
Tissue expression and biochemical characterization
of human 2-amino 3-carboxymuconate 6-semialdehyde
decarboxylase, a key enzyme in tryptophan catabolism
Lisa Pucci*, Silvia Perozzi*, Flavio Cimadamore, Giuseppe Orsomando and Nadia Raffaelli
Istituto di Biotecnologie Biochimiche, Universita
`Politecnica delle Marche, Ancona, Italy
In mammals, tryptophan exceeding basal requirement
for protein and serotonin synthesis, is oxidized via
indole-ring cleavage through the kynurenine pathway,
consisting of several enzymatic reactions leading to
2-amino 3-carboxymuconate 6-semialdehyde (ACMS)
(Fig. 1) [1,2]. ACMS can be decarboxylated to
2-aminomuconate 6-semialdehyde (AMS) by the
enzyme ACMS decarboxylase (ACMSD, EC 4.1.1.45),
or it can undergo spontaneous pyridine ring closure to
form quinolinate, an essential precursor for de novo
NAD synthesis. AMS can be routed to the citric
acid cycle via the glutarate pathway, or converted
nonenzymatically to picolinate. By catalyzing ACMS
decarboxylation, ACMSD thus diverts ACMS from
NAD synthesis, channeling tryptophan towards
complete oxidation or conversion to picolinate.
By determining picolinate and quinolinate forma-
tion, ACMSD directly participates in the cellular pro-
cesses regulated by these molecules. Quinolinate is a
neurotoxic tryptophan metabolite, whose action has
been ascribed to N-methyl-D-aspartate receptors
activation and to its ability to generate free radicals
Keywords
ACMSD; NAD biosynthesis; picolinate;
quinolinate; tryptophan catabolism
Correspondence
N. Raffaelli, Istituto di Biotecnologie
Biochimiche, Universita
`Politecnica delle
Marche, Via Ranieri, 60131 Ancona, Italy
Fax: +39 712204677
Tel: +39 712204682
E-mail: n.raffaelli@univpm.it
*These authors contributed equally to this
paper
(Received 16 November 2006, accepted
6 December 2006)
doi:10.1111/j.1742-4658.2007.05635.x
2-Amino 3-carboxymuconate 6-semialdehyde decarboxylase (ACMSD, EC
4.1.1.45) plays a key role in tryptophan catabolism. By diverting 2-amino
3-carboxymuconate semialdehyde from quinolinate production, the enzyme
regulates NAD biosynthesis from the amino acid, directly affecting quinoli-
nate and picolinate formation. ACMSD is therefore an attractive therapeu-
tic target for treating disorders associated with increased levels of
tryptophan metabolites. Through an isoform-specific real-time PCR assay,
the constitutive expression of two alternatively spliced ACMSD transcripts
(ACMSD I and II) has been examined in human brain, liver and kidney.
Both transcripts are present in kidney and liver, with highest expression
occurring in kidney. In brain, no ACMSD II expression is detected, and
ACMSD I is present at very low levels. Cloning of the two cDNAs in yeast
expression vectors and production of the recombinant proteins, revealed
that only ACMSD I is endowed with enzymatic activity. After purification
to homogeneity, this enzyme was found to be a monomer, with a broad
pH optimum ranging from 6.5 to 8.0, a K
m
of 6.5 lm, and a k
cat
of 1.0 s
)1
.
ACMSD I is inhibited by quinolinic acid, picolinic acid and kynurenic
acid, and it is activated slightly by Fe
2+
and Co
2+
. Site-directed mutagen-
esis experiments confirmed the catalytic role of residues, conserved in all
ACMSDs so far characterized, which in the bacterial enzyme participate
directly in the metallocofactor binding. Even so, the properties of the
human enzyme differ significantly from those reported for the bacterial
counterpart, suggesting that the metallocofactor is buried deep within the
protein and not as accessible as it is in bacterial ACMSD.
Abbreviations
ACMS, 2-amino 3-carboxymuconate 6-semialdehyde; ACMSD, ACMS decarboxylase; AMS, 2-aminomuconate 6-semialdehyde.
FEBS Journal 274 (2007) 827–840 ª2007 The Authors Journal compilation ª2007 FEBS 827

[3,4]. This neurotoxicity might play an important role
in the pathogenesis of major neurodegenerative and
convulsive disorders. In particular, many of the
distinct neuropathological features of Huntington’s
disease are duplicated in experimental animals by
intrastriatal quinolinate injection [5,6]. In addition, a
significant elevation of quinolinate levels has been
observed in low-grade Huntington’s disease brains,
suggesting that the molecule might participate in the
initial phases of the neurodegenerative process [7].
