Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium Kiyohiko Igarashi1, Makoto Yoshida1, Hirotoshi Matsumura2, Nobuhumi Nakamura2, Hiroyuki Ohno2, Masahiro Samejima1 and Takeshi Nishino3
1 Department of Biomaterials Sciences, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan 2 Department of Biotechnology, Tokyo University of Agricultural and Technology, Japan 3 Department of Biochemistry and Molecular Biology, Nippon Medical School, Tokyo, Japan
Keywords cellobiose dehydrogenase; cellulose degradation; electron-transfer; Phanerochaete chrysosporium
Correspondence K. Igarashi, Department of Biomaterials Sciences, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan Fax: +81 3 5841 5273 Tel: +81 3 5841 5258 E-mail: aquarius@mail.ecc.u-tokyo.ac.jp
(Received 27 February 2005, revised 26 March 2005, accepted 6 April 2005)
Cellobiose dehydrogenase (CDH) is an extracellular flavocytochrome con- taining flavin and b-type heme, and plays a key role in cellulose degrada- tion by filamentous fungi. To investigate intermolecular electron transfer from CDH to cytochrome c, Phe166, which is located in the cytochrome domain and approaches one of propionates of heme, was mutated to Tyr, and the thermodynamic and kinetic properties of the mutant (F166Y) were compared with those of the wild-type (WT) enzyme. The mid-point potential of heme in F166Y was measured by cyclic voltammetry, and was estimated to be 25 mV lower than that of WT at pH 4.0. Although pre- steady-state reduction of flavin was not affected by the mutation, the rate of subsequent electron transfer from flavin to heme was halved in F166Y. When WT or F166Y was reduced with cellobiose and then mixed with cytochrome c, heme re-oxidation and cytochrome c reduction occurred syn- chronously, suggesting that the initial electron is transferred from reduced heme to cytochrome c. Moreover, in both enzymes the observed rate of the initial phase of cytochrome c reduction was concentration dependent, whereas the second phase of cytochrome c reduction was dependent on the rate of electron transfer from flavin to heme, but not on the cytochrome c concentration. In addition, the electron transfer rate from flavin to heme was identical to the steady-state reduction rate of cytochrome c in both WT and F166Y. These results clearly indicate that the first and second electrons of two-electron-reduced CDH are both transferred via heme, and that the redox reaction of CDH involves an electron-transfer chain mech- anism in cytochrome c reduction.
Cellulose is the most abundant natural polymer on earth, and its degradation is thus an important compo- nent of the carbon cycle. Although cellulose is often referred to as a b-linked glucose polymer, cellobiose, a b-1,4-linked glucose dimer, should strictly be regarded as the repeating unit of cellulose, because adjacent glucoses show opposing faces to each other in the cel- lulose chain [1,2]. Many microorganisms recognize this
repeating unit and hydrolyze cellulose to cellobiose as an initial step in the metabolism [3]. In filamentous fungi, cellulose degradation had been thought to pro- ceed via two-step hydrolysis, i.e. cellulose is hydrolyzed to cellobiose by various cellulases and the product is further hydrolyzed to glucose by b-glucosidase. How- ever, recent cytochemical, kinetic, and transcriptional supported another hypothesis studies
[4–6] have
doi:10.1111/j.1742-4658.2005.04707.x
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2869
Abbreviations CDH, cellobiose dehydrogenase; F166Y, Phe166Tyr mutant CDH; NHE, normal hydrogen electrode; WT, wild-type CDH.
the white-rot
concerning the contribution of cellobiose dehydroge- nase (CDH; EC 1.1.99.18) to the extracellular cellulose fungus Phanerochaete metabolism of chrysosporium, and the importance of a combination in cellulose- of hydrolytic and oxidative reactions degrading fungi as discussed previously [7–13].
CDH is
produced using the heterologous expression system of Pichia pastoris. Presteady-state reduction of cyto- chrome c and re-oxidation of heme in the recombinant wild-type (WT) and mutant enzymes were observed by sequential mixing in a three-syringe stopped-flow spec- trophotometer to clarify the redox mechanism of CDH.
