intTypePromotion=1

Phát hiện virus gây bệnh thối đen mũ chúa (Black queen cell virus) trên ong mật ở một số tỉnh miền bắc Việt Nam

Chia sẻ: Ngọc Ngọc | Ngày: | Loại File: PDF | Số trang:6

0
11
lượt xem
0
download

Phát hiện virus gây bệnh thối đen mũ chúa (Black queen cell virus) trên ong mật ở một số tỉnh miền bắc Việt Nam

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Ðể định hướng cho việc nghiên cứu chế tạo bộ kit chẩn đoán virus BQCV ở ong mật, chúng tôi bước đầu thực hiện nghiên cứu phát hiện virus BQCV bằng RT-PCR. Trên các mẫu ong mật ở Việt Nam. Mời các bạn tham khảo!

Chủ đề:
Lưu

Nội dung Text: Phát hiện virus gây bệnh thối đen mũ chúa (Black queen cell virus) trên ong mật ở một số tỉnh miền bắc Việt Nam

HỘI NGHỊ KHOA HỌC TOÀN QUỐC VỀ SINH THÁI VÀ TÀI NGUYÊN SINH VẬT LẦN THỨ 6<br /> <br /> NGHIÊN CỨU PHÁT HIỆN VIRUS GÂY BỆNH THỐI ĐEN MŨ CHÖA<br /> (BLACK QUEEN CELL VIRUS) TRÊN ONG MẬT<br /> Ở MỘT SỐ TỈNH MIỀN BẮC VIỆT NAM<br /> HÀ THỊ QUYẾN,<br /> <br /> T<br /> <br /> g i học Công nghệ,<br /> i học Quốc gia Hà Nội<br /> <br /> HÀ THỊ THU, BÙI THỊ THÙY DƢƠNG, ĐỒNG VĂN QUYỀN<br /> <br /> Viện Công nghệ sinh học,<br /> Viện Hàn lâm Khoa học và Công nghệ Việt Nam<br /> Vệ N<br /> ố<br /> ,Vệ N<br /> Á ỉ<br /> T<br /> ậ<br /> ệ<br /> ườ<br /> <br /> T<br /> ở<br /> <br /> ệ<br /> Q ố<br /> ,<br /> <br /> ờ ế<br /> ậ<br /> ứ<br /> ứ<br /> ẩ<br /> D liệu xu t khẩu ă<br /> <br /> ệ<br /> ậ<br /> ệ US<br /> <br /> ậ<br /> ế<br /> ,Vệ N<br /> ư<br /> <br /> M c dù vậy, nh ng ă<br /> ầ<br /> ,<br /> ố<br /> ổ<br /> ì<br /> ì<br /> ệ<br /> ồ ư<br /> ứ<br /> ệ<br /> ậ ờ<br /> ầ<br /> ,<br /> ởVệ N<br /> ong b mắc bệnh, chủ yếu do virus. Vì<br /> ậ , ườ<br /> kháng sinh<br /> ệ do virus, vi khuẩn.<br /> <br /> ứ<br /> <br /> ứ<br /> ẩ<br /> <br /> ă<br /> <br /> ệ<br /> <br /> ệ<br /> <br /> ẩ<br /> <br /> ậ<br /> ế<br /> <br /> ố<br /> trên ong mật do virus black queen cell (BQCV)<br /> ệnh ổ ế<br /> ổ<br /> ườ<br /> ởVệ N<br /> K<br /> thành tế bào ủ<br /> xu t hiện các m<br /> ,<br /> ườ<br /> ố<br /> (Bailey & Wood, 1977).<br /> <br /> ế<br /> ệ<br /> <br /> N<br /> ổ<br /> ứ<br /> <br /> ệ<br /> <br /> ệ<br /> <br /> ễ<br /> Q V,<br /> ọ virus này<br /> <br /> (a)<br /> (b)<br /> Hình 1: (a) Ấu trùng chúa của ong mật bị nhiễm BQCV; (b) Nhộng bị nhiễm BQCV<br /> Q V<br /> <br /> ườ<br /> A) G<br /> <br /> k<br /> Đ<br /> <br /> ẩ<br /> <br /> ệ<br /> <br /> ệ<br /> <br /> ,<br /> ươ<br /> <br /> (không<br /> <br /> ẩ<br /> ư<br /> ệ<br /> ứ<br /> ệ<br /> ọ ,<br /> ế<br /> ọ và<br /> ọ<br /> Đ<br /> ứ ứ<br /> ươ<br /> ệ<br /> ệ<br /> ở<br /> ậ<br /> ư ươ<br /> ễ<br /> (ELISA, W<br /> , )<br /> RT-PCR, multiplex RT-PCR, RFLP, (Grabensteiner et al., 2007; Mongi et al., 2001).