Moreover, a role of quinolinate in the pathogenesis
of AIDS–dementia complex, as well as Alzheimer’s
disease, has been very recently proposed [8,9]. In turn,
picolinate exhibits important immunomodulatory
properties, involving activation of macrophage tumori-
cidal, microbicidal and proinflammatory functions [10–
12]. This metabolite also stimulates apoptosis in var-
ious transformed cell lines, and efficiently interrupts
the progress of human HIV-1 in vitro [13,14]. Although
the physiological relevance of picolinate formation
in vivo is not known, it has been detected in human
milk, pancreatic juice, intestine and in the serum of
patients with degenerative liver diseases [15–17]. In
addition, high levels have been measured in the
cerebrospinal fluid of children with cerebral malaria
and in the brain of a murine model of the syndrome
[18,19]. Interestingly, picolinate is reportedly able to
prevent the neurotoxic effects of quinolinate in the rat
central nervous system, suggesting that a highly regula-
ted production of these metabolites is required for
Fig. 1. Schematic overview of tryptophan
catabolism through the kynurenine pathway.
Human ACMSD L. Pucci et al.
828 FEBS Journal 274 (2007) 827–840 ª2007 The Authors Journal compilation ª2007 FEBS

normal neuronal function [20]. Such considerations
indicate that ACMS decarboxylation is a key meta-
bolic control step and that the enzyme catalyzing this
reaction is likely to be a drug target [21].
Mammalian ACMSD has been purified and charac-
terized from cat, hog and rat [22–24], where it is
present only in kidney, brain and liver. Several studies
have demonstrated that in rats, nutritional factors and
hormones affect both gene expression and enzymatic
activity. In particular, the enzyme is down-regulated
by dietary polyunsaturated fatty acids, phthalate esters
and peroxisome proliferators, like clofibrate, whereas it
is up-regulated in rats fed a high protein diet [25–28].
mRNA expression and enzymatic activity are elevated
in the liver of streptozotocin-induced diabetic rats, and
insulin injection suppresses such elevation [29]. These
studies clearly demonstrated that changes in ACMSD
activity are readily reflected by serum and tissue quino-
linate levels and in the rate of tryptophan-to-NAD
conversion. Rat liver ACMSD gene expression is regu-
lated by the two transcriptional factors: hepatocyte
nuclear factor 4a(HNF4a) and peroxisome prolifera-
tor-activated receptor a(PPRa); the former activates
ACMSD expression directly by site-specific binding
to the promoter, and the latter represses ACMSD
expression indirectly through suppression of HNF4a
expression [30].
The presence of ACMSD has been recently demon-
strated in bacteria species that fully catabolize trypto-
phan or 2-nitrobenzoic acid [31,32]. The biochemical
and structural characterization of Pseudomonas fluores-
cens ACMSD revealed that the enzyme is metal-
dependent and catalyzes a novel type of nonoxidative
decarboxylation [21,33–35].
The human gene has been identified upon expression
in COS7 cells of a cDNA from a brain library, enco-
ding the human homologue of the rat protein [36].
Recently, a cDNA sequence from a liver library, deri-
ving from alternative splicing of the gene, has been
deposited in GenBank. In this study, we have demon-
strated the constitutive expression in human organs of
the two alternatively spliced ACMSD transcripts. The
corresponding cDNAs have been cloned in yeast
expression vectors, allowing for the first time the puri-
fication and biochemical characterization of human
ACMSD.
Results
Cloning of ACMSD transcripts
The complete coding sequence of human ACMSD
was obtained from reverse-transcribed human kidney
RNA, by using the primers pair 1fw ⁄11rev, encompas-
sing the ACMSD open reading frame (GenBank acces-
sion number Q8TDX5-1) (Fig. 2A; Table 1). Agarose
gel electrophoresis of the PCR product indicated the
presence of two distinct bands between 1000 and
1100 bp of roughly the same extent (not shown). Clo-
ning and nucleotide sequencing of these two products
indicated that the lower band (1011 bp) corresponded
to the expected cDNA (here named ACMSD I), while
the higher band (1068 bp) corresponded to the cDNA
currently in GenBank under accession number
AAH16018 (here named ACMSD II). ACMSD II cod-
ing sequence was obtained by using the primers pair
4fw ⁄11 rev (Fig. 2A). Again, two distinct PCR prod-
ucts were obtained, the longer (887 bp) corresponding
to part of the ACMSD I cDNA, the shorter (837 bp)
representing ACMSD II open reading frame (not
shown). The two transcripts are produced by alternat-
ive splicing of exons 2 and 5 of the ACMSD gene
(Fig. 2A); the presence of exon 2 in ACMSD II causes
a shift in the open reading frame, resulting in the
occurrence of the first available start codon in exon 4.
