Báo cáo khoa học: Distribution of the lipolysis stimulated receptor in adult and embryonic murine tissues and lethality of LSR–/–

doi:10.1111/j.1432-1033.2004.04223.x

Eur. J. Biochem. 271, 3103–3114 (2004) (cid:1) FEBS 2004

Distribution of the lipolysis stimulated receptor in adult and embryonic murine tissues and lethality of LSR–/– embryos at 12.5 to 14.5 days of gestation

Samir Mesli1, Sandrine Javorschi1,†, Annie M. Be´ rard1, Marc Landry2, Helen Priddle3, David Kivlichan3, Andrew J. H. Smith3, Frances T. Yen4, Bernard E. Bihain4 and Michel Darmon1 1Laboratoire de Biochimie et de Biologie Mole´culaire, Universite´ Victor Se´galen Bordeaux 2, France; 2INSERM E358, Universite´ Victor Se´galen Bordeaux 2, France; 3Gene Targeting Laboratory; Center for Genome Research, University of Edinburgh, Scotland; 4Laboratoire Me´decine et The´rapeutique Mole´culaire, Vandoeuvre-les-Nancy, France

steroidogenic organs, lung, intestine and kidney). To explore the role of LSR in vivo, the LSR gene was inactivated in 129/ Ola ES cells by removing a gene segment containing exons 2–5, and 129/Ola-C57BL/6 mice bearing the deletion were produced. Although heterozygotes appeared normal, LSR homozygotes were not viable, with the exception of three males, while the total progeny of genotyped wild-type and heterozygote pups was 345. Mortality of the homozygote embryos was observed between days 12.5 and 15.5 of ges- tation, a time at which their liver was much smaller than that of their littermates, indicating that the expression of LSR is critical for liver and embryonic development.

Keywords: lipoprotein receptors; Northern-blot; quantita- tive PCR; immunofluorescence; gene-targetting.

The lipolysis stimulated receptor (LSR) recognizes apo- lipoprotein B/E-containing lipoproteins in the presence of free fatty acids, and is thought to be involved in the clearance of triglyceride-rich lipoproteins (TRL). The distribution of LSR in mice was studied by Northern blots, quantitative PCR and immunofluorescence. In the adult, LSR mRNA was detectable in all tissues tested except muscle and heart, and was abundant in liver, lung, intestine, kidney, ovaries and testes. During embryogenesis, LSR mRNA was detectable at 7.5 days post-coitum (E7) and increased up to E17 in parallel to prothrombin, a liver marker. In adult liver, immunofluorescence experiments showed a staining at the periphery of hepatocytes as well as in fetal liver at E12 and E15. These results are in agreement with the assumption that LSR is a plasma membrane receptor involved in the clear- ance of lipoproteins by liver, and suggest a possible role in

Lipids, absorbed exogenously by the intestine and synthe- sized endogenously by the liver, are secreted into the circulation as lipoproteins for their transport to tissues, where they are used mainly for membrane synthesis, steroidogenesis and fat storage. Dietary cholesterol, phos- pholipids, triglycerides (TG) and fat-soluble vitamins absorbed by the intestine after a meal are transported by chylomicrons into lymph, then into blood. Lipoprotein lipase (LPL), anchored to the surface of capillary endothe-

lium, hydrolyzes TG of chylomicrons into free fatty acids (FFA) that are taken up by the underlying muscle and adipose tissues. Chylomicron remnants are then taken up by the liver [1]. Transport of lipids to tissues is achieved by very low density lipoproteins (VLDL) and low density lipo- proteins (LDL). Excess cholesterol is removed from the peripheral cells by high density lipoproteins (HDL) that are able to return it to the liver for excretion via the LDL receptor (LDLR) or the scavenger receptor class BI (SR-BI) path- ways. In the same way, HDL are also involved in the delivery of cholesterol to certain tissues, mainly steroidogenic organs. Apolipoprotein (apo) B and E containing-VLDL and chylomicron remnants bind with high affinity to the LDLR and the LDL receptor related protein (LRP) that mediates endocytosis of both particles. However, another plasma membrane lipoprotein receptor genetically distinct from the LDLR and LRP, called the lipolysis-stimulated receptor (LSR) may also be involved in the clearance of TRL [2,3].

The LSR was originally identified by its ability to bind LDL in the presence of FFAs [4]. LSR polypeptides (85 and 115 kDa) were identified by ligand blotting in the presence of oleate in fibroblasts isolated from a patient with familial hypercholesterolemia [2]. Three bands of 90, 115, and 240 kDa were found when solubilized rat liver membrane proteins were used as a substrate [5]. When antibodies inhibiting LSR function were used for Western blotting, the

Correspondence to Y. M. Darmon, Universite´ Victor Se´ galen Bor- deaux 2, Laboratoire de Biochimie et de Biologie Mole´ culaire, Zone Nord – Case 49–146, Rue Le´ o Saignat, 33076 Bordeaux Cedex, France. Fax: + 33 5 57 57 1397, Tel.: + 33 5 57 57 15 79. E-mail: darmon@u-bordeaux2.fr Abbreviations: apo, apolipoprotein; FFA, free fatty acids; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HDL, high density lipo- proteins; LDL, low density lipoproteins; LDLR, low density lipo- protein receptor; LRP, low density lipoprotein receptor related protein; LSR, lipolysis stimulated receptor; SR-BI, scavenger receptor BI; TG, triglycerides; TRL, triglyceride-rich lipoproteins; VLDL, very low density lipoproteins. (cid:1)Present address: Invitrogen Corp. 1610 Faraday Avenue, Carlsbad, CA 92008, USA. (Received 1 April 2004, revised 6 May 2004, accepted 19 May 2004)

3104 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

[32P]dCTP[aP]

inserted in pGEMT-easy 5Zf(–) (a gift from Genset, La Jolla, CA, USA). Probes were labeled by decanucleotide-mediated incorporation of (Ambion, Montrouge, France). Blots were rinsed three times with 2· NaCl/Cit, 0.05% SDS at room temperature for 30 min and washed twice with 0.1· NaCl/Cit, 0.1% SDS at 50 (cid:2)C for 40 min with agitation. Autoradiography was performed by expo- sure for 2 h in a PhosphorImager (Molecular Dynamics, Amersham–Pharmacia–Biotech, Orsay, France).

Real-time RT-PCR

same three bands were detected. Molecular cloning of the LSR allowed the authors to identify putative translation products of 58.3, 63.8, and 65.8 kDa. The combination of various techniques suggested that the receptor was a multimer of subunits associated through disulfide bridges [5]. Several characteristics of LSR suggest that it might represent a significant element for the clearance of TRL: (a) LSR is able to bind lipoproteins containing apoB and apoE; (b) LSR displays high affinity for TRL; (c) LSR binding is inhibited by lactoferrin, receptor associated protein (RAP), and apoCIII, all reported to have a hyperlipemic effect in animals [2,3] [6,7]; (d) the apparent number of LSR binding sites expressed at the surface of hepatocytes correlates negatively with plasma triglyceride levels measured in the postprandial stage [3].

Mouse tissues were pooled from 4 to 5 mice on a standard diet. Samples were immediately put into Trizol (Gibco BRL, Cergy-Pontoise, France) and stored at )80 (cid:2)C pending RNA isolation. Total RNAs were isolated accord- ing to the manufacturer’s instructions. The amount of RNA was determined by measuring absorption at 260 nm. The quality of the isolated RNA was controlled by the 260/ 280 nm ratio (1.8–2.0).