<br /> ủ<br /> <br /> ệ<br /> <br /> ứ<br /> RNA<br /> ơ ồ<br /> ứ<br /> ọ<br /> ở ORF<br /> ORF<br /> (Kondreddy et al., 2013; Leat et al., 2000).<br /> ươ<br /> <br /> ư é<br /> <br /> 1621<br /> <br /> HỘI NGHỊ KHOA HỌC TOÀN QUỐC VỀ SINH THÁI VÀ TÀI NGUYÊN SINH VẬT LẦN THỨ 6<br /> <br /> ươ<br /> <br /> C<br /> <br /> ế<br /> <br /> ườ<br /> <br /> ế ố<br /> <br /> ố ư<br /> <br /> ư<br /> <br /> T<br /> Hơ<br /> ư<br /> ố<br /> ư<br /> <br /> , ỹ<br /> ệ<br /> ,<br /> <br /> ệ<br /> <br /> ủ<br /> <br /> ẩ<br /> <br /> ậ<br /> <br /> ẩ<br /> ậ<br /> <br /> virus ừ<br /> <br /> Đ<br /> ệ<br /> <br /> ệ<br /> <br /> RT-P R<br /> ì<br /> ơ<br /> <br /> ỉ<br /> ệ<br /> ế ì ừ<br /> <br /> ẩ<br /> ố<br /> <br /> ì<br /> <br /> ệ , ở ì ầ<br /> ế<br /> ệ<br /> ồ<br /> ệ<br /> <br /> ệ<br /> é , ừ<br /> <br /> kit mua<br /> ủ<br /> <br /> ờ<br /> <br /> ư<br /> <br /> Đ<br /> ư ng cho việc nghiên cứu chế t o b kit chẩ<br /> Q V ở ong mật, chúng<br /> ư<br /> ầu th c hiện nghiên cứu phát hiện virus BQCV b ng RT-PCR. Trên các mẫu ong mật<br /> ở Việt Nam.<br /> I. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU<br /> 1. Vật liệu<br /> Mẫ RNA ươ<br /> ẩn (tách từ ong nhiễm BQCV) và mẫu RNA âm tính chuẩn (tách<br /> từ<br /> ưởng thành kh e m )<br /> T<br /> ậ,<br /> ậ<br /> ủ<br /> H<br /> Q ố (QIA)<br /> ,<br /> ệu là BQCV(+) và BQCV(-).<br /> T<br /> ă<br /> ,<br /> mẫu<br /> ưởng thành ư c thu thập t i 9<br /> ở5<br /> tỉnh mi n Bắc Việt Nam,<br /> ồ Đ ện Biên, Hòa Bình, Bắ G<br /> , Hư Y và Nghệ An.<br /> Mỗ<br /> ồm c mẫu<br /> ưởng thành. Mẫ ư c ký hiệu b ng các ch<br /> ư<br /> ưởng thành ký hiệu là T và u trùng ký hiệu là A. Mỗi tỉnh thu 18 mẫ<br /> ưởng thành<br /> và 18 mẫu u trùng. Mẫ ư c b o qu n trong ethanol 100% và gi ở -20o<br /> ến khi s d ng.<br /> 2. Hóa chất, sinh phẩm<br /> Bao gồm các b kit: B kit RNeasy Mini Kit 250 củ<br /> QIA<br /> tách RNA tổng số;<br /> b kit SuperSciptTMFirst-S NA S<br /> S<br /> (I<br /> )<br /> t o cDNA; TA cloning Kit<br /> (I<br /> )<br /> tách dòng gen; GenJETTMP R P f<br /> K (F<br /> )<br /> tinh s ch vector<br /> tái tổ h p và s n phẩm PCR; BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied<br /> Biosystems)<br /> ọc trình t gen.