This, together with the absence of exon 5, gives rise to
aACMSD II protein, which differs from ACMSD I at
the N-terminus (Fig. 2B).
Expression of ACMSD variants in Escherichia coli
and Pichia pastoris
ACMSD I and II cDNAs were subcloned into pET15b
and pET32b E. coli expression vectors, providing the
recombinant proteins with a N-terminal His6-tag, and
a thioredoxin-tag, respectively. In both cases, proteins
were expressed as inclusion bodies (not shown). Any
effort to obtain soluble recombinant proteins, inclu-
ding lower growth temperatures (18 C) and isopropyl
b-D-1-thiogalactopyranoside concentrations (down to
0.1 mm), as well as inclusion of various metal ions in
the growth medium during induction, were unsuccess-
ful. Expression in the methylotrophic yeast P. pastoris
was performed both via secretion and intracellularly,
as described in Experimental procedures. Both
isoforms were secreted by yeast cells transformed with
the pPIC9 recombinant plasmids (Fig. 3); however,
when ACMSD activity was assayed in the culture
media, the enzymatic activity was only detected in
media containing isoform I. Both isoforms were
also expressed intracellularly, as evidenced by the
appearance of protein bands of the expected size
upon SDS ⁄PAGE analysis of the crude extracts
prepared after 3 days methanol induction (not shown).
Again, only isoform I was endowed with enzymatic
activity.
L. Pucci et al. Human ACMSD
FEBS Journal 274 (2007) 827–840 ª2007 The Authors Journal compilation ª2007 FEBS 829

In light of the recent findings that P. fluorescens
ACMSD requires a metal-ion cofactor and is able to
take up the metal from the expressing host during
protein synthesis [21,33], we investigated whether the
production of the human recombinant isoforms might
be enhanced by the presence of metal ions in the
growth medium. We found that addition of 200 lmto
1mmCoCl
2
during methanol induction did not result
in a significant increase of ACMSD I specific activity,
and no activity was detected in the extracts prepared
from cells expressing the other isoform.
A
B
Fig. 2. Alternative splicing of human ACMSD gene. (A, upper panel) Genomic structure of the ACMSD gene with the alternative splicing pat-
terns. Exons are indicated by boxes and introns by connecting lines. The approximate locations of the oligonucleotide primers used in the
preparation of the cDNAs are shown by bold arrows (see Table 1 for sequences). (A, lower panel) Representation of full length ACMSD I
and ACMSD II mRNAs. Open reading frames are underlined and the localization of the primers pairs and probes used for real-time PCR
assays is also showed (see Table 1 for sequences). (B) Alignment of the not conserved N-terminal regions of the two isoforms. Alignment
was carried out using the CLUSTALW program. Fully conserved and similar residues are indicated by asterisks and colon, respectively.
Table 1. Oligonucleotide primer sequences. fw, forward; rev,
reverse.
Sequence
ACMSD cloning: primer
1fw CGCTCGAGATGAAAATTGACATCCATA
GTCAT
11rev AAAGCTGAGCTCCATTCAAATTGTTTT
CTCTCAAG
4fw TTCTCGAGATGGGAAAGTCTTCAGAGT
GGT
ACMSD real-time PCR: primer and probe
1⁄3fw TGGCCAGATCTAAAAAAGAGGT
2fw ATCCCAGGAAACACCAGTAGA
10rev ATTGTTTTCTCTCAAGACCCAA
TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG
18Sfw CGCCGCTAGAGGTGAAATTC
18Srev TCTTGGCAAATGCTTTCGCT
TaqMan probe 18S TGGACCGGCGCAAGACGGAC
AB
Fig. 3. ACMSD I and ACMSD II extracellular expression. Tricine
SDS ⁄PAGE of the culture filtrates of the best expressing clones
obtained by transformation of P. pastoris GS115 cells with pPIC9-
ACMSD I (A) and pPIC9-ACMSD II (B). Culture filtrates were ana-
lyzed after 104 h (lane a) and 128 h (lane b) methanol induction.