K. Igarashi et al. Electron transfer chain reaction of CDH
Results
Redox properties of WT and F166Y CDH
an oxidase
the only extracellular flavocytochrome known to be secreted by filamentous fungi during cel- lulose degradation [11–13]. This enzyme carries flavin and a b-type heme in different domains, and the flavin domain catalyzes the dehydrogenation of cellobiose and cello-oligosaccharides to the corresponding d-lac- tones [8,9,14,15]. Although this enzyme was initially characterized as (cellobiose oxidase; EC 1.1.3.25) [8], its higher affinity for quinones and ferric compounds than for oxygen [16–18] and the low- spin character of the heme in both the ferric and fer- rous states [19] indicate that the electron acceptor of this enzyme is not molecular oxygen. Although many candidates have been proposed for the electron accep- tor of CDH, its natural electron acceptor and the phy- siological function of the oxidative half reaction of this enzyme are still uncertain.
The redox potentials of WT and F166Y were com- pared at various pH values, as shown in Fig. 2A. The potential of F166Y was lower than that of WT at all pH values, but the difference was larger at lower pH than at neutral pH. The potentials of WT and F166Y were estimated to be 176 and 151 mV vs. normal hydrogen electrode (NHE) at pH 4.0. Although the potential of F166Y is 25 mV lower than that of WT, it is still high enough to receive the electron from reduced flavin, because addition of cellobiose causes spectral changes in F166Y from the oxidized to the reduced form (Fig. 2B). Reduced F166Y has typical absorption maxima of CDH at 562, 533 and 428 nm due to a-, b- and c-(Soret) bands, respectively, and the absorption decreased at around 480 nm mainly because of flavin reduction. These results are essen- tially the same as those for the WT enzyme [24] and suggest that both flavin and heme are active in the mutant enzyme.
Presteady-state and steady-state kinetics of F166Y
ferric compounds
The presteady-state reduction of flavin and the subse- quent electron transfer from flavin to heme in WT and F166Y were observed by stopped-flow spectrophoto- metry (Fig. 3). The addition of cellobiose caused rapid reduction of flavin, and the absorption at the isosbestic point of heme (449.0 nm) decreased similarly in both
In a previous kinetic study, we showed the pre- steady-state two-electron reduction of flavin, followed by interdomain one-electron transfer from flavin to heme, resulting in the formation of the flavin semi- quinone radical and reduced heme [20]. In order to achieve full understanding of the redox reaction of CDH, the reduction mechanism of the electron accep- tor should be clarified. However, several groups have proposed two possible mechanisms for this reaction; electron transfer chain and electron sink mechanisms [21–23]. In the putative electron transfer chain reac- such as cytochrome c are tion, reduced by heme after one-electron transfer from fla- vin, whereas the flavin radical or fully reduced flavin is an electron donor in the electron sink mechanism. In this study, Phe166, which approaches heme propion- ate, as shown in Fig. 1, was mutated to Tyr, and the slow interdomain electron transfer mutant F166Y was
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2870
Fig. 1. Stereo representation of the heme in CDH and the amino acids within 4 A˚ of the heme. Heme and Phe166 are indicated in color. The model was generated from PDB 1D7C [35] using the software PYMOL (DeLano Scientific LLC, San Francisco, CA, USA).
K. Igarashi et al. Electron transfer chain reaction of CDH
A
A
B
B
Fig. 2. (A) pH dependence of the midpoint potential of heme in WT (h) and F166Y (d). (B) Absorption spectra of oxidized (solid line) and reduced (dotted line) forms of F166Y. Midpoint potentials of heme in CDH were measured by cyclic voltammetry as described in Experimental procedures. For the absorption spectra, 2.0 lM F166Y was scanned with or without 50 lM cellobiose in 50 mM sodium acetate buffer, pH 4.0.
) and F166Y (K F166Y
d
d
WT and F166Y (Fig. 3A). The observed rates (kobs) of WT and F166Y reduction were 53.0 ± 1.0 and 50.0 ± 1.3 s)1, respectively. In contrast, an apparent difference in heme reduction was observed between WT and F166Y, as shown in Fig. 3B. In WT CDH, (cid:1) 90% of heme was reduced within 0.1 s, whereas in F166Y, 13% of heme was still in the oxidized form at 0.2 s after mixing with the substrate. The kobs values reduction of WT and F166Y were for heme 30.2 ± 1.2 and 12.5 ± 0.9 s)1, respectively. These results suggest that only the electron transfer step from flavin to heme was halved in F166Y, whereas the ini- tial flavin reduction was not affected by the muta- tion. Presteady-state kinetic experiments for flavin and heme reduction were carried out at various substrate
concentrations, as shown in Fig. 4. The kobs values for flavin reduction were identical for WT and F166Y (Fig. 4A), whereas those of heme reduction in F166Y was almost half of that of WT at all substrate concen- trations tested (Fig. 4B). The dissociation constants of WT (K WT ) obtained from the plots were 107 ± 6.6 and 111 ± 6.5 lm, respectively. As shown in a previous presteady-state kinetic study of WT CDH, heme reduction was inhibited at high substrate concentrations. In this study, this phenom-
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2871
Fig. 3. Presteady-state reduction of WT and F166Y by cellobiose. (A) Time courses of absorption at 449 nm for monitoring flavin reduction. (B) Time courses of absorption at 562 nm for monitoring heme reduction. Solid line, F166Y; dashed line, WT. CDH and cello- biose (final concentrations of 5 and 100 lM, respectively) were mixed in 50 mM sodium acetate buffer (pH 4.0), and the absorption changes were monitored by stopped-flow photometry at 30 (cid:1)C.