The present work was undertaken to determine the distribution of LSR mRNA and protein in murine organs, and whether this distribution was compatible with the alleged role of this new receptor as a lipoprotein receptor. It was found that LSR was not only expressed in liver (adult and fetal), but also in steroidogenic organs (ovaries, testes, and adrenal glands), lung, intestine, kidney and brain. To explore further the role of LSR, the gene was inactivated in ES cells and a strain of transgenic LSR knockout mice was established. However, from a total progeny of 345 mice derived from intercrossing LSR heterozygote (LSR+/–) animals, only three viable homozygote (LSR–/–) animals were obtained, so that a comprehensive description of their phenotypic defects was impossible to produce. Most LSR–/– mutants die in utero between embryonic days 12.5 (E12.5) and E15.5. At E14.5, LSR–/– mutant mice livers were found to be much smaller than that of their littermates. Therefore, inactivation of LSR appears to be lethal at the embryonic stage, probably secondary to liver involution.

Materials and methods

Animals used for expression studies

Normal C57Bl/6, 129/Sv, and MF1 mice were obtained from CERJ (Le Genest Saint-Isle, France). They were housed in a specific pathogen-free animal facility on a 12-h light : 12-h dark cycle, with free access to food and water. The research protocol was in accordance with French Ministry of Agriculture, section of Health and Animal Protection (approval 04476).

Northern blots

cDNAs were obtained by reverse-transcription of 1 lg total RNAs prepared from C57BL/6 mouse tissues. RNAs were first treated by RQ1 RNase-Free DNase (Promega, Charbonnie` res, France). First strand cDNA synthesis was performed in a 20 lL mixture using the GeneAmp RNA PCR kit (Applied Biosystems, Courtaboeuf, France). For some tissues, total cDNAs were also obtained from Clontech. Specific primers and TaqMan probes were designed using the PRIMER EXPRESS 1.0 software (Applied Biosystems) and synthesized by Genset (Paris, France). Each probe was double-labeled with the fluorescent reporter dye, 6-carb- oxyfluorescein (FAM), covalently linked to the 5¢-end of the probe and the quencher dye, 6-carboxytetramethylrhodam- ine (TAMRA), attached to the 3¢-end. Quantitative PCR was performed in 96-well reaction plates with optical caps. Fluorescence was followed continuously for each reaction. Real-time quantitative RT-PCR analyses were performed in an ABI PRISM 5700 sequence detection system instrument (Applied Biosystems). The reaction mixture contained an amount of cDNA corresponding to 100 ng of reverse- transcribed total RNA, 300 nM sense and antisense primers (except for GAPDH, 120 nM of each) and 200 nM probe in a final volume of 25 lL using the TaqMan PCR mix (Applied Biosystems). Relative quantitation of a given gene was calculated after normalization to 18S ribosomal RNA amount for tissues from which RNAs were isolated (liver, ovaries, adrenal glands, testes, intestine, brain, muscle), or GAPDH amount for tissues for which total cDNA were purchased (liver, lung, kidney, heart). Individual CT values are means of duplicate measurements. Delta CT were converted to arbitrary values with the formula: arbitrary units ¼ 2)dCT · 106 assuming an efficiency of amplification of 100%. Results are expressed as the mean of two experiments. The complete list of gene-specific primers and probes can be found in Table 1. It must be noted that the quantitative PCR was designed to detect the sum of all transcripts of LSR.

Antibodies and immunocytochemistry

Mouse embryo and adult multiple tissue Northern blots were performed with nylon membranes blotted to gels loaded with 2 lg mRNA per lane (Clontech, Saint-Quentin en Yvelines, France). They were prehybridized for 30 min at 68 (cid:2)C in Express Hyb TM hybridization solution (Clontech) and then hybridized for 2 h at 68 (cid:2)C with the same solution supple- mented with the appropriate radiolabeled cDNA probes. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probe (500 bp fragment) was prepared by NotI and EcoRI digestion of the murine cDNA inserted in PT7T3d plasmid (IMAGE clone 113843, UK HGMP Resource Centre, Cambridge, UK). The LSR probe (full length 2 kb insert) was prepared by EcoRI digestion of the murine cDNA

The anti-LSR Ig used for this study was a gift from Genset (La Jolla, CA, USA) [5]. The antiserum raised in New

LSR gene and protein expression (Eur. J. Biochem. 271) 3105

(cid:1) FEBS 2004

Table 1. Sequences of primers and probes used for real-time PCR with the TaqMan system. NC, sequences not communicated by Perkin Elmer.

mRNA Amplicon size (bp) Upstream primer (5¢fi3¢) Probe (5¢fi3¢) Downstream primer (5¢fi3¢)

LSR atgcgtcctccctatgggtac tggagactttgacaggaccagctcagttg acctgggagctgtggcc

ctgtccccccaagacgtg caagtgcatctccccgcagtttgtgt ccatctaggcaatctcggtctc

gtcccattggctttgagctc tcgaggagagcggatatcagacgcatatc gccacattgttgttgtttgtttc

tgatgatgaccttggcgct caccatgggccagcgtgcttt gggaagcatgtctgggagg

cgtgggctccagcattcta ccaatggtcgggcactgctcaa tcatttctgcctttgcgtcc

attacctgcgctgggtgc tgaccaggtccaggaagagctgca gtcagttcttgtgtgacttgggag

gacactctgggttcaaccgttagt ctgcaggaacggctgggccc ttcctctaggtccttgttcatctcc

tacatagacgggcgcatcg agggctgggacgctgagaagggtat aaaaagcatcacctgccagg

ggtggctattaattattcggctg attcccagtgggcagtgatggcattac gggcaagtggctagagtgca

Zealand rabbits was able to inhibit the in vitro binding of LDL to LSR preparations. In Western blots or immuno- precipitations it recognized the same bands that were identified by ligand blotting (90, 115 and 240 kDa) and by Western blotting. Negative controls were prepared by substituting the anti-LSR serum by nonimmunized or irrelevant rabbit sera. In some experiments, tissues from surviving male homozygous LSR knockout mice were included as negative controls.

Adult mouse tissues and post implantation embryos (E12.5 and E15.5) were fixed in 4% paraformaldehyde overnight, freezed in Tissue-Tek (Labonord, Templemars, France) and sectioned with a cryotome (10 lm sections) onto Superfrost coated slides (Labonord).

Tissues were incubated for 30 min in phosphate-buffered saline (NaCl/Pi) containing 0.5% bovine serum albumin (BSA), washed 3· with NaCl/Pi and incubated in anti-LSR serum (1 : 10 in NaCl/Pi/BSA) for 2 h at 37 (cid:2)C. The sections were washed in NaCl/Pi and incubated with fluorescein- conjugated goat anti-rabbit IgG (Molecular Probes/Inter- chim, Montluc¸ on, France) 1 : 200 in NaCl/Pi-BSA for 1 h at 37 (cid:2)C. The sections were then washed 3· in NaCl/Pi before mounting in ProlongTM Antifade (Molecular Probes/Inter- chim). Slides were examined with a Leica photomicroscope using appropriate filter systems. Photographs were taken on Kodak films (Amersham–Pharmacia–Biotech).