<br /> 3. Phƣơng pháp nghiên cứu<br /> Tách chiết RNA t ng số<br /> Các mẫ<br /> ư<br /> <br /> ẫ<br /> Khuế h<br /> <br /> ưởng thành và<br /> ư<br /> ơ<br /> S<br /> ,<br /> d ng b RNeasy Mini Kit 250 củ<br /> QIA<br /> ủ<br /> ố<br /> RNA ư c hòa l i trong 30 µ ư c kh<br /> ủ RNA ư<br /> ổ Nanodrop.<br /> i<br /> <br /> ẫ<br /> RNA<br /> EP Nồ<br /> <br /> DNA ặc hiệu c a BQCV (RT-PCR)<br /> <br /> a. Tổng h p cDNA từ RNA tổng số<br /> Quy trình và thành phần ph n ứ<br /> <br /> ư<br /> <br /> :<br /> <br /> Hỗn h p 1 gồm: RNA tổng số tách từ mẫu<br /> ưởng thành (30 ng–50 ng): 7 µl;<br /> Mồi ngẫu nhiên (50 ng/µl): 3 µl; Ủ hỗn h p 1 b ng máy PCR ở 650<br /> S<br /> trên<br /> Hỗn h p 2 gồm: 5X RT Buffer(0,5M Tris-HCl pH-8,3; 0,75M KCl; 0,03M MgCl2): 4µl; dNTP<br /> mix (10 mM): 2 µl; DTT (0,1 mM): 2 µl; Inibitor Rnase (20 u/µl):1 µl; Reverse trancriptase (20<br /> u/µl): 1µl.<br /> 1622<br /> <br /> HỘI NGHỊ KHOA HỌC TOÀN QUỐC VỀ SINH THÁI VÀ TÀI NGUYÊN SINH VẬT LẦN THỨ 6<br /> <br /> Bổ sung 10 µl hỗn h p 2 vào hỗn h<br /> th c hiện ph n ứng RT-PCR<br /> ì<br /> ệ<br /> n ứng tổng h p cDNA từ RNA ổ<br /> ố<br /> P R<br /> o<br /> o<br /> trong 5 phút; 42 C trong 60 phút và 70 C trong 5 phút.<br /> b. Khuế<br /> <br /> ư<br /> <br /> :<br /> <br /> o<br /> <br /> C<br /> <br /> i gen từ cDNA b ng PCR<br /> <br /> C p mồi thiết kế cho việc khuế<br /> im<br /> c hiệu của virus BQCV có trình t<br /> ư<br /> sau: BQCV-F: ‟- TGGTCAGCTCCCACTACCTTAAAC - ‟<br /> BQCV-R: ‟- GCAACAAGAAGAAACGTAAACCAC- ‟<br /> S n phẩm sau khi khuế<br /> i sẽ có chi u dài kho ng 701bp<br /> Chu kỳ nhiệt ph n ứng khuế<br /> i: 94oC trong 3 phút; 35 chu kỳ (gồm 94oC trong 40 giây;<br /> o<br /> o<br /> 56 C trong 40 giây; 72 C trong 1 phút); 72oC trong 8 phút; gi mẫu ở 4oC.<br /> II. KẾT QUẢ VÀ THẢO LUẬN<br /> 1. Kiể<br /> <br /> ính đặc hiệ củ cặp<br /> <br /> ẫ RNA ươ<br /> NA<br /> Q V Kế<br /> ệ<br /> <br /> ồi đ<br /> <br /> Từ<br /> <br /> 1.<br /> 2.<br /> 3.<br /> 4.<br /> 5.<br /> <br /> hiế kế<br /> ẩ ,<br /> <br /> ẩ<br /> <br /> ế<br /> ứ P R<br /> ế<br /> P R ư<br /> ệ ở ì<br /> <br /> NA<br /> NA<br /> <br /> ồ<br /> ệ<br /> <br /> ẫ<br /> ủ<br /> <br /> Hình 2: Điện di sản phẩm<br /> RT-PCR đ ạn DNA đặc<br /> hiệu của BQCV<br /> ~701bp<br /> <br /> Kênh 1: Chỉ th DNA chuẩn<br /> Kênh 2: Mẫu BQCV(-)<br /> Kênh 3: Mẫu BQCV(+)<br /> <br /> Theo kết qu thiết kế mồi, s n phẩ P R<br /> n DNA của BQCV sẽ có<br /> ư c kho ng<br /> 701bp. Hình<br /> ện di cho th ,<br /> ện di s n phẩm RT-PCR, mẫu BQCV(+) xu t hiện m t<br /> ă<br /> ư<br /> ư c củ<br /> NA c hiệu của BQCV (kho ng<br /> 701bp), còn mẫu BQCV(-) không th y xu t hiện