K. Igarashi et al. Electron transfer chain reaction of CDH
A
lim ) and F166Y (kF166Y
two enzymes. The limiting rates of heme reduction for WT (kWT ) were 46.9 ± 6.8 and lim 18.8 ± 1.0 s)1, respectively.
B
The steady-state kinetic parameters are summarized in Table 1. As expected from the presteady-state experiment, there is no difference in these parameters between WT and F166Y using ubiquinone as an electron acceptor, whereas the mutation affected the kinetic parameters when the redox reaction was mon- itored in terms of cytochrome c reduction. The kcat values of cellobiose oxidation monitored in terms of cytochrome c reduction were quite similar to the klim values of heme reduction in both WT and F166Y. Interestingly, an increase in cytochrome c concentra- tion inhibited its reduction only in the case of F166Y.
Sequential mixing experiment of WT and F166Y
To monitor the redox state of heme in CDH and cyto- chrome c independently in the same reaction mixture, the oxidized and reduced spectra of CDH and cyto- chrome c were compared, as shown in Fig. 5. In each hemoprotein, there are four isosbestic points in the 500–600 nm region, where the a- and b-bands of heme absorb. We selected 549.0 and 556.7 nm to monitor cytochrome c and heme in CDH, respectively, because these gave the maximum absorption difference.
reduction of
and 643 ± 10 s)1,
662 ± 17
inhibition
constant
i
After the initial mixing of WT or F166Y with cello- biose, cytochrome c was added to the reaction mixture and the changes in absorption at 549.0 and 556.7 nm were monitored (Fig. 6). The cyto- chrome c and re-oxidation of heme in CDH were observed synchronously, and the kobs values for cyto- chrome c reduction by WT and F166Y were estima- respectively ted as (Fig. 6A,C) i.e. almost the same value for the two enzymes. The kobs values for the secondary phase, however, were 27.7 ± 2.1 (WT) and 13.3 ± 4.1 (F166Y). These values are quite similar to those of
enon was also observed in F166Y, and the sub- of F166Y (K F166Y strate ¼ 1130 ± 130 lm) was similar to that of WT (K WT i ¼ 1230 ± 180 lm), reflecting the similar Kd values of the
Fig. 4. Cellobiose concentration dependence of the observed rate (kobs) for flavin (A) and heme (B) reduction in WT (s) and F166Y (j). kobs values for both prosthetic groups were obtained under the same conditions as in Fig. 3, using 25–500 lM cellobiose as a sub- strate. The fitting of the data was performed as described in Experimental procedures.
Table 1. Steady-state kinetic constants for WT and F166Y. All measurements were carried out at 30 (cid:1)C in 50 mM sodium acetate buffer, pH 4.0. Cellobiose oxidation was monitored by following the reduction of 1 mM ubiquinone or 50 lM cytochrome c as described in Experi- mental procedures. ND, no significant substrate inhibition was observed.
