STR trong sàng lọc di truyền tiền làm tổ bệnh thận đa nang nhiễm sắc thể thường trội do các biến thể gây bệnh của gen PKD1 tại Việt Nam

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:10

Thêm vào BST

Báo xấu

10
lượt xem 2
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

ADPKD là bệnh thận di truyền phổ biến nhất, đặc trưng bởi sự sản sinh và tăng sinh nhiều u nang trong thận và tiến triển dần dần dẫn đến suy thận giai đoạn cuối. Nghiên cứu này đã thực hiện thành công chẩn đoán di truyền tiền làm tổ bệnh ADPKD ở người Việt Nam.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: STR trong sàng lọc di truyền tiền làm tổ bệnh thận đa nang nhiễm sắc thể thường trội do các biến thể gây bệnh của gen PKD1 tại Việt Nam

HỘI NGHỊ KHOA HỌC TOÀN QUỐC THƯỜNG NIÊN HỘI HÌNH THÁI HỌC VIỆT NAM - 2024 STR TRONG SÀNG LỌC DI TRUYỀN TIỀN LÀM TỔ BỆNH THẬN ĐA NANG NHIỄM SẮC THỂ THƯỜNG TRỘI DO CÁC BIẾN THỂ GÂY BỆNH CỦA GEN PKD1 TẠI VIỆT NAM Triệu Tiến Sang1, Nguyễn Thị Việt Hà1, Nguyễn Thanh Tùng2, Trần Văn Khoa1, Nguyễn Văn Phong1, Nguyễn Hà Hương Ly1, Lê Việt Thắng1, Trương Quý Kiên3 TÓM TẮT 44 quản để đánh giá kích thước, từ đó xác định các ADPKD là bệnh thận di truyền phổ biến alen di truyền có biến thể gây bệnh và chẩn đoán nhất, đặc trưng bởi sự sản sinh và tăng sinh nhiều di truyền bằng phôi trước khi chuyển phôi. Sinh u nang trong thận và tiến triển dần dần dẫn đến thiết được thực hiện trên 13 mẫu phôi vào ngày suy thận giai đoạn cuối. Do kích thước rất lớn thứ năm cho thấy sáu mẫu phôi chứa biến thể của gen PKD1, nhiều vị trí của các biến thể gây PKD1 gây bệnh và bảy mẫu phôi không có biến bệnh trên gen và sự hiện diện tới sáu vùng gen thể PKD1 gây bệnh thích hợp cho việc chuyển giả với 97,7% đối với PKD1, các phương pháp phôi. chẩn đoán trực tiếp đối với biến thể gây bệnh của Nghiên cứu này đã thực hiện thành công gen PKD1 đang gặp nhiều thách thức. Sử dụng chẩn đoán di truyền tiền làm tổ bệnh ADPKD ở phân tích liên kết di truyền để kiểm tra sự di người Việt Nam. truyền của STR với gen PKD1 trong chẩn đoán Từ khóa: Phân tích liên kết di truyền, STR, tiền làm tổ là một cách tuyệt vời để chẩn đoán PKD1, bệnh thận đa nang nhiễm sắc thể thường bệnh thận đa nang di truyền và xác định sự hiện trội, PGT diện của nhiễm DNA ngoại lai và hiện tượng ADO. Bảy STR liên quan đến PKD1 đã được SUMMARY chọn để khuếch đại và phân tích trên 16 mẫu máu SHORT TANDEM REPEATS IN của bệnh nhân ADPKD. Sản phẩm PCR của STR PREIMPLANTATION GENETIC được thực hiện bằng phương pháp điện di mao DIAGNOSIS OF AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY 1 BM. Sinh học và Di truyền Y học, Học viện DISEASE DUE TO PATHOGENIC Quân y VARIANTS OF THE PKD1 GENE IN 2 Viện Phôi học và Mô học Lâm sàng Quân đội, VIETNAM Học viện Quân y ADPKD is the most prevalent inherited 3 Khoa Thận và Chạy thận nhân tạo, Bệnh viện kidney disease, characterized by the production Quân y 103, Học viện Quân y and proliferation of numerous cysts in the kidney Chịu trách nhiệm chính: Triệu Tiến Sang and progressive progression that results in end- Email: trieusangk83@yahoo.com.vn stage renal failure. Due to the enormous size of Ngày nhận bài: 12/04/2024 the PKD1 gene, the numerous positions of Ngày phản biện khoa học: 25/04/2024 pathogenic variants on the gene, and the presence Ngày duyệt bài: 15/5/2024 324
TẠP CHÍ Y HỌC VIỆT NAM TẬP 539 - THÁNG 6 - SỐ CHUYẤN ĐỀ - 2024 of up to six pseudogene regions with 97.7% to and has a size of 47.2 kb [8] with 46 exons PKD1, direct diagnostic approaches for the (16p13.3). The polycystin-1 transmembrane pathogenic variation of the PKD1 gene are protein is encoded by the PKD1 gene (PC1). challenging. Using genetic linkage analysis to Any pathogenic mutation of the PKD1 gene examine the inheritance of STRs with the PKD1 will affect the PC1 protein, disrupt several gene in preimplantation diagnosis is an excellent cellular signalling pathways [16] and lead to way to diagnose hereditary polycystic kidney anomalies in ion transport, polarity, disease and determine the presence of foreign reproduction, and cyclic cell death in renal infection and the ADO phenomenon. Seven epithelial cells, resulting