di sản phẩm PCR phát hiện gen tms5 bằng chỉ thị C365-1<br /> <br /> <br /> <br /> <br /> 20<br /> Đánh giá đặc điểm nông họcc và xác đ<br /> định gen mẫn cảm nhiệt độ của một số dòng TGMS<br /> <br /> <br /> <br /> <br /> Hình 2.. Điện di sản phẩm PCR phát hiệ<br /> hiện gen tms4 bằng chỉ thị RM257<br /> <br /> <br /> 4. KẾT LUẬN Hai Zhou, Qinjian Liu, Jing Li, Dagang Jiang, Lingyan<br /> Zhou, Ping Wu, Sen Lu, Feng Li, Liya Zhu,<br /> Các dòng TGMS có thời gian sinh trưởng từ Zhenlan Liu, Letian Chen, Yao-Guang Yao Liu,<br /> 140-163 ngày trong vụ xuân,, có số lá trên thân Chuxiong Zhuang (2012). (2012) Photoperiod- and<br /> thermo-sensitive<br /> sensitive genic male sterility in rice are<br /> chính từ 14-16 lá, cây thấp, bông dài trung<br /> caused by a point mutation in a novel noncoding<br /> bình, lá đòng ngắn, trỗ nghẹn,<br /> ghẹn, có kiểu đẻ nhánh RNA that produces a small RNA, Cell Research,<br /> Research<br /> gọn hoặc chụm. Các<br /> ác dòng E15, AT<br /> AT-1, AT-2, AT- 22: 649-660.<br /> 3, AT-4, AT-5 có mùi thơm cả trên lá và nội Hui Zhang, Chenxi Xua,YiHea, Jie Zong, Xijia Yanga<br /> nhũ. Huamin Si, Zongxiu Sun, Jianping Hu, Wanqi<br /> Lianga, and Dabing Zhanga (2013), Mutation in<br /> Hầu hết các dòng TGMS có tỷ lệ vươn vòi<br /> CSA creates a new photoperiod-sensitive<br /> photoperiod genic<br /> nhụy cao hơn đối chứng T1S-96,<br /> 96, thời gian nở male sterile line applicable for hybrid rice seed<br /> hoa trên bông khá dài (4-10 ngày). Các dòng production, 110(1): 76-81.<br /> 81.<br /> TGMS có số hạt trên bông khá cao ((168,8-208,8 Nguyen Tri Hoan, Le Quoc Thanh, Pham Dong Quang,<br /> hạt), khối lượng 1.000 hạt của các dòng biến Ngo Van Giao, Duong Thanh Tai (2014).(2 Research<br /> động từ 19,3-26,2g. and development of hybrid rice in Vietnam,<br /> Symposium on Hybrid Rice: Ensuring Food<br /> Tất cả 16 dòng TGMS trong nghiên cứu này Security<br /> rity in Asia, Bangkok, Thailand.<br /> đều mang gen tms5,, duy nhất có dòng 827S<br /> IRRI (2002). Standard evaluation system for rice.<br /> đồng thời mang 2 gen là tms4 và tms5. (IRRI P.O. Box 933. 1099-<br /> 1099 Manila Philippines).<br /> Kabria K., Islam M.M. and Begum S.N. (2008).<br /> TÀI LIỆU<br /> U THAM KH<br /> KHẢO “Screening of aromatic rice lines by phenotypic<br /> and molecular markers”, Bangladesh J. Bot., 37(2):<br /> 37(2)<br /> Cục Trồng trọt (2014). Báo cáo tổng<br /> ổng kết năm 2013 vvà 141-147.<br /> triển khai nhiệm vụ trọngọng tâm năm 2014, ngày<br /> Lee DS, Chen LJ, Suh HS. (2005). Genetic<br /> 25/1/2104, Hà Nội.<br /> characterization and fine mapping of a novel<br /> CHEN Li-yun, XIAO Ying-hui, hui, LEI DongDong-yang thermo-sensitive<br /> sensitive genic male-<br /> male sterile gene tms6 in<br /> (2010). Mechanism of Sterility and Breeding rice (Oryza sativa L.). Theor. Appl. Genet., 111:<br /> Strategies for Photoperiod/Thermo<br /> Photoperiod/Thermo- Sensitive 271-277.<br /> Genic Male Sterile Rice, Rice Science<br /> Science, 17(3):161- Lopez M.T. et al. (2003). Microsatellite Makers<br /> 167. Flanking the tms2 Gene Facilitated Tropical<br /> Dong NV, Subudhi PK, Luong PN PN, Quang VD, Quy TGMS Rice Line Development. Crop sci., sci 43(6):<br /> TD, Zheng HG, Wang B, Nguyen HT. (2000). 2267-2271.<br /> Molecular mapping of a rice gene conditioning Reddy OK, Siddiq EA, Sarma NP, Ali J, Hussain AJ,<br /> thermosensitive genic male sterility using AFLP, Nimmakayala P, Ramasamy P, Pammi S, Reddy<br /> RFLP, and SSR techniques. Theor. Appl. Genet, AS. (2000).. Genetic analysis of temperature-<br /> temperature<br /> 100: 27-34. sensitive male sterility in rice. Theor. Appl. Genet.,<br /> Genet<br /> Gomez, Kwanchai A. and Arturo A. Gomez (1984). 100: 794-801.<br /> Statistical procedures for agricultural research, 2nd Subudhi PK, Borkakati RP, Virmani SS, Huang N.<br /> Edition. John Wiley & Sons, Inc. (1997).. Molecular mapping of a thermosensitive<br /> thermose<br /> <br /> <br /> 21<br /> Phạm Văn Thuyết, Đàm Văn Hưng, Nguyễn Quốc Trung Trần Văn Quang, Lê Quốc Doanh<br /> <br /> <br /> genetic male sterility gene in rice using bulked gene in rice (Oryza sativa L.) with molecular<br /> segregant analysis. Genome, 40: 188-194. markers. Theor. Appl. Genet., 91: 1111-1114.<br /> Sood B.C. and Siddiq E.A. (1978). A rapid technique Wang YG, Xing QH, Deng QY, Liang FS, Yuan LP,<br /> for scent determination in rice, Indian J. Genet. Weng ML, Wang B. (2003). Fine mapping of the<br /> Plant Breed., 38: 268-271. rice thermo-sensitive genic male sterile gene<br /> TMS5. Theor. Appl. Genet., 107: 917-921.<br /> Peng HF, Chen XH, Lu YP, Peng YF, Wan BH, Chen<br /> ND, Wu B, Xin SP, Zhang GQ (2010). Fine Yamaguchi Y, Ikeda R, Hirasawa H, Minami M,<br /> mapping of a gene for non-pollen type Ujikara A (1997). Linkage analysis of<br /> thermosensieive genic male sterility in rice (Oryza thermosensitive genic male sterility gene, TMS2,<br /> sativa L.). Theor Appl. Genet., 120: 1013-1020. in rice (Oryza sativa L.). Breed. Sci., 47: 371-373.<br /> Wang B, Wang JZ, Wu W, Zheng HG, Yang ZY, Xu Yuan L.P. and Xi Qui Fu (1995). Technology of hybrid<br /> WW, Ray JP, Nguyen HT (1995). Tagging and rice production, Food and Agriculture<br /> mapping the thermosensitive genic male sterile Organization of the United Nation, Rome, p.84.<br /> <br /> <br /> <br /> <br /> 22<br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2