Gene targeting of the LSR gene and generation of LSR deficient mice

together covered the most part of the gene, were isolated and inserts sequenced. This sequence (GenBank AY376636) contained the first eight exons and ends 19 bp before the end of exon 9 of the LSR gene; it lacks all of intron 9 and exon 10. Altogether this sequence lacks the portion coding for the last 17 amino acids of LSR. A replacement targeting vector (map, Fig. 1). was designed subsequently to create a null allele by deletion of an internal region of the gene between the 5¢-end of exon 2 and the 3¢-end of exon 5 and its substitution with a reporter (b-galactosidase) and selection marker (neomycin resistance). This vector was comprised of left and right homology arms, which consisted of 2.65 kb of cloned genomic DNA sequence containing the 5¢- part of exon 2, intron 1, exon 1 and its 5¢-flanking noncoding sequence, and 2.7 kb of sequence containing the 3¢-part of exon 5 and 3¢-flanking intron 5 sequence, respectively. These were inserted into a pBluescript plasmid, with the exon 2 and 5 sequences joined via a BamHI linker. The reporter/selection cassette TAG3/IRES lacz/ SV40pA/MC1neo/pA [8] was inserted into the BamHI linker site. A MC1-tk dimer cassette [9] was appended to the end of the 5¢-homology arm at a SalI site for negative selection [10]. The vector was linearized with NotI, and E14TG2a embryonic stem cells cultured according to standard conditions [11] were electroporated and selected in G418 and ganciclovir. Resistant ES cell clones were picked into 96-well plates, and replica plated subsequently for freezing and DNA preparation. ES cell clone DNAs were screened by Southern blot analysis using HindIII digestion and hybridization with probes flanking and external to the vector homology arms (Fig. 1). Clones targeted correctly at both 5¢- and 3¢-sides were detected at a frequency of 12%. Targeted ES cells were injected into C57BL/6 blastocysts and the resulting male chimeras subsequently test-crossed with C57BL/6 females. Germline transmission from chimeras derived with two independent targeted clones was confirmed in agouti coat colored

The murine (C57BL/6) LSR gene contains 10 coding exons with an open reading frame of 1782 nuclotide long encoding a peptide of 594 amino acids (F. T. Yen & B. E. Bihain, unpublished results). A129/Ola mouse genomic lambda 2001 library was screened with a full length LSR cDNA probe to isolate cloned DNA for the targeting vector construction. Several overlapping phage clones, which

LDLR X64414 LRP AF074265 SRB1 U37799 ApoB M35186 ApoE D00466 Apo A1 X64262 Prothrombin X52308 Ubiquitin X51703 GAPDH 18S rRNA NC NC NC NC NC NC 71 (exons 6–7) 102 (430–531of 4467) 124 (1926–2049 of 5521) 131 (520–650 of 1785) 65 (771–835 of 2354) 79 (134–212 of 936 CDS) 126 (268–393 of 924) 72 (1084–1155 of 2031) 75 (1010–1084 of 1172) (cid:1) 190 (cid:1) 200

3106 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

Genotyping of LSR and neogenes by PCR

test-cross offspring by Southern blot analysis of DNA obtained from tail biopsy. Male and female test-cross offspring heterozygous for the null allele were intercrossed to obtain formal proof of the creation of the null allele and for preliminary phenotypic assessment. The LSR deficient strain was maintained by back-crossing heterozygous males with C57BL/6, 129/Sv and MF1 females at each generation. Mice at back-cross generation 1–6 were intercrossed to provide the homozygous null, heterozygous null and wild- type mice used in the analyses described herein.

For PCR, genomic DNA from embryos and adult mouse tails was extracted by proteinase K digestion, isolated using the Genomic DNA Purification Kit (Promega, Charbonnie` - res, France) and precipitated with ethanol. PCR primers were selected to generate a product specific for either the wild-type or the mutant LSR allele. The wild-type LSR allele was diagnosed by a 773-bp PCR product generated by a forward primer located in exon 4 (5¢-CAGGACC TCAGAAGCCCCTGA-3) and a reverse primer located in exon 5 (5¢-AACAGCACTTGTCTGGGCAGC-3¢). This region of the LSR gene is deleted in the mutant allele. The

Animal breeding and experiments were carried out in accordance with the European Communities Council Directive of 24 November 1986.

Fig. 1. Generation of the LSR null allele. (A) Structure of the mouse LSR gene (top), the linearized LSR targeting vector (middle) and the targeted allele (bottom) resulting from replacement recombination. The null allele was created by deletion of a 9.8 kb internal region of the gene from the beginning of exon 2 to the end of exon 5 and its substitution with a b-galactosidase/neomycin phosphotransferase reporter/selection cassette. Dashed crosses indicate the recombination cross-over positions between homologous vector and chromosomal sequence. Chromosomal and cloned genomic DNA sequence is shown by a thick black line (for intron and flanking noncoding sequence) and by black rectangles (for exon sequence), the reporter/positive selection cassette by IRESlaczpA and grey (loxP/MC1neopA loxP)1) rectangles, the HSV thymidine kinase negative selection cassette (MC1tk dimer) by a rectangle and pBluescript plasmid sequence by a thin black line. Sites for HindIII restriction enzyme (H) are indicated by small arrows and the sizes of relevant restriction fragments in the wild-type and targeted allele are shown by dotted lines. The targeted allele was identified by HindIII digestion and hybridization with the 5¢- and 3¢-flanking probe fragments (striped rectangles) to detect the indicated size fragments. (B) Southern blot analysis of HindIII-digested genomic DNA prepared from 96-well plates of G418+ Gancyclovir resistant ES cell clones derived from transfection with the LSR targeting vector. The digested DNA and a kHindIII marker was resolved on a 0.6% agarose gel, blotted to positively charged nylon membrane and hybridized with 25 ng of 3¢-probe and 25 ng of kHindIII marker. The hybridized blots were exposed to Kodak XOMAT film overnight at )80 (cid:2)C. The 3¢-probe detects a 10.5 kb HindIII fragment for the wild-type allele and a 13 kb fragment in a targeted allele.

LSR gene and protein expression (Eur. J. Biochem. 271) 3107

(cid:1) FEBS 2004

ization of the radioactivity of the LSR bands to that of the 1.35 kb GAPDH band. Data showed that testes and kidney contained, respectively, 63% and 48% of the signal present in liver. Figure 2B shows a Northern blot containing mRNA from whole embryos at stages E7, E11, E15, and E17 hybridized with an LSR probe and reprobed with a GAPDH cDNA. The 2.1 kb LSR band was detected at all stages. Again, loading of the lanes was unequal making direct quantification difficult. As in the case of adult tissues, we normalized LSR bands to the corresponding 1.35kb GAPDH bands. Ratios were approximately equal at all stages, indicating that the LSR expression level was of the same order of magnitude between E7 and E17.

targeted mutant allele was detected by the presence of the neo gene. Two couples of neo primers have been used during the course of this work: (forward: 5¢-GGCGCCCGG TTCTTTTTGTCA-3¢ and reverse: 5¢-TTGGTGGTCG AATGGGCAGGT-3¢ giving a product of 281 bp) and (forward: 5¢-GAGGATCTCGTCGTGACCCATG-3¢ and reverse: 5¢-GAGGAAGCGGTCAGCCCATT-3¢ giving a product of 179 bp). For the wild-type LSR gene, conditions were (94 (cid:2)C for 30 s, 63 (cid:2)C for 1 min, 72 (cid:2)C for 30 s; 35 cycles. For the neo gene, PCR conditions were: 95 (cid:2)C for 30 s, 68 (cid:2)C for 1 min, and 72 (cid:2)C for 30 s; 33 cycles. In both cases, PCR cycles were preceded by 10 min at 95 (cid:2)C and ended by 7 min at 72 (cid:2)C.