Arrows indicate the recombinant isoforms. Lane M, molecular
mass standards.
Human ACMSD L. Pucci et al.
830 FEBS Journal 274 (2007) 827–840 ª2007 The Authors Journal compilation ª2007 FEBS

Quantitation of ACMSD variants in liver, kidney
and brain
An isoform-specific real-time PCR assay was performed
to analyze the expression pattern of the two transcripts
in brain, kidney and liver. A hybridization probe over-
lapping exon 3 and exon 4 was designed (T1), which is
able to anneal to both variants (Fig. 2A). Specific ampli-
fication was achieved by using the same reverse primer
(10rev), located in exon 10, with 1 ⁄3fw primer, spanning
the boundaries of exons 1 and 3, for ACMSD I, and
2fw, located in exon 2, for ACMSD II. To assess the
specificity of the assay, linearized pGEM plasmids har-
boring the two cDNAs were used as templates in control
real-time PCR experiments. Each isoform was subjected
to amplification with the specific primer ⁄probe set in the
presence of increasing molar amounts of the other iso-
form (1 : 1, 1 : 1000 and 1 : 10 000). Detection of
ACMSD I was not influenced by the presence of up to
10 000-fold molar excess of ACMSD II and the same
result was obtained when detection of ACMSD II was
performed in the presence of ACMSD I. The expression
levels of ACMSD alternative transcripts in the organs
we have examined are reported in Fig. 4. ACMSD I
transcript was present in all tested organs, with an
expression ratio of 1300 : 30 : 1 in kidney, liver and
brain, respectively. Interestingly, ACMSD II was not
detected in brain, while no significant difference in the
relative expression of the two isoforms within kidney
and liver was observed.
ACMSD I purification and characterization
Recombinant human ACMSD I was purified to homo-
geneity from P. pastoris cells transformed with the
pHIL-D2-ACMSD I plasmid, by the purification proce-
dure described in Experimental procedures and sum-
marized in Table 2. The final preparation was stable for
several weeks when stored at 4 C, whereas the purified
protein was sensitive to freezing at both )20 C and
)80 C. SDS ⁄PAGE of the pure protein revealed a
molecular mass of about 40 kDa, as expected for the
recombinant enzyme (Fig. 5). Gel filtration experiments
showed a native molecular mass of about 50 kDa, indi-
cating that the enzyme might exist as a monomer in
solution (not shown). ACMSD I had an optimum pH
ranging from 6.5 to 8.0 (Fig. 6). The activity was signifi-
cantly affected by the concentrations of the buffers used
at pH values below 6.5, being markedly lower in the
presence of 50 mmbuffers, rather than 5 mmat the
same pH values (Fig. 6). As shown in Table 3, the pure
enzyme was fully active in the absence of metal ions,
being slightly activated by Co
2+
and Fe
2+
, whereas
Zn
2+
,Cd
2+
Cr
3+
and Fe
3+
strongly reduced the enzy-
matic activity. Human ACMSD I exhibited a linear kin-
etic behavior, with K
m
for ACMS of 6.5 lm,V
max
of
0.105 mms
)1
and k
cat
of 1.0 s
)1
(Fig. 7).
To identify possible enzyme modulators, we exam-
ined the effect of several NAD biosynthetic pathway
intermediates on the human enzyme activity. We found
that NAD, nicotinate adenine dinucleotide, nicotina-
Fig. 4. Quantitation of ACMSD variants by real-time PCR. Tissues
RNA was reverse-transcribed and ACMSD variants were quantita-
ted as described in Experimental procedures, using the prim-
ers ⁄probe sets reported in Table 1. Data are the mean of three
independent experiments and are presented as copies of the target
variant per 10
9
copies of 18S RNA.
Table 2. Purification of recombinant human ACMSD I.
Step
Total protein
a
(mg)
Total activity
b
(units)
Specific activity
(unitsÆmg
)1
)
Yield
(%)
Purification
(-fold)
Crude extract 305 1.9 0.006 100 –
Streptomycin sulfate 102 2.0 0.019 100 3.26
Hydroxyhapatite 23.4 1.2 0.051 63 8.5
MonoQ 0.36 0.5 1.39 31 231
a
Starting from 400 mL yeast culture.
b
The enzymatic activity was assayed spectrophotometrically, as reported in the Experimental proce-
dures.
L. Pucci et al. Human ACMSD
FEBS Journal 274 (2007) 827–840 ª2007 The Authors Journal compilation ª2007 FEBS 831