in renal cyst PKD1-associated STRs were selected for formation. Cysts in patients with polycystic amplification and analysis on 16 ADPKD patients blood samples. PCR products of STRs kidney disease enlarge the kidneys and lead are carried out by capillary electrophoresis to to the progressive loss of typical structures, assess the size, thereby identifying genetic alleles resulting in a decline in kidney function and with pathogenic variants and making genetic progression to renal failure [2]. diagnoses with embryos before transplanting. Current methods to directly discover Biopsies performed on 13 embryo samples on pathogenic variations in the PKD1 gene are day five revealed six embryo samples harbouring based on the same fundamental premise of the pathogenic PKD1 variant and seven embryo multiplying the sequence sections of the samples without the pathogenic PKD1 variant PKD1 gene with techniques such as LR-PCR suitable for embryo transfer. and Nested-PCR. Then, pathogenic variants This study successfully performed the are identified using sequencing techniques preimplantation genetic diagnosis of ADPKD in such as NGS and Sanger sequencing on the Vietnamese. amplified products and comparing the results Keywords: Linked genetic analysis, STR, to the standard human genome sequence PKD1, Autosomal-dominant polycystic kidney data. [13,12,5]. In addition, some disease, PGT investigations employ additional techniques, such as MLPA, QFM-PCR, Q-PCR, and I. INTRODUCTION Array-CGH. [1,6]. Polycystic Kidney Disease (PKD) is a However, direct genetic analysis methods prevalent inherited kidney disease, with an still face some difficulties due to the large estimated prevalence of 1/500-1/1 000 in size of the PKD1 gene and the many Western countries [17], caused by a pathogenic variant sites on the gene. In pathogenic variant appearance of the PKD1 addition, there are up to 6 regions of (MIM #601313) and PKD2 (MIM #173910) pseudogene structure (high similarity genes [1], with 85% of cases caused by a (97.7%) with sequences from 5'UTR to exon pathogenic variant on the PKD1 gene. The 32 on chromosome 16 [1,8]), causing many PKD1 gene is situated on chromosome 16 325
HỘI NGHỊ KHOA HỌC TOÀN QUỐC THƯỜNG NIÊN HỘI HÌNH THÁI HỌC VIỆT NAM - 2024 difficulties in gene amplification. Gene PKD1.01: ADPKD patient carries the sequencing techniques take a long time to pathogenic variant on exon 29 of PKD1: conduct the technique, and the cost of testing c.9859_9861delCTC (NM_001009944); is relatively high. In addition, when family PKD1.02: ADPKD patient carries a diagnosing biopsied embryo samples, it is pathogenic variant on exon 5 of PKD1: necessary to evaluate the phenomenon of p.P253Q (NC_000016.10/NT_187607.1); ADO and DNA contamination. Family PKD1.03: ADPKD patient carries a In addition to approaches for directly pathogenic variant on exon 29 of PKD1: detecting the PKD1 variation, some writers p.Phe3257fs (NM_001009944). Families worldwide have diagnosed ADPKD by collected information about ADPKD and genetic linkage analysis [4,11,10]. This created genetic pedigrees. method is based on the co-inheritance of the All people described in this research causal gene and its associated short tandem were signed written informed consent for the repeats (STRs) in affected families. The publication of the case details, and the presence or lack of STRs linked to the protocol was approved by the Ethical Review disease gene makes it feasible to determine a Committee of Vietnam Military Medical carrier of the disease gene. Due to the small University (No.1068/2019/VMMU-IRB). size of STR fragments, their amplification is This study was also conducted using good more straightforward and can be performed clinical practice following the Declaration of on embryos that have been biopsied and Helsinki and its later amendments or genomically propagated. In addition, the comparable ethical standards. STR analysis method can assess the ADO 2.2. Short tandem repeat phenomenon and DNA contamination during The haplotypes of microsatellite markers embryo biopsy and whole genome within and around the PKD1 gene were amplification of