s n phẩm. Tuy nh ,<br /> chắc chắn s n phẩm<br /> P R<br /> ư c là củ Q V,<br /> ọc trình t nucleotide và so sánh v i m t số trình t<br /> ươ<br /> ồng trên GeneBank có số ă<br /> KP119603.1, KM255694.1, JX149531.1,<br /> AF<br /> ,N _<br /> Kế<br /> (<br /> ì<br /> ở<br /> )<br /> ươ<br /> ồ<br /> > 96%. N ư ậy, c p mồi mà chúng tôi thiết kế r<br /> c hiệu cho BQCV và có th s d ng<br /> c p mồ<br /> ư<br /> ì RT-P R<br /> u tra phát hiện các mẫu ong nhiễm BQCV trên<br /> th<br /> a. S n phẩ P R<br /> n DNA của BQCV nói trên ư c tách dòng trong vector tách dòng<br /> R<br /> ư cs d<br /> ối chứ<br /> ươ<br /> ứu tiếp theo.<br /> 2. Phát hiện sự có mặt của BQCV trên các mẫu ong<br /> Áp d ng quy trình RT-PCR có s d ng c p mồ<br /> ết kế ở trên, chúng tôi tiến hành phát<br /> hiện s có m t của BQCV trên các mẫu ong ở 5 tỉnh: 180 mẫu RNA tổng số<br /> ư c tách chiết<br /> 1623<br /> <br /> HỘI NGHỊ KHOA HỌC TOÀN QUỐC VỀ SINH THÁI VÀ TÀI NGUYÊN SINH VẬT LẦN THỨ 6<br /> <br /> từ 180 mẫ<br /> ưởng thành và<br /> ư<br /> th c hiện ph n ứng PCR. Hình 3 trình bày kết qu<br /> ưởng thành và<br /> i diện cho 5 tỉ<br /> BQCV(+).<br /> <br /> ư c thành cDNA rồi tiến hành<br /> ện di s n phẩm RT-PCR của m t số mẫu<br /> d ng mẫ ối chứ<br /> ươ<br /> <br /> Hình 3: Điện di sản phẩm RT-PCR đ ạn DNA đặc hiệu của BQCV<br /> Kênh 1, 2: Mẫ<br /> ưởng thành ở Đ ện Biên; Kênh 3: Mẫu u trùng ở Đ ện Biên<br /> Kênh 4, 5: Mẫu<br /> ưởng thành ở Hòa Bình;<br /> Kênh 6, 7, 8,: Mẫ<br /> ưởngthành ở Bắc Giang;<br /> Kênh 9: Chỉ th DNA chuẩn; Kênh 10: Mẫu BQCV(+)<br /> Kênh 11, 14: Mẫu u trùng ở Hư Y K<br /> , : Mẫ<br /> ưởng thành ở Hư Y<br /> Kênh 15, 16: Mẫ<br /> ưởng thành ở Nghệ An; Kênh 17: Mẫu u trùng ở Nghệ An<br /> V<br /> ế<br /> RT-P R<br /> ươ<br /> ươ<br /> ư<br /> quy trình RT-P R<br /> ẫ<br /> ậ .<br /> 3. Đánh giá ự ph n bố củ<br /> <br /> ì<br /> ẩ<br /> <br /> P R ủ<br /> <br /> ẫ<br /> ẫ<br /> <br /> ệ<br /> ươ<br /> <br /> ệ ,<br /> <br /> ệ<br /> <br /> QCV ở 5 ỉnh<br /> <br /> ẩ<br /> ẩ<br /> <br /> P R<br /> ư<br /> Q V(+) N ư ậ ,<br /> ủ Q V<br /> <br /> iền ắc Việ N<br /> <br /> Theo kết qu RT-PCR th c hiện trên 180 mẫ<br /> có 4/5 tỉnh phát hiệ<br /> Q V,<br /> Đ ện Biên, Bắ G<br /> <br /> ư c ở 5 tỉnh, chúng tôi thống kê th y<br /> , Hư Y<br /> N ệ An (hình 4).<br /> <br /> Hình 4: Phân bố tỉ lệ nhiễm BQCV ở 5 tỉnh khảo sát<br /> Có tổng số<br /> ươ<br /> Bắc Giang có 5<br /> N ệA<br /> nhiễ N ư ậy, tỉ lệ nhiễ<br /> Q V<br /> Kế<br /> ơ<br /> ế<br /> 1624<br /> <br /> Q V,<br /> Đệ<br /> , Hư Y<br /> ,<br /> Riêng Hòa Bình không phát hiện th<br /> ì<br /> o sát chiếm >15,5%.