Real-time quantitative RT-PCR

Results

To obtain insight on the possible function(s) of LSR, we first determined the tissue distribution of its mRNA in organs of adult mice in comparison with that of mRNA of other lipoprotein receptors or apolipoproteins. We also determined the amount of LSR mRNA at different time points of embryonic development.

Northern blots

In a first selection of tissues (liver, ovaries, adrenal glands, intestine, brain and muscle), LSR mRNA was testes, extracted as described in Materials and methods. Results obtained by real-time quantitative RT-PCR were normal- ized to the amount of 18S ribosomal RNA (Fig. 3A and Table 2). Quantitative PCR was also performed on lung, kidney and heart samples, but in that case the starting material was commercially available total cDNA. For those tissues, data were normalized to the amount of GAPDH mRNA (Fig. 3B and Table 3).

Liver cDNAs were obtained from both the mRNA extracted in our laboratory and from the commercial source in order to allow us to compare the two sets of experiments. Figure 3A and Table 2 show that LSR mRNA is very abundant in liver, as expected from the Northern blot analysis. We also found a significant expression in ovaries and testes (respectively 62.8%, and 21.7% of liver), but the

Figure 2A shows a Northern blot of selected adult murine tissues hybridized with an LSR probe. As expected from results obtained in the rat [5], a 2.1 kb band was observed in liver. A faint but clean band was also observed in testis and kidney. Hybridization with a GAPDH probe showed unequal loading of the commercial membrane and partic- ularly that the liver lane was overloaded. Quantitation of the amount of LSR mRNA was thus performed after normal-

Fig. 2. Northern blots of adult murine tissues (A) and whole embryos (B) mRNAs. E7, E11, E15, E17: embryo stages (days post-coitum). The LSR probe reveals a 2.1 kb band, and the GAPDH probe a 1.35 kb band and (in some tissues) a 1.2 kb band.

3108 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

The pattern of expression of SR-BI mRNA (Tables 2 and 3) was rather different from that of LSR mRNA: (a) it was extremely abundant in adrenal glands and ovaries (respect- ively 46.5-fold and 18-fold the amount present in liver); (b) expression in testes, brain and muscle was rather abundant (respectively 115%, 122.2% and 55.8% of the amount present in liver).

The tissue distribution of LRP mRNA in adult mice (Tables 2 and 3) was also very different from that of LSR: its amount in ovaries, adrenal glands, brain and muscle was higher than that of liver (respectively 410%, 190%, 180%, and 250% of the amount present in liver).

Although RT-PCR arbitrary units do not

reflect precisely true message amounts, due to the different amplification efficiencies for different gene targets, taken altogether, the results suggest that the amount of LSR messengers in liver is higher than that of the other receptors here described. It must be noted that Fig. 3A and B have different scales because one was normalized to 18S ribosomal RNA and the other to GAPDH mRNA.

Several mRNA species were used as controls for tissue- specific expression. As expected, prothrombin mRNA was almost exclusively expressed in liver; apoA1 and apoB mRNA were expressed mainly in liver but also in intestine; apoE mRNA was predominant in liver but abundant in all tissues; ubiquitin and GAPDH mRNA were ubiquitous, and showed important variations of expression from one tissue to another.

The expression of LSR was also studied by quantitative PCR during mouse embryonic development. cDNAs from whole embryos at E7, E11, E15, E17 stages were used as starting material and results were normalized to GAPDH mRNAs. Figure 3C shows that LSR was detectable at E7, became more abundant at E11 (fourfold increase) and maintaining these increased levels until E17. This pattern of expression seems to parallel liver growth as a similar time- course was observed for prothrombin. Table 4 shows that in contrast, LDLR and SR-BI mRNA had different time- courses with a higher amount at E7, followed by a decrease at E11 and an increase at E15. LRP showed a time-course similar to that of LSR except for a decrease at E17; apoA1, apoB and ubiquitin showed a time-course similar to that of LRP.

Immunofluorescence

amount in adrenal glands was only 4% of that of liver. A substantial expression was found in intestine and brain (respectively 41.9% and 15.9% of liver). The expression in muscle was very low (0.5% of liver). Figure 3B and Table 3 show that LSR mRNA is rather abundant in lung and kidney (55.8% and 11.8% of liver) but barely detectable in heart.

To localize the LSR receptor itself, different murine tissues were studied by indirect immunofluorescence with an anti- LSR antiserum. To avoid misinterpretations due to back- ground, two normal rabbit sera were systematically included in the labeling experiments. Moreover, tissues from LSR knockout mice were also tested with the anti-LSR anti- serum. Figure 4A,B shows the presence in adult liver of a strong specific signal at the periphery of hepatocytes. This staining pattern is compatible with the previously described localization of LSR at the plasma membrane level [5]. The presence of LSR could also be detected in fetal liver cells in E12 and E15 embryos (data not shown). A faint but specific staining was detected in kidney Fig. 4E. The signal was observed in the kidney cortex, mainly at the level of glomerules.

The distribution of several gene mRNA involved in lipoprotein metabolism was studied comparatively as an attempt to get some insight into the possible functions of LSR. The tissue distribution of LDLR mRNA (Tables 2 and 3) is not very different from that of LSR mRNA, with two notable exceptions: (a) it was more abundant in adrenal glands and ovaries than in liver (respectively 200%, and 180% of liver); (b) it was abundant in muscle (41.2% of liver).

Fig. 3. Quantitation of LSR mRNA by real-time PCR in adult murine tissues (A,B) and whole post-implantation embryos (C). Data were normalized to 18S ribosomal RNA (A) and to GAPDH mRNA (B, C). dCT were converted to arbitrary values by the following formula: 2)dCT · 106. Liver (L), ovaries (o), adrenal glands (a), testes (t), intes- tine (i), brain (b) and muscle (m), lung (lu), kidney (k) and heart (h). E7, E11, E15, E17: Embryo stages (days post-coitum).

LSR gene and protein expression (Eur. J. Biochem. 271) 3109

(cid:1) FEBS 2004

Table 2. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB, apoE, ubiquitin, prothrombin, and GAPDH mRNAs by real-time PCR in a first set of adult murine tissues. For each gene, results were normalized to 18S ribosomal RNA. dCT were converted to arbitrary values by the following formula: 2)dCT · 106.

Tissue

mRNA Liver Ovaries Adrenal glands Testis Intestine Brain Muscle

3.61

28.5 167 3620 34.4 43.4 55.8 298 68.8 16.5 9.8 57.1 446 150 1390 91 0.79 0.3 41.7 0.04 5.5 154 10.7 89.7 5.5 0.06 1.5 113 63.8 95.1 40.6 0.04 0.4 0.06 0.1

Knock-out of the LSR gene

4830 1840 7490 2780 899 6050 1630 854 343 13900 3830 1190 1490 0.5 1.8 0.4 9.8 0.1 0.8 LSR LDLR SRBI LRP ApoAI ApoB ApoE Ubiquitin Prothrombin GAPDH 710 83.4 77.8 22.2 244 16900 83000 478 9490 1780 5910 3700 321 321 19800 51100

Table 3. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB, apoE, ubiquitin, and prothrombin by real-time PCR in a second set of adult murine tissues. For each gene, results were normalized to GAPDH mRNA. DCT were converted to arbitrary values by the following formula: 2)dCT · 106.