day five embryos. determined for each subject. The markers used were D16S475, D16S3082, D16S283 II. MATERIAL AND METHODS (SM7), D16S663 (CW2), D16S291 (CA2.5) 2.1. Patient description located in the upstream gene, 1 in the gene: The study was performed on 16 D16S3252 (KG8) and 1 in the downstream peripheral blood samples from members of 3 gene: D16S52 (Table 1). They have families of ADPKD patients, and 13 embryos polymorphism information content (PIC) were biopsied on day 5 of these families. values that range from 0.25 to 0.83 in the ADPKD patients have correctly identified local Thai population [9]. The locations of the pathogenic variant of the PKD1 gene by the markers relative to PKD1 are shown in next-generation sequencing. Family Fig 1. 326
TẠP CHÍ Y HỌC VIỆT NAM TẬP 539 - THÁNG 6 - SỐ CHUYẤN ĐỀ - 2024 Figure 1: Location map of the STRs and the PKD1 gene on chromosome 16 (based on the position parameters of the STRs on https://genecards.weizmann.ac.il/geneloc_ncbi37) Table 1: Characteristics of selected microsatellite markers including sequence of primers, polymerase chain reaction products size [4,15,18]. Product Refer Marker Primer sequence (5’-3’) size (bp) ence Forward* TGAACTGAGGTCCTACCACTG D16S475 207-243 [4] Reverse AGAAACTACTGGCAGGAACAGA Forward* CCATGTGTCACCTTAACCTTTCC D16S3082 143-175 [18] Reverse TGGCCGGTCTTTCCAGG Forward* CCATGTGTCACCTTAACCTTTCC D16S283 81-107 [18] Reverse TGGCCGGTCTTTCCAGG TGTAAAACGACGGCCAGTGTCTTTCTAGGAA Forward* D16S663 TGAAATCAT 123-147 [18]** Reverse ATTGCAGCAAGACTCCATCT * Forward AAGGCTGGCAGAGGAGGTG D16S291 109-142 [15] Reverse CAGTTGTGTTTCCTAATCGGCG TGTAAAACGACGGCCAGTGTACACAGAAGC Forward* D16S3252 AGGCACAG 201-217 [4] ** Reverse GGCAAGTAGCAGGACTAGGC TGTAAAACGACGGCCAGTGAGCGAGACTCC Forward* D16S521 GTCTAAA 174-190 [18]** Reverse CAGCAGCCTCAGGGTT * Primer fluorescently labeled with FAM ** The primers used for the reaction were previously with some modifications 327
HỘI NGHỊ KHOA HỌC TOÀN QUỐC THƯỜNG NIÊN HỘI HÌNH THÁI HỌC VIỆT NAM - 2024 DNA Extraction annealing at 56℃ for 30s, extension at 72℃ As directed by the G-spinTM Total DNA for 45s and a final extension at 72℃ for 10 Extraction Kit, peripheral blood samples minutes. After running the PCR reaction, the from relatives of ADPKD patients were amplified product is electrophoresed on 3% retrieved. Following extraction, the DNA agarose gel with GeneRuler 100bp DNA solution was examined by SpectraMax Ladder (Thermo Fisher Scientific) to check, QuickDrop for concentration and purity. then conducting capillary electrophoresis. Whole genome Amplification for Capillary electrophoresis Embryos’genome One μL of fluorescent PCR product was After performing IVF, embryo samples combined with 24.5 μL of Hi-Di Formamide from 3 families were cultured until day five (Thermo Fisher Scientific, USA) and 0.5 μL and biopsied to obtain 3-5 cells at the of WEN ILS 500 size standard before being Military Institute of Clinical Embryology and denatured at 95°C for 5 minutes, cooled to Histology (MICEH). DNA from biopsied 4°C, and resolved in SeqStudio Genetic embryos was amplified using the REPLI-g® Analyzer (Thermo Fisher Scientific, USA). Single Cell Kit (QIAGEN, Germany), diluted Using GeneMapper 6.0 software, a post- with nuclease-free water to a concentration electrophoresis analysis was done. of 10-20 ng/µL and stored at -200C. Based on the results of analyzing the PCR amplification allele sizes and their inheritance to conclude Single-primer PCR was performed to the group of alleles associated with the amplify STRs for blood and embryo samples. pathogenic variant of the PKD1 gene, Each PCR reaction tube for amplifying the thereby giving the results of pre-implantation individual STR fragment has a volume of 25 genetic diagnosis for this disease with μL, which contains 12.5 μL of GoTaq Green embryo samples of the ADPKD families. Mastermix 2X; 0.5 μL each forward and reverse primer and 2.5 μL DNA template III. RESULTS (concentration: 10-20 ng/µL), water The DNA template for the PCR reaction sufficient. amplified the STRs to be studied in each The thermal cycle for amplifying the family's DNA sample. Then, 3% agarose gel STR segments is as follows: 95℃-5 min, 35 electrophoresis was used to evaluate the PCR cycles include denaturation at 94℃ for 30s, results (Fig 2). 328