Cellobiose oxidation with electron acceptors
Ubiquinone Cytochrome c Ubiquinone reduction Cytochrome c reduction
kcat (s)1) kcat (s)1) kcat (s)1) kcat (s)1) Km (lM) Km (lM) Ki (lM) Km (lM) Km (lM) Ki (lM)
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2872
WT F166Y 57.9 ± 7.1 56.0 ± 5.5 40.1 ± 1.2 36.8 ± 0.9 28.6 ± 1.6 17.9 ± 3.0 43.5 ± 0.9 19.2 ± 0.9 2510 ± 380 3540 ± 310 326 ± 35 293 ± 16 44.2 ± 1.4 46.4 ± 0.8 1.46 ± 0.12 0.67 ± 0.11 37.2 ± 0.3 ND 19.0 ± 0.5 233 ± 42
K. Igarashi et al. Electron transfer chain reaction of CDH
A
Discussion
B
Two mechanisms, electron transfer chain and electron sink, have been proposed for the redox reaction of CDH, and several previous kinetic studies have attemp- ted to clarify the overall reaction of this enzyme [21–23]. However, uncertainty remains, possibly because of the special features of this enzyme. The optimum pH values of flavin reduction by cellobiose (pH 4.5–5.0) and of electron transfer from flavin to heme (pH 3.5–4.0) differ from each other, and the rate-limiting step of the reac- tion thus depends on the pH of the reaction mixture [20,25]. Moreover, a higher concentration of substrate (cellobiose) inhibits presteady-state heme reduction, but not flavin reduction [20,26], suggesting that binding of substrate to the active site of the flavin domain inhibits electron transfer from flavin to heme. This phenomenon makes it difficult to solve the redox mechanism of this enzyme using kinetic results obtained with only WT CDH. In this study, therefore, we compared the ther- modynamic and kinetic features of recombinant WT and the slow electron transfer mutant F166Y.
The presteady-state electron transfer from flavin to heme was halved in F166Y compared with WT. This was expected from the thermodynamic result that the redox potential of heme in F166Y was lower than that of WT. However, when the electron transfer rate k (s)1) and the driving force DG (eV) were analyzed in terms of electron transfer theory, which was recently developed by Dutton’s group [27], the edge-to-edge distance R and the reorganization energy k of F166Y were higher than those of WT when one of these parameters was fixed and used for the calculation (data not shown). This indicates that the halved electron transfer rate of F166Y is due not only to thermody- namic factors, but also involves kinetic changes in this mutant; for example, the change of Phe to Tyr may change the charge of the protein surface, resulting in a change in the interaction between the two domains. This would produce a higher R or k value for F166Y compared with the WT enzyme. That only F166Y shows significant substrate (cytochrome c) inhibition might be because of the weaker domain interaction of this mutant enzyme. The F166Y mutant is, however, useful for monitoring the electron transfer step of CDH, because the mutation affects only the electron transfer step from flavin to heme, but not initial flavin reduction or cytochrome c reduction.
heme reduction in both enzymes at the same cellobiose concentration. As shown in Fig. 6B,D, heme in WT and F166Y remained oxidized during this phase, but was re-reduced with reduction of cytochrome c. The kobs of cytochrome c reduction depended on the con- centration of cytochrome c in the region tested (5– 20 lm, data not shown), and was almost identical for WT and F166Y with limiting values of 1460 ± 140 and 1380 ± 80 s)1, respectively.
WT or F166Y was first mixed with cellobiose, and then the cellobiose–CDH mixture was mixed with cyto- chrome c after 0.1 s (WT) or 0.2 s (F166Y). At the second mixing time, (cid:1) 90% of heme is in the ferrous state and the flavin forms a semiquinone, as confirmed
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2873
Fig. 5. Absorption spectra of heme in CDH (A) and cytochrome c (B) for comparison of the isosbestic points. The spectra of the oxi- dized (solid line) and reduced (dashed line) forms are compared in the range of 450–650 nm. Dotted lines at 549.0 (left) and 556.7 (right) show the isosbestic points of heme in CDH and cyto- chrome c, respectively.
K. Igarashi et al. Electron transfer chain reaction of CDH
A
B
C
D
molecular rate constants (6 · 106 m)1Æs)1). This indicates that, at the initial phase, the electron is transferred from heme to cytochrome c. In contrast, the second phase of cytochrome c reduction was not concentration depend- ent, but depended on electron transfer from flavin to heme. Considering that the kcat value for cytochrome c reduction was almost identical to the klim value for heme reduction in both WT and F166Y, the two electrons in reduced CDH are sequentially transferred from reduced flavin to cytochrome c via heme. Cameron and Aust [22] recently demonstrated that the reduction rate of cyto- chrome c by fully (three-electron) reduced CDH was lower than the rate under steady-state turnover, and suggested that the flavin radical reduces cytochrome c.