Tissue

mRNA Liver Lung Kidney Heart

303 141 95.6 37700 13300 20200 1150 7980 2630 144 911 125 4.86 3.58 4.76

63400 63700 LSR LDLR SRBI LRP ApoAI ApoB ApoE Ubiquitin Prothrombin 67500 15400 3740 538 3380 86600 15 700 000 2060 000 901 000 46.6 593 717 000 6770 000 6300 380 93400 966 000 128 4.63

Table 4. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB, apoE, ubiquitin and prothrombin by real-time PCR in whole post- implantation embryos. For each gene, results were normalized to GAPDH mRNA. DCT were converted to arbitrary values by the fol- lowing formula: 2)dCT · 106. Embryo stages (days post-coitum.): E7, E11, E15, E17.

Age

Mice with one LSR allele inactivated did not show any detectable defect. Their size, weight, adiposity, plasma glucose, cholesterol, triglycerides, phospholipids, nonesteri- fied fatty acids, free glycerol, as well as their lipoprotein profile were similar to those of their wild-type littermates. Animals bearing two inactivated LSR alleles (LSR–/–) show an embryonic lethality between E12.5 and E15.5. As an attempt to define the reason for the embryonic lethality of LSR–/– embryos, timed matings were set up and resulting embryos examined and genotyped (Table 5 and Fig. 5). Up to E12.5, LSR–/– mice were obtained in numbers compatible with Mendelian ratios, and macro- scopic examination of the whole litters showed that all embryos were alive and had no observable anomalies. But at E15.5, genotyping did not show the presence of viable homozygote embryos. Resorbed embryos were numerous at E14.5/15.5 and the majority were most probably LSR–/–, but we were not able to genotype them because of DNA degradation. At E14.5, some litters contained LSR–/– embryos. Their only constant defect was a reduction in liver size (Fig. 6A); in some embryos, the liver was reduced to a punctiform red spot (not shown). Histological sections of E14.5 LSR–/– embryos showed that the cell density was lower than in the wild-type littermates. Spaces devoid of cells were observed, but no specific cellular abnormalities or absence of certain cell types were observed in the liver of the mutants. For example, megacaryocytes, although rare (Fig. 6E), could be found in LSR–/– embryos (not shown). LSR–/– embryos had other anomalies but they were not constant: a general white coloration, while the LSR+/+ and LSR+/– littermate embryos had a pinkish hue; superficial hemmorrhages (Fig. 6A), superficial detachment of the skin (Fig. 6A); a smaller size than their littermates and finally some of them were obviously dead. Interestingly homozygote embryos did not show an overall developmen- tal delay, as shown by limb bud, eye and facial development (Fig. 6A).

mRNA E7 E11 E15 E17 Adult Liver

During the last three years, no viable adult LSR–/– was obtained by intercrossing LSR+/– mice. However in the very first litters obtained by intercrossing male LSR+/– derived from the chimeras with female LSR+/– derived

5680 2880 4160 16 900 20.6 3190 30 800 7190 4780 6430 25 600 93.8 25 600 277 000 7810 2560 9620 7440 76.7 5340 578 000 67 500 1310 15 400 21 900 37 400 14 100 538 9230 3380 5.82 86 600 32 12 600 1 5700 000 979 000 1 580 000 3 030 000 1 060 000 2 060 000 LSR LDLR SRBI LRP ApoA1 ApoB ApoE Ubiquitin Prothrombin 13.6 2670 40 900 114000 901 000

3110 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

Fig. 4. Immunolocalization of LSR in liver and kidney. (A,B,C,E) anti-LSR serum, (D,F) normal rabbit serum. Specific staining is observed at the periphery of hepatocytes of adult liver (A,B). No signal was observed in liver from one LSR–/– mouse (C). Specific staining is also found in kidney cortex (E) principally at the level of glomeruli (arrows). No staining was detected in liver (D) and kidney (F) treated with normal rabbit serum. Bar in (F) relates to 20 lm (A,C,D,E,F) and 6 lm (B).

Table 5. Embryos obtained by intercrossing LSR+/– mice. Embryos were genotyped as shown in Fig. 6. Living LSR–/– embryos were found at E10.5 and E12.5 and were apparently normal. LSR–/– embryos could not be found at E15.5. At E14.5, living LSR–/– embryos were found but had all a small liver (Fig. 6A). Moreover, one litter contained two dead LSR–/– embryos with a punctiform liver.

LSR mutants

except that one of them seemed to have no testes. They were smaller than their littermates: the 9-month weight of LSR–/– was 30.7 ± 0.2 vs. 39.3 ± 2.1 g for their wild-type litter- mates (P < 0.02). Continual matings for 3 months demon- strated that these mice were sterile. As one of the LSR–/– mice died spontaneously and the others became sick (lethargic), we killed these two animals for necropsy and collection of organ samples; they both showed a limited amount of fat and one of them actually had no testes, but no other anatomical defect was detected. To explore whether the genetic background could influence the viability of LSR–/– mice, we backcrossed the mutations in two inbred strains (C57BL/6 and 129/Sv) and an outbred strain (MF1); we also intercrossed heterozygotes of C57BL/6 and 129/Sv back- grounds, but no viable LSR–/– mice were obtained.

+/+ +/– –/– Genetic background No. of embryos No. of litters Age

Discussion

a Dead embryos.

In this study, we used Northern blotting, real-time PCR and immunofluorescence microscopy to examine the expression of LSR in the adult mouse and during development. In the adult, the highest levels of LSR expression were found in liver as expected from results obtained in the rat [5]. Several reports published by Bihain and colleagues [2–5] have provided circumstantial evidence for a role of LSR in the

from the first generation, or intercrossing male and female LSR+/– mice derived from the first generation, three viable LSR–/– mice (all males, two from one litter, and one from another) were obtained. They had no morphological defects

E10.5 C57BL/6 C57BL/6 E12.5 C57BL6/)129/Ola E12.5 E14.5 C57BL/6 E14.5 C57BL/6 C57BL/6–129/Ola E14.5 MF1 E14.5 C57BL/6–129/Ola E15.5 10 7 25 10 8 10 22 13 1 1 3 1 1 1 2 1 3 1 4 3 3 4 5 7 6 4 14 7 3 6 11 6 1 2 7 0 2a 0 6 0

LSR gene and protein expression (Eur. J. Biochem. 271) 3111

(cid:1) FEBS 2004

in these latter tissues and is involved together with LPL in fatty acid uptake by striated muscle [18]. Thus, our data indicate that LSR could be specialized in the uptake of TRL by liver as suggested by its discoverers [5]. The demonstra- tion of this hypothesis would require an analysis of the lipoprotein phenotype of a sufficient number of adult LSR–/– mice (for instance after designing a liver-specific inducible inactivation of the LSR gene).