TẠP CHÍ Y HỌC VIỆT NAM TẬP 539 - THÁNG 6 - SỐ CHUYẤN ĐỀ - 2024 Figure 2: Electrophoresis results of PCR products of one DNA sample in this study and GeneRuler 100bp DNA Ladder (Thermo Fisher Scientific) on 3% agarose gel It is possible to determine the group of clinical characteristics of pedigree members. inherited alleles linked with illness genes and It is then possible to diagnose embryos with the group of inherited alleles with normal disease-causing genes and embryos without genes based on the study findings of allele disease-causing genes. size in each marker in combination with the Figure 3: Pedigrees of Family PKD1.01 with haplotypes for the PKD1 associated polymorphic markers in this study 329
HỘI NGHỊ KHOA HỌC TOÀN QUỐC THƯỜNG NIÊN HỘI HÌNH THÁI HỌC VIỆT NAM - 2024 Figure 4: Pedigrees of Family PKD1.02 with haplotypes for the PKD1 associated polymorphic markers in this study Figure 5: Pedigrees of Family PKD1.03 with haplotypes for the PKD1 associated polymorphic markers in this study 330
TẠP CHÍ Y HỌC VIỆT NAM TẬP 539 - THÁNG 6 - SỐ CHUYẤN ĐỀ - 2024 Names of the PKD1 associated STRs are markers keep within a 2 Mb (2 cM) distance located on the left of the pedigrees. Numbers from PKD1, reducing their capacity to cross- indicate lengths of PCR products (bp) for exchange during meiosis in germ cells and different alleles of STRs. The alleles located facilitating genetic analysis of the marker's in the red box are genetically linked to the relationship with PKD1. pathogenic variant of PKD1. In this study, after studying the genetic With the analysis results of all three results of markers in all three patient families (Fig 3, fig 4, fig5), it can be seen families, it was determined that the selected that the alleles are successfully multiplied, STR loci were totally related to the PKD1 and the size is consistent with the design gene in the reported samples, ensuring the primer characteristics. With embryo samples, accuracy of genetic diagnosis of the PKD1 the results of STR analysis showed that gene in embryo samples. In contrast, the embryos carrying disease-causing variants study discovered that markers D16S3252 inherited from the father or mother could be (KG8) and D16S521 had a high rate of distinguished from embryos that did not homology, and that each locus included just carry these variants. In addition, the absence two alleles. In families when both parents are of ADO and foreign contamination during homozygous for the same allele, these STRs biopsies and whole-genome multiplication did not add information to the genetic ensures that the diagnostic results on research method. In order to propose a STRs embryos are entirely reliable and help to panel for PGT-M of Vietnamese ADPKD make informed decisions regarding genetic patients, further research is required to information for families during the selection examine the heterozygosity and of embryos for implantation in the mother's polymorphism index for STRs related with uterus. the PKD1 gene in the Vietnamese population. IV. DISCUSSION The method of genetic analysis linked to No studies provide information on the the analysis of STRs associated with disease heterozygosity index and genetic genes has many advantages when it is polymorphism index of STRs related to the possible to identify carriers of disease genes PKD1 gene in the Vietnamese population at more easily than direct genetic evaluation this time. Based on the genetic data of Asian methods (especially for genes with large size populations [11,7], the STR markers utilized and complex variants such as PKD1), can be in this investigation have a high frequency of applied on families carrying different heterozygosity and polymorphism. As pathogenic variants, and saves the patient's proposed by the European Society of Human family time and money. In addition, the Reproduction and Embryology in 2020 [3], evaluation of ADO and contamination during 331