<br /> ứ ủ T ươ A T<br /> ă<br /> <br /> HỘI NGHỊ KHOA HỌC TOÀN QUỐC VỀ SINH THÁI VÀ TÀI NGUYÊN SINH VẬT LẦN THỨ 6<br /> <br /> ỉ ệ<br /> % (T ươ<br /> ,<br /> ậ<br /> <br /> ễ<br /> Q Vở ỉ<br /> ắ (Đ ệ<br /> Vă T n và cs, 2012) S<br /> ệ<br /> ố ơ<br /> ệ<br /> ế<br /> ă<br /> ố ơ<br /> Q V ẫ ế<br /> ỉ ệ<br /> ễ<br /> <br /> , Sơ L , Đắk Lắk, Hư Y , H N )<br /> ỉ ệ<br /> ễ<br /> ườ<br /> ừ<br /> ệ , ư ọ ư<br /> ẫ<br /> ư<br /> nhiễm của nh<br /> Q Vở<br /> ỉ<br /> ắ<br /> <br /> Kết qu kh o sát còn cho th y Bắ G<br /> ố ường h p ong nhiễm nhi u nh t chiếm 36%,<br /> Đ ện Biên có tỉ lệ nhiễm cao thứ<br /> %, ếp theo là Hư Y<br /> N ệ An có số ường<br /> h p nhiễm chiếm lầ ư t là 21% và 14%.<br /> BQCV có th<br /> ệ<br /> ết ong ở<br /> n<br /> nh tỉ lệ lây nhiễm của BQCV lên từ<br /> i u tr bệnh. Kết qu<br /> u tra tỉ lệ nhiễm BQCV trên<br /> th hiện ở hình 5.<br /> <br /> Hình 5: Tỉ lệ nhiễm BQCV ở ấ<br /> <br /> ng<br /> <br /> ĩ<br /> <br /> ng<br /> <br /> ưởng thành. Vì vậy việc<br /> t l n cho công tác phòng và<br /> ưở<br /> ư c<br /> <br /> ƣởng thành<br /> <br /> V i kết qu ở hình 5, trong số các mẫ ươ<br /> , ỉ phát hiệ ư c BQCV ở các mẫu ong<br /> ưởng thành mà không th y xu t hiện ở các mẫu u trùng. Kết qu<br /> pv<br /> ế<br /> nghiên cứu của Tentcheva D. và c ng s khi cho r ng BQCV lây nhiễ<br /> ưởng thành<br /> nhi<br /> ơ ở u trùng (Tentcheva D. et al., 2004). Hiệ ư ng BQCV chỉ xu t hiện ở mẫu ong<br /> ưởng thành có th trong quá trình t<br /> , ườ<br /> t thận trọng trong việc chọn<br /> e m nh nên u trùng ong ít b nhiễm bệ ,<br /> ưởng thành có th b<br /> lây nhiễ<br /> Q V<br /> ường truy n nga :<br /> ĩ<br /> truy n từ cá th ưởng thành này sang<br /> cá th ưởng thành khác, ho c do ong tiếp xúc v i thứ ă ,<br /> nhiễm virus ho c b<br /> nhiễ<br /> ng vật nguyên sinh Nosema apis hay ve ký sinh<br /> Varroa.<br /> III. KẾT LUẬN<br /> ệc th c hiện quy trình RT-PCR v i c p mồi t thiết kế<br /> phát hiện BQCV trên 180 mẫu ong mật ở 5 tỉnh mi n Bắc Việ N T<br /> ắc Giang có tỉ<br /> lệ nhiễ<br /> %, Đ ện Biên nhiễ<br /> %, Hư Y<br /> ễm 21% và Nghệ An nhiễm 14%. Hòa<br /> Bình 0%. T t c các mẫ ươ<br /> Q V u là các mẫ<br /> ưởng thành. V i việc phát<br /> hiện 4/5 tỉ<br /> ư 14/90<br /> nhiễm BQCV cho th<br /> ơ<br /> ch bệnh là<br /> r<br /> ơ<br /> m d ch cần có chiế ư c phát hiện, ki m soát d ch bệnh trên các<br /> p thời.<br /> 1625<br /> <br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2