previously by EPR [20], suggesting that most of the enzyme is in the two-electron reduced form. In previous studies, prereduced CDH was often used to observe the electron transfer from heme to cytochrome c with cello- biose or ascorbate as an electron donor [22,23,28]. With- out a sequential mixing technique, however, it is difficult to monitor cytochrome c reduction, because premixing with the electron donors produces one- (ascorbate) or three- (cellobiose) electron-reduced CDH, but not the two-electron-reduced form with flavin radical and reduced heme. Soon after the two-electron-reduced CDH was mixed with cytochrome c, synchronous cyto- chrome c reduction and re-oxidation of heme were clearly observed in WT and F166Y with similar bio-
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2874
Fig. 6. Time courses of redox state of heme in WT (A, B) and F166Y (C, D) after sequential mixing with cellobiose and cytochrome c. Absorptions at 556.7 (solid line) and 549.0 (dashed line) nm were used for monitoring the heme in CDH and cytochrome c, respectively. WT or F166Y (5 lM) was mixed with 100 lM cellobiose, and 20 lM cytochrome c was then added and mixed after 0.1 s (WT) or 0.2 s (F166Y) using a sequential mixing stopped-flow apparatus. The absorption changes were monitored after mixing with cytochrome c, and the initial (0–0.020 s) and secondary (0–0.2 s) phase are seen in left (A, C) and right (B, D) panels, respectively. Conditions: 50 mM sodium acetate buf- fer (pH 4.0) at 30 (cid:1)C.
sequence of P. chrysosporium [29]. To clarify the true role of CDH, therefore, it is important to consider the interaction with other extracellular redox proteins. As demonstrated in our kinetic studies, including this the redox reaction of CDH is regulated by work, cellobiose concentration and pH at the interdomain electron transfer step. This might provide a clue to identify the redox system of CDH in vivo.
K. Igarashi et al. Electron transfer chain reaction of CDH
Experimental procedures
Materials
In the same report, moreover, they proposed that the heme in CDH acts as an electron sink, because Rogers and co-workers reported that heme is oxidized during steady-state cytochrome c reduction [28]. Although this phenomenon was also observed in the second phase of presteady-state cytochrome c reduction, it is because of the significant difference between the electron transfer rate from flavin to heme (30 s)1) and that from heme to cytochrome c ((cid:1) 1500 s)1). After the electron is loaded from flavin to heme, it is transferred to cytochrome c without any significant time lag. Consequently, all the results obtained in this study apparently indicate that the overall redox reaction of CDH occurs through the electron transfer chain mechanism, as shown in Scheme 1.
d-Cellobiose was purchased from ICN Biomedicals (Irvine, CA, USA). Ubiquinone (2,3-dimethoxy-5-methyl-1,4-benzo- quinone) and bovine heart cytochrome c were purchased from Wako Pure Chemical Industries (Osaka, Japan). To assess the pH dependence of the mid-point potential of heme, 50 mm buffers were used as described previously [20,30].
Steady-state enzyme assays
(0–1 mm). Reduction rates
Although this study clearly demonstrates an electron transfer chain mechanism of CDH when cytochrome c is used as an electron acceptor, it is too early to con- clude that the mechanism is also used during cellulose degradation by the fungus because its natural electron acceptor is still uncertain. Considering the kinetic effi- ciency of cytochrome c for CDH is quite high com- pared with other ferric compounds, it is possible that fungi produce a cytochrome c-like the filamentous hemoprotein extracellularly and utilize it as an electron there are several hypo- acceptor of CDH. Indeed, thetical proteins with a secretion signal and a cyto- chrome c-binding motif encoded in the total genome
To obtain the steady-state kinetic parameters of cellobiose oxidation, the reduction rate of 1 mm ubiquinone or 50 lm cytochrome c was plotted against concentration of cello- for ubiquinone and biose cytochrome c were also measured at various concentrations (0–1 mm for ubiquinone and 0–50 lm for cytochrome c) using 500 lm cellobiose as a substrate. The reductions of ubiquinone and cytochrome c were monitored photometri- cally at 406 nm (De406 ¼ 0.745 mm)1 cm)1) and 550 nm (De550 ¼ 17.5 mm)1 cm)1), respectively. Because apparent substrate inhibition was observed when cytochrome c was used as an electron acceptor, the obtained substrate dependence plots were fitted to the Michaelis–Menten equa- tion with a substrate inhibition constant (Ki). Unless other- wise noted, steady-state kinetic parameters (Km and kcat) were estimated by nonlinear fitting of the data to the Michaelis–Menten equation using deltagraph v. 5.5 (SPSS Inc., Cary, NC, USA and Redrock Software, Inc., Salt Lake City, UT, USA) and kaleidagraph v. 3.0.8 (Synergy Software, Reading, PA, USA).