Recent studies have suggested that cholesterol plays a crucial role in specific processes during embryonic develop- ment. Cholesterol deficiency during embryogenesis can be caused by defects in apolipoproteins, enzymes or cell- surface receptors that are potentially involved in cellular lipoprotein uptake, either by cells of the yolk sack or the placenta or by the embryo itself [19]. We have studied LSR expression during late embryogenesis in comparison with other lipoprotein receptors which are known to play an important role in embryonic development, and with prothrombin, a liver-specific marker. Due to unequal loading of the lanes, Northern blots were not sensitive enough to show significant changes in LSR expression between E7 and E17. However real-time PCR showed that LSR mRNA is detectable at E7, becomes abundant at E11 (fourfold increase) and remains practically constant until E17. This can be attributed to liver organogenesis which follows a similar time-course [20]. Moreover, LSR protein was detected by immunofluorescence in dissected fetal livers of E12 and E15 mice. Although our real-time PCR data show that all lipoprotein receptors tested follow roughly similar time-courses between E11 and E17, LSR and LDLR are probably the only receptors, among those tested to be present in fetal liver in substantial amounts. Actually previous reports show that (a) the LDLR is present in rat liver from E19 fetuses at 19% of the adult level; (b) hepatic LRP is still low at 19 days of gestation (only 6% of the adult level) [21] and (c) SR-BI is not detectable in embryonic liver until stage E17 [22]. The increased SR-BI mRNA synthesis that we observed between E11 and E15 is probably due to adrenal gland organogenesis [22]. Fetal liver has been shown to synthesize and export into the fetal circulation about one- half of the cholesterol required for heart, lung and kidney development [21, 23]. The early expression of LSR in fetal liver suggests that this receptor could play a role in the uptake of lipoproteins during embryogenesis, a process that cannot be effected by SR-BI at this stage [22]. The scarcity of LSR messages at E7 contrasts with the high expression at that stage of the other lipoprotein receptors which are involved in exchanges between the embryo and extraem- bryonic and maternal tissues. For example, SR-BI present on the apical surfaces of visceral endodermal is thought to provide cholesterol to extraembryonic cells for storage until it can be subsequently transferred to the embryo [22].

Whatever the importance of LSR for post-implantation embryo viability, it must be noted that the abundance of its mRNA increases dramatically during adulthood (Fig. 3). It would be interesting to determine whether it is suckling, like in the case of LRP [21], or weaning, as in the case of LDLR [24], which triggers the increase of LSR seen in liver, as such an induction would be consistent with a role of LSR in chylomicron remnant metabolism.

clearance of TRL by the liver. The LDLR and the LRP have both been shown to be involved in the removal of chylomicron remnants by the liver [12,13]. The facts that mice with an isolated inactivation of the LDLR show no increase in circulating TG [14], and that the lack of LDLR in humans does not lead to a pathological change in the metabolism of dietary fat [15] suggest that (an)other receptor(s) play(s) the major part in TRL clearance by the liver. Moreover, Rohlmann et al. [16] demonstrated that the absence of LRP expression in the livers of LDLR-deficient mice resulted in a large elevation in the plasma concentra- tion of cholesterol and TG that were carried in apo B48- containing lipoproteins resembling remnants. Nevertheless, in LDLR-deficient mice the increase in TG levels was much smaller than that obtained in RAP overexpression experi- ments [17]. The authors concluded that the most probable explanation is that RAP-sensitive receptors such as LSR [7] could be involved in TRL clearance. Actually, our real-time PCR data indicate that in liver, LSR mRNA is expressed as well as LDLR and LRP mRNA, suggesting that the newcomer receptor could indeed play an important role in TRL clearance by the liver. Moreover, the abundance of LSR in liver contrasts with its almost complete absence in skeletal muscle and heart. In that respect LSR differs strikingly from the VLDL receptor which is very abundant

The lethality of LSR–/– embryos that we observed occurs around E12.5–14.5, a period which is concomittant

Fig. 5. Genotyping of embryos obtained by intercrossing LSR+/– mice. PCR of diagnostic LSR (773 bp) and neo (180 bp) gene regions is described in Materials and methods. LSR –/– embryos (upper 5, 6) are present at E12.5 but missing at E15.5.

3112 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

in embryonic lethality by various mechanisms

result [28,29].

including LSR,

We found transcripts for all the lipoprotein receptors tested, in steroidogenic organs such as adrenal glands, testes and ovaries. This is in agreement with results showing SR-BI to be highly expressed in steroido- genic tissues [30,31] which are the sites of the highest specific activity for selective HDL cholesterol uptake in rodents [32]. Nevertheless, LSR and SR-BI were expressed differently, more in reproductive organs than in adrenal glands for LSR, and inversely for SR-BI. The specific abundance of LSR mRNA in testes suggests that this receptor could play an important role in this organ. However its implication in steroidogenesis is questionable as SR-BI, which has also been detected in testes, seems to mediate phagocytosis of apoptotic spermatogenic cells by Sertoli cells after recogni- tion of surface phosphatidylserine [33,34]. In ovaries and

with the appearance of specific hepatocyte function in the fetus [25–27]. The fact that LSR–/– embryos’ livers were smaller (and sometimes punctiform) at E14.5 but normal size at E12.5 indicates that an atrophy of the liver occurred after a first period of apparently normal growth. Histological sections of E14.5 LSR–/– embryos actually showed that the cell density was lower than in the wild- type littermates; moreover spaces devoid of cells were observed in the mutants. Future studies using time-specific markers of liver development will be conducted to compare their time-course in the mutant and the wild- type mice. If the primary effect of the mutation indeed affects liver development, other defects such as the smaller size and even lethality of the embryo can be explained by ischemia, as liver is the major hematopoietic organ at that stage. Inactivations of some lipoprotein receptor genes, for instance LRP and gp330/megalin, have also been found to

Fig. 6. Gross morphology and liver histology of a typical LSR–/– mutant embryo compared to a wild-type littermate. Lateral views of E14.5 embryos (A,B). The LSR–/– embryo (A) shows a reduction of liver size (white arrow) and displays hemorrhages (black arrow) contrasting with an anemic color. It also shows a detachment of dorsal skin (small arrows). The wild-type littermate (B) shows a liver of normal size (white arrows); its skin has a pinkish hue, distinct subcutaneous vessels and does not show detachment. Note that the overall development of the mutant is not dif- ferent from that of the wild-type as shown by embryo size, and limb bud and eye stages. Histological sections of livers of E14.5 em- bryos stained with hematoxylin and eosin (C,D,E,F). Note the presence of large inter- cellular spaces (arrow) in the liver of the mutant (C,E) contrasting with the normal architecture of the wild-type liver (D,F). In addition, megacaryocytes were very rare in the mutant liver while they were easily found in the wild-type liver [see arrow on view (F)]. Bar in F relates to 160 lm (C,D) and 40 lm (E,F).

LSR gene and protein expression (Eur. J. Biochem. 271) 3113

(cid:1) FEBS 2004

adrenal glands, LSR mRNA is found to be abundant. Previous studies have demonstrated that steroidogenesis in the ovary depends mainly on the selective uptake of HDL- cholesteryl esters by SR-BI [35,36]. However, it has been shown that rat and human luteal cells can utilize LDL and VLDL, respectively, for steroidogenesis [37,38]. As LSR recognizes both apoB and apoE [2], we can imagine that an interaction between apoE-containing lipoproteins and cell surface apoE would provide cholesterol to ovarian and adrenocortical cells for steroidogenesis.

distinct from the LDL receptor and the LDL receptor-related protein. Biochemistry 33, 1172–1180.