HỘI NGHỊ KHOA HỌC TOÀN QUỐC THƯỜNG NIÊN HỘI HÌNH THÁI HỌC VIỆT NAM - 2024 biopsies and whole genome amplification of disease: comprehensive mutation analysis of embryo samples is aided by linked genetic PKD1 and PKD2 in 700 unrelated patients", analysis. This improves the accuracy of Human mutation. 33(8), pp. 1239-1250. embryo sample diagnostic results, preventing 2. Chang MY, Chen HM, Jenq CC, et al. false negatives. Currently, according to the Novel PKD1 and PKD2 mutations in Taiwanese patients with autosomal dominant guidelines of the European Society for polycystic kidney disease. J Hum Genet. Human Reproduction and Embryology for 2013;58(11):720-727. 2020 [3], the use of whole genome 3. ESHRE PGT-M Working Group, Carvalho, amplification followed by linkage genetic F., Moutou, C., Dimitriadou, E., Dreesen, J., analysis for the detection of genetic illnesses Giménez, C., ... & De Rycke, M. (2020). is becoming one of the PGT-M approaches. ESHRE PGT Consortium good practice Nonetheless, the linkage genetic analysis recommendations for the detection of method has limitations when examining de- monogenic disorders. Human reproduction novo and mosaic variations. open, 2020(3), hoaa018. 4. Fatehi, R., Khosravi, S., Abedi, M., Salehi, V. CONCLUSION R., & Gheisari, Y. (2017). Heterozygosity The initial study provided analysis of polycystic kidney disease 1 gene preimplantation genetic diagnostic microsatellite markers for linkage analysis of information for 14 embryos from 3 families autosomal dominant polycystic kidney of ADPKD patients due to a pathogenic disease type 1 in the Iranian variant on the PKD1 gene based on genetic population. Journal of Research in Medical Sciences: The Official Journal of Isfahan analysis of the association of 7 STRs with University of Medical Sciences, 22. the PKD1 gene in Vietnamese. This 5. Giancarlo Blasio, Miriam Zacchia, diagnostic method combined with screening Francesca Del Vecchio Blanco, et al. for chromosomal abnormalities on embryo (2021). The application of a NGS kidney samples, helps families of ADPKD patients panel revealed key challenges of PKD1 -2 to select normal embryos that do not carry analysis: interpretation of missense variants, disease genes before transplanting into the significance of variants in duplicated regions mother's uterus and helping to have healthy and high allelic heterogeneity. Nephrology children. The method also can diagnose early Dialysis Transplantation, Volume 36, Issue (when they are asymptomatic) ADPKD Supplement_1, May 2021, gfab080.0017, family members. https://doi.org/10.1093/ndt/gfab080.0017. 6. Kurashige, M, et al. (2014). "A REFERENCES comprehensive search for mutations in the 1. Audrézet, Marie‐Pierre, et al. (2012). PKD1 and PKD2 in Japanese subjects with "Autosomal dominant polycystic kidney autosomal dominant polycystic kidney 332
TẠP CHÍ Y HỌC VIỆT NAM TẬP 539 - THÁNG 6 - SỐ CHUYẤN ĐỀ - 2024 disease", Clinical genetics. 87(3), pp. 266- 10. N. Buset Ríos1 , J.C. Rodríguez Pérez, J.J. 272. Sánchez4, (2009). Genetic diagnosis of 7. Li, S., Zhu, S., & Wang, H. (1998). The autosomal dominant polycystic kidney polymorphism of two microsatellites closely disease using multiplex-PCR. linked to the locus for polycystic kidney Nefrología;29(4):327-330. disease 1 in Chinese population. Zhonghua yi 11. Plurksathaporn, P., Bunditworapoom, D., xue yi chuan xue za zhi= Zhonghua yixue Roothumnong, E., Amesbutr, M., yichuanxue zazhi= Chinese journal of Limwongse, C., Vareesangthip, K., & medical genetics, 15(6), 360-363. Thongnoppakhun, W. (2015). Multiplex- 8. Loftus BJ, Kim UJ, Sneddon VP, et al. STR panels comprehensive for a timely Genome duplications and other features in 12 molecular diagnosis of ADPKD. Genomics Mb of DNA sequence from human and Genetics, 8(2), 143-149. chromosome 16p and 16q. Genomics. 12. Obeidova, Lena, et al. (2014). "Novel 1999;60(3):295-308. mutations of PKD genes in the Czech 9. Magistroni R, He N, Wang K, et al. population with autosomal dominant Genotype-renal function correlation in type 2 polycystic kidney disease", BMC medical autosomal dominant polycystic kidney genetics. 15(1), p. 41. disease. J Am Soc Nephrol. 2003;14(5):1164-1174. 333