Preparation of wild-type CDH and F166Y mutant
nucleotides
(mutated
Recombinant wild-type P. chrysosporium CDH was hetero- logously expressed in the methylotropic yeast Pichia past- oris and purified as described previously [24]. Site-directed mutagenesis was carried out based on the overlap extension and nested primers methods, as described elsewhere [31–34]. Synthetic oligonucleotides, F166Y-F, 5¢-CACAC are CGACTACGGCTTCTT-3¢ underlined); AP1-EcoRI-F, 5¢-TTTTCAGCGTTCTCGGA ATTCCAGAGTGCCTCACAGTTTACCGAC-3¢; AP1-F,
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2875
Scheme 1. Proposed catalytic cycle of CDH using cellobiose and cytochrome c as electron donor and electron acceptor, respectively. CB, cellobiose; CBL, cellobionolactone; F, flavin; H, heme; ox, oxi- dized form; red; reduced form; sq: semiquinone form.
and 556.7 nm for heme
instructions,
cellobiose and cytochrome c were 5.0, 5.0, 100 and 5– 20 lm, respectively. To monitor the reduction of heme in CDH and cytochrome c independently, absorption at the isosbestic points, 549.0 nm for cytochrome c (De549.0 ¼ 16.8 mm)1Æcm)1) in CDH (De556.7 ¼ 9.29 mm)1Æcm)1), was monitored. All presteady- state measurements were carried out at least three times in 50 mm sodium acetate buffer pH 4.0 at 30 (cid:1)C, and the data were analyzed as described previously [20].
K. Igarashi et al. Electron transfer chain reaction of CDH
Acknowledgements
This research was supported by Grants-in-Aid for Sci- entific Research to KI (No. 15780206), MS (No. 14360094), and TN (No. 16205021), and by Grant-in- Aid for Scientific Research on Priority Area to TN (No. 12147208) from the Ministry of Education, Cul- ture, Sports, Science and Technology, and a Research Fellowship to MY (No. 08446) from the Japan Society for the Promotion of Science.
5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA CCTCCCGCAAGCGCGAG-3¢; and AP2-R, 5¢-TTACA GTAATATAAAGAATTTCGCTCTAGA-3¢, were used to obtain the nucleotide fragment of F166Y (f166y). The frag- ment was subcloned into the pCR(cid:2)4Blunt-TOPO vector (Invitrogen, Carlsbad, CA, USA) as described in the manu- vector pCR4(cid:2)Blunt- facturer’s and the TOPO ⁄ f166y was digested with EcoRI and XbaI (TaKaRa Bio, Shiga, Japan) and ligated into the pPICZa-A vector the same restriction sites. The vector (Invitrogen) at pPICZa-A ⁄ f166y was then linearized with Bpu1102I (TaKaRa Bio) and transformed into Pichia pastoris KM- 71H using a MicroPulser electroporation device (Bio-Rad Laboratories, Hercules, CA, USA). The Zeocin-resistant transformant was cultivated in a growth medium (1% yeast extract, 2% polypeptone, 1% glycerol; w ⁄ v) for 24 h at followed by the induction medium (1% yeast 30 (cid:1)C, extract, 2% polypeptone, 1% methanol; w ⁄ v) for 48 h at 26.5 (cid:1)C, and F166Y was purified from the culture filtrate with the same protocol as described previously [24]. The purity of wild-type CDH and F166Y was confirmed by SDS ⁄ PAGE and by the absorption spectrum.
References
1 Nishiyama Y, Sugiyama J, Chanzy H & Langan P
Measurement of midpoint potential of heme in CDH
(2003) Crystal structure and hydrogen bonding system in cellulose 1a, from synchrotron X-ray and neutron fiber diffraction. J Am Chem Soc 125, 14300–14306. 2 Nishiyama Y, Langan P & Chanzy H (2002) Crystal
structure and hydrogen-bonding system in cellulose 1b from synchrotron X-ray and neutron fiber diffraction. J Am Chem Soc 124, 9074–9082.