3. Mann, C.J., Khallou, J., Chevreuil, O., Troussard, A.A., Guermani, L.M., Launay, K., Delplanque, B., Yen, F.T. & Bihain, B.E. (1995) Mechanism of activation and functional significance of the lipolysis-stimulated receptor. Evidence for a role as chylomicron remnant receptor. Biochemistry 34, 10421–10431. 4. Bihain, B.E. & Yen, F.T. (1992) Free fatty acids activate a high- affinity saturable pathway for degradation of low-density lipo- proteins in fibroblasts from a subject homozygous for familial hypercholesterolemia. Biochemistry 31, 4628–4636.

5. Yen, F.T., Masson, M., Clossais-Besnard, N., Andre, P., Grosset, J.M., Bougueleret, L., Dumas, J.B., Guerassimenko, O. & Bihain, B.E. (1999) Molecular cloning of a lipolysis-stimulated remnant receptor expressed in the liver. J. Biol. Chem. 274, 13390–13398. 6. Mann, C.J., Troussard, A.A., Yen, F.T., Hannouche, N., Najib, J., Fruchart, J.C., Lotteau, V., Andre, P. & Bihain, B.E. (1997) Inhibitory effects of specific apolipoprotein C-III isoforms on the binding of triglyceride-rich lipoproteins to the lipolysis-stimulated receptor. J. Biol. Chem. 272, 31348–31354.

Our real-time PCR data show that LSR, LDLR, SR-BI and LRP messages are all very abundant in lung, i.e. in the range of liver or more. Lung surfactant is a surface tension lowering mixture of lipids and hydrophobic proteins that lines the alveolar surface and maintains alveolar patency. Its synthesis is critically dependent on the availability of fatty acids. A variety of receptors, including SR-BI [39], LDLR [40], LRP and gp330/megalin [41,42], are present on alveolar cells and are able to bind lipoproteins and to participate to surfactant synthesis. Moreover there is evidence that VLDL in the presence of lipoprotein lipase (LPL), provide the free fatty acid substrate required for surfactant synthesis [43]. LDL and HDL are also taken up by alveolar cells [40]. It is possible that LSR, along with the above-mentioned recep- tors, participates in surfactant synthesis.

7. Troussard, A.A., Khallou, J., Mann, C.J., Andre, P., Strickland, D.K., Bihain, B.E. & Yen, F.T. (1995) Inhibitory effect on the lipolysis-stimulated receptor of the 39-kDa receptor-associated protein. J. Biol. Chem. 270, 17068–17071.

8. Nehls, M., Kyewski, B., Messerle, M., Waldschutz, R., Schud- dekopf, K., Smith, A.J. & Boehm, T. (1996) Two genetically separable steps in the differentiation of thymic epithelium. Science 272, 886–889.

9. Smith, A.J., De Sousa, M.A., Kwabi-Addo, B., Heppell-Parton, A., Impey, H. & Rabbitts, P. (1995) A site-directed chromosomal translocation induced in embryonic stem cells by Cre-loxP recombination. Nat. Genet. 9, 376–385.

LSR mRNA was found to be relatively abundant in kidney (12% of liver levels). Immunohistochemistry indica- ted that LSR protein was localized in glomeruli. Glomerular cells exhibit both VLDL receptors and LDLR [44] and are known to be able to take up LDL via apoB/E receptors [45]. Moreover, several pathological disorders are accompanied by lipid deposition into glomeruli [46]. The presence of LSR in glomerular cells might provide an additional pathway for explaining lipoprotein uptake in normal and pathological glomerular cells.

10. Mansour, S.L., Thomas, K.R. & Capecchi, M.R. (1988) Disrup- tion of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336, 348–352. 11. Smith, A.G. (1991) Culture and differentiation of embryonic stem cells. J. Tiss. Cult. Meth. 13, 89–94.

12. Willnow, T.E., Goldstein, J.L., Orth, K., Brown, M.S. & Herz, J. (1992) Low density lipoprotein receptor-related protein and gp330 bind similar ligands, including plasminogen activator-inhibitor complexes and lactoferrin, an inhibitor of chylomicron remnant clearance. J. Biol. Chem. 267, 26172–26180.

The abundance of LSR in fetal and adult liver as well as in steroidogenic organs and organs such as lung or kidney adds further evidence to its hypothesized function in lipid transport in these organs. Unfortunately, the scarcity of viable LSR–/– adult mice did not allow us to obtain definitive information on the role of LSR in lipid and lipoprotein metabolism. The production of a conditional knock-out will be necessary to explore this question. Further studies are also required to understand the mech- anisms of liver involution and lethality in LSR–/– embryos and its relationship (if any) with the role of LSR as a lipoprotein receptor.

13. Choi, S.Y. & Cooper, A.D. (1993) A comparison of the roles of the low density lipoprotein (LDL) receptor and the LDL receptor- related protein/alpha 2-macroglobulin receptor in chylomicron remnant removal in the mouse in vivo. J. Biol. Chem. 268, 15804– 15811.

14. Ishibashi, S., Brown, M.S., Goldstein, J.L., Gerard, R.D., Hammer, R.E. & Herz, J. (1993) Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J. Clin. Invest. 92, 883–893. 15. Rubinsztein, D.C., Cohen,

Acknowledgements

J.C., Berger, G.M., van der Westhuyzen, D.R., Coetzee, G.A. & Gevers, W. (1990) Chylo- micron remnant clearance from the plasma is normal in familial hypercholesterolemic homozygotes with defined receptor defects. J. Clin. Invest. 86, 1306–1312. We thank Professor Marc Vasseur for stimulating discussions. Pierre Costet is acknowledged for his excellent management of the murine animal facility and Vale´ rie Le Morvan for performing Northern-blots. This research was supported by a grant from Genset SA.

References

16. Rohlmann, A., Gotthardt, M., Hammer, R.E. & Herz, J. (1998) Inducible inactivation of hepatic LRP gene by cre-mediated recombination confirms role of LRP in clearance of chylomicron remnants. J. Clin. Invest. 101, 689–695. 1. Cooper, A.D. (1997) Hepatic uptake of chylomicron remnants. J. Lipid Res. 38, 2173–2192.

17. Herz, J., Qiu, S.Q., Oesterle, A., DeSilva, H.V., Shafi, S. & Havel, R.J. (1995) Initial hepatic removal of chylomicron remnants is unaffected but endocytosis is delayed in mice lacking the low density lipoprotein receptor. Proc. Natl Acad. Sci. USA. 92, 4611–4615. 2. Yen, F.T., Mann, C.J., Guermani, L.M., Hannouche, N.F., Hubert, N., Hornick, C.A., Bordeau, V.N., Agnani, G. & Bihain, B.E. (1994) Identification of a lipolysis-stimulated receptor that is

3114 S. Mesli et al. (Eur. J. Biochem. 271)

(cid:1) FEBS 2004

phagocytosis of apoptotic rat spermatogenic cells by Sertoli cells. J. Biol. Chem. 274, 5901–5908.