3 Clarke AJ (1997) Biodegradation of Cellulose: Enzymo- logy and Biotechnology. Technomic Publishing, Lancas- ter, PA.
A direct electrochemical technique was used to measure the mid-point potential according to our previous report [30]. Glassy carbon, platinum, and Ag ⁄ AgCl were used as the working, counter, and reference (+205 mV vs. NHE at 25 (cid:1)C) electrodes, respectively. Cyclic voltammetry was performed in the presence of 50 mm MgCl2 using an ALS Electrochemical Analyzer 624A, and the potential was deter- mined by averaging the anodic and cathodic peak potentials.
Presteady-state kinetic studies
4 Igarashi K, Samejima M, Saburi Y, Habu N & Eriksson K-EL (1997) Localization of cellobiose dehydrogenase in cellulose-grown cultures of Phanerochaete chrysospor- ium. Fungal Genet Biol 21, 214–222.
5 Igarashi K, Samejima M & Eriksson K-EL (1998) Cel- lobiose dehydrogenase enhances Phanerochaete chryso- sporium cellobiohydrolase I activity by relieving product inhibition. Eur J Biochem 253, 101–106.
[20]. Because apparent
6 Yoshida M, Igarashi K, Kawai R, Aida K & Samejima M (2004) Differential transcription of b-glucosidase and cellobiose dehydrogenase genes in cellulose degradation by the basidiomycete Phanerochaete chrysosporium. FEMS Microbiol Lett 235, 177–182.
7 Eriksson K-E & Pettersson B (1974) Oxidation: an
important enzyme reaction in fungal degradation of cel- lulose. FEBS Lett 49, 282–285.
8 Ayers AR, Ayers SB & Eriksson K-E (1978) Cellobiose oxidase, purification and partial characterization of a hemoprotein from Sporotrichum pulverulentum. Eur J Biochem 90, 171–181.
Presteady-state reduction of flavin and heme was monitored at the appropriate isosbestic point using an Applied Photo- physics SX-18MV kinetic spectrophotometer and the observed rate (kobs) was estimated by fitting to the double exponential curve (flavin reduction) or single exponential curve with lag (heme reduction) according to our previous report substrate inhibition was observed in heme reduction, the substrate inhibition con- stant (Ki) was used to estimate the limiting rates (klim) of heme reduction as described previously [20]. Rapid reduc- tion of cytochrome c by reduced CDH and re-oxidation of heme in CDH were monitored with the same equipment, but using a sequential mixing mode as follows. Wild-type CDH and F166Y were first mixed with cellobiose, and the solution was then mixed with cytochrome c at 0.1 s (WT) or 0.2 s (F166Y) after the initial mixing, when almost 90% of heme was reduced. Final concentrations of WT, F166Y,
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2876
cellobiose oxidoreductase: a one-electron reducing sys- tem. Biochim Biophys Acta 1604, 47–54.
24 Yoshida M, Ohira T, Igarashi K, Nagasawa H, Aida K,
9 Bao W, Usha SN & Renganathan V (1993) Purification and characterization of cellobiose dehydrogenase, a novel extracellular hemoflavoenzyme from the white-rot fungus Phanerochaete chrysosporium. Arch Biochem Biophys 300, 705–713.
Hallberg BM, Divne C, Nishino T & Samejima M (2001) Production and characterization of recombinant Phanerochaete chrysosporium cellobiose dehydrogenase in the methylotrophic yeast Pichia pastoris. Biosci Bio- technol Biochem 65, 2050–2057.
25 Samejima M, Phillips RS & Eriksson K-EL (1992)
10 Bao W & Renganathan V (1992) Cellobiose oxidase of Phanerochaete chrysosporium enhances crystalline cellu- lose degradation by cellulases. FEBS Lett 302, 77–80. 11 Eriksson K-EL, Habu N & Samejima M (1993) Recent advances in fungal cellobiose oxidoreductases. Enzyme Microb Technol 15, 1002–1008.
Cellobiose oxidase from Phanerochaete chrysosporium: stopped-flow spectrophotometric analysis of pH-depen- dent reduction. FEBS Lett 306, 165–168.
12 Henriksson G, Johansson G & Pettersson G (2000) A critical review of cellobiose dehydrogenases. J Biotech- nol 78, 93–113.
26 Jones GD & Wilson MT (1988) Rapid kinetic studies of the reduction of cellobiose oxidase from the white-rot fungus Sporotrichum pulverulentum by cellobiose. Bio- chem J 256, 713–718.
13 Cameron MD & Aust SD (2001) Cellobiose dehydro- genase. An extracellular fungal flavocytochrome. Enzyme Microb Technol 28, 129–138.
14 Morpeth FF (1985) Some properties of cellobiose oxi-
27 Page CC, Moser CC & Dutton PL (2003) Mechanism for electron transfer within and between proteins. Curr Opin Chem Biol 7, 551–556.
28 Rogers MS, Jones GD, Antonini G, Wilson MT &
dase from the white-rot fungus Sporotrichum pulverulen- tum. Biochem J 228, 557–564.
15 Henriksson G, Pettersson G, Johansson G, Ruiz A & Uzcategui E (1991) Cellobiose oxidase from Phanero- chaete chrysosporium can be cleaved by papain into two domains. Eur J Biochem 196, 101–106.
Brunori M (1994) Electron transfer from Phanerochaete chrysosporium cellobiose oxidase to equine cytochrome c and Pseudomonas aeruginosa cytochrome c-551. Biochem J 298, 329–334.
16 Wilson MT, Hogg N & Jones GD (1990) Reactions of reduced cellobiose oxidase with oxygen. Is cello- biose oxidase primarily an oxidase? Biochem J 270, 265–267.
17 Kremer SM & Wood PM (1992) Evidence that cello-
29 Martinez D, Larrondo LF, Putnam N, Gelpke MD, Huang K, Chapman J, Helfenbein KG, Ramaiya P, Detter JC, Larimer F et al. (2004) Genome sequence of the lignocellulose degrading fungus Phanerochaete chrys- osporium strain RP78. Nat Biotechnol 22, 695–700. 30 Igarashi K, Verhagen MFJM, Samejima M, Schu¨ lein
biose oxidase from Phanerochaete chrysosporium is pri- marily an Fe(III) reductase. Kinetic comparison with neutrophil NADPH oxidase and yeast flavocytochrome b2. Eur J Biochem 205, 133–138.
M, Eriksson K-EL & Nishino T (1999) Cellobiose dehy- drogenase from the fungi Phanerochaete chrysosporium and Humicola insolens: a flavohemoprotein from Humi- cola insolens contains 6-hydroxy-FAD as the dominant active cofactor. J Biol Chem 274, 3338–3344.
31 Higuchi R, Krummel B & Saiki RK (1988) A general
18 Samejima M & Eriksson K-EL (1992) A comparison of the catalytic properties of cellobiose: quinone oxido- reductase and cellobiose oxidase from Phanerochaete chrysosporium. Eur J Biochem 207, 103–107.
method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA inter- actions. Nucleic Acids Res 16, 7351–7367.
19 Cox MC, Rogers MS, Cheesman M, Jones GD, Thom- son AJ, Wilson MT & Moore GR (1992) Spectroscopic identification of the heme ligands of cellobiose oxidase. FEBS Lett 307, 233–236.
20 Igarashi K, Momohara I, Nishino T & Samejima M
32 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59. 33 Merino E, Osuna J, Bolivar F & Soberon X (1992) A
(2002) Kinetics of inter-domain electron transfer in fla- vocytochrome cellobiose dehydrogenase from the white- rot fungus Phanerochaete chrysosporium. Biochem J 365, 521–526.
general, PCR-based method for single or combinatorial oligonucleotides-directed mutagenesis on pUC ⁄ M13 vec- tors. Biotechniques 12, 508–510.
21 Henriksson G, Johansson G & Pettersson G (1993) Is cel- lobiose oxidase from Phanerochaete chrysosporium a one- electron reductase? Biochim Biophys Acta 1144, 184–190. 22 Cameron MD & Aust SD (2000) Kinetics and reactivity of the flavin and heme cofactors of cellobiose dehydro- genase from Phanerochaete chrysosporium. Biochemistry 39, 13595–13601.
23 Mason G, Nicholls P, Divne C, Hallberg BM, Henriks-
son G & Wilson MT (2003) The heme domain of
34 Rouwendal GJA, Wolbert EJH, Zwiers L-H & Springer J (1993) Simultaneous mutagenesis of multiple sites: appli- cation of the ligase chain reaction using PCR products instead of oligonucleotides. Biotechniques 15, 68–76. 35 Hallberg BM, Bergfors T, Backbro K, Pettersson G, Henriksson G & Divne C (2000) A new scaffold for binding haem in the cytochrome domain of the extracel- lular flavocytochrome cellobiose dehydrogenase. Struct Fold Design 8, 79–88.
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
2877
K. Igarashi et al. Electron transfer chain reaction of CDH