18. Takahashi, S., Kawarabayasi, Y., Nakai, T., Sakai, J. & Yama- moto, T. (1992) Rabbit very low density lipoprotein receptor: a low density lipoprotein receptor-like protein with distinct ligand specificity. Proc. Natl Acad. Sci. USA. 89, 9252–9256. 19. Farese, R.V. Jr & Herz, J. (1998) Cholesterol metabolism and 34. Kawasaki, Y., Nakagawa, A., Nagaosa, K., Shiratsuchi, A. & Nakanishi, Y. (2002) Phosphatidylserine binding of class B scavenger receptor type I, a phagocytosis receptor of testicular sertoli cells. J. Biol. Chem. 277, 27559–27566. embryogenesis. Trends Genet. 14, 115–120.

35. Reaven, E., Nomoto, A., Leers-Sucheta, S., Temel, R., Williams, D.L. & Azhar, S. (1998) Expression and microvillar localization of scavenger receptor, class B, type I (a high density lipoprotein receptor) in luteinized and hormone-desensitized rat ovarian models. Endocrinology 139, 2847–2856. 20. Zaret, K. (1998) Early liver differentiation: genetic potentiation and multilevel growth control. Curr. Opin. Genet. Dev. 8, 526–531. 21. Smith, J.L., Lear, S.R. & Erickson, S.K. (1995) Developmental expression of elements of hepatic cholesterol metabolism in the rat. J. Lipid Res. 36, 641–652.

22. Hatzopoulos, A.K., Rigotti, A., Rosenberg, R.D. & Krieger, M. (1998) Temporal and spatial pattern of expression of the HDL receptor SR-BI during murine embryogenesis. J. Lipid Res. 39, 495–508. 36. Azhar, S., Tsai, L., Medicherla, S., Chandrasekher, Y., Giudice, L. & Reaven, E. (1998) Human granulosa cells use high density lipoprotein cholesterol for steroidogenesis. J. Clin. Endocrinol. Metab. 83, 983–991.

23. Jurevics, H.A., Kidwai, F.Z. & Morell, P. (1997) Sources of cholesterol during development of the rat fetus and fetal organs. J. Lipid Res. 38, 723–733.

37. Hwang, J. & Menon, K.M. (1983) Characterization of low density and high density lipoprotein receptors in the rat corpus luteum and regulation by gonadotropin. J. Biol. Chem. 258, 8020–8027. 38. Murata, M., Tamura, A., Kodama, H., Hirano, H., Takahashi, O. & Tanaka, T. (1998) Possible involvement of very low density lipoproteins in steroidogenesis in the human ovary. Mol. Hum. Reprod. 4, 797–801.

39. Kolleck, I., Witt, W., Wissel, H., Sinha, P. & Rustow, B. (2000) HDL and vitamin E in plasma and the expression of SR-BI on lung cells during rat perinatal development. Lung 178, 191–200. 24. Staels, B., Jansen, H., van Tol, A., Stahnke, G., Will, H., Verho- even, G. & Auwerx, J. (1990) Development, food intake, and ethinylestradiol influence hepatic triglyceride lipase and LDL- receptor mRNA levels in rats. J. Lipid Res. 31, 1211–1218. 25. Spijkers, J.A., van den Hoff, M.J., Hakvoort, T.B., Vermeulen, J.L., Tesink-Taekema, S. & Lamers, W.H. (2001) Fetal rise in hepatic enzymes follows decline in c-met and hepatocyte growth factor expression. J. Hepatol. 34, 699–710.

transduction and exocytosis

26. Ji, M.Y., Lee, Y.C., Kim, K.S., Cho, J.W., Jung, K.Y., Kim, C.H. & Choo, Y.K. (1999) Developmental patterns of GalBeta1,3 (4) GlcNAc alpha2,3-sialyltransferase (ST3Gal III) expression in the mouse: in situ hybridization using DIG-labeled RNA probes. Arch. Pharm. Res. 22, 243–248.

40. Voyno-Yasenetskaya, T.A., Dobbs, L.G., Erickson, S.K. & Hamilton, R.L. (1993) Low density lipoprotein- and high density lipoprotein-mediated signal in alveolar type II cells. Proc. Natl Acad. Sci. USA. 90, 4256–4260. 41. Kolleck, I., Wissel, H., Guthmann, F., Schlame, M., Sinha, P. & Rustow, B. (2002) HDL-holoparticle uptake by alveolar type II cells: effect of vitamin E status. Am. J. Respir. Cell Mol. Biol. 27, 57–63.

27. Morris, S.M. Jr, Kepka, D.M., Sweeney, W.E. Jr & Avner, ed. (1989) Abundance of mRNAs encoding urea cycle enzymes in fetal and neonatal mouse liver. Arch. Biochem. Biophys. 269, 175– 180.

42. Stefansson, S., Kounnas, M.Z., Henkin, J., Mallampalli, R.K., Chappell, D.A., Strickland, D.K. & Argraves, W.S. (1995) gp330 leading to on type II pneumocytes mediates endocytosis degradation of pro-urokinase, plasminogen activator inhibitor-1 and urokinase-plasminogen activator inhibitor-1 complex. J. Cell Sci. 108, 2361–2368. 28. Willnow, T.E., Hilpert, J., Armstrong, S.A., Rohlmann, A., Hammer, R.E., Burns, D.K. & Herz, J. (1996) Defective forebrain development in mice lacking gp330/megalin. Proc. Natl Acad. Sci. USA. 93, 8460–8464.

43. Mallampalli, R.K., Salome, R.G., Bowen, S.L. & Chappell, D.A. (1997) Very low density lipoproteins stimulate surfactant lipid synthesis in vitro. J. Clin. Invest. 99, 2020–2029.

29. Herz, J., Clouthier, D.E. & Hammer, R.E. (1992) LDL receptor- related protein internalizes and degrades uPA-PAI-1 complexes and is essential for embryo implantation. Cell 71, 411–421. 30. Acton, S., Rigotti, A., Landschulz, K.T., Xu, S., Hobbs, H.H. & Krieger, M. (1996) Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271, 518–520.

44. Quaschning, T., Koniger, M., Kramer-Guth, A., Greiber, S., Pavenstadt, H., Nauck, M., Schollmeyer, P. & Wanner, C. (1997) Receptor-mediated lipoprotein uptake by human glomerular cells: comparison with skin fibroblasts and HepG2 cells. Nephrol. Dial. Transplant. 12, 2528–2536.

31. Landschulz, K.T., Pathak, R.K., Rigotti, A., Kriegerj, M. & Hobbs, H.H. (1996) Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroido- genic tissues of the rat. J. Clin. Invest. 98, 984–995.

45. Grone, H.J., Walli, A.K., Grone, E., Kramer, A., Clemens, M.R. & Seidel, D. (1990) Receptor mediated uptake of apo B and apo E rich lipoproteins by human glomerular epithelial cells. Kidney Int. 37, 1449–1459.

32. Glass, C., Pittman, R.C., Civen, M. & Steinberg, D. (1985) Uptake of high-density lipoprotein-associated apoprotein A-I and cholesterol esters by 16 tissues of the rat in vivo and by adrenal cells and hepatocytes in vitro. J. Biol. Chem. 260, 744–750.

33. Shiratsuchi, A., Kawasaki, Y., Ikemoto, M., Arai, H. & Nakanishi, Y. (1999) Role of class B scavenger receptor type I in 46. Kramer, A., Nauck, M., Pavenstadt, H., Schwedler, S., Wieland, H., Schollmeyer, P. & Wanner, C. (1993) Receptor-mediated uptake of IDL and LDL from nephrotic patients by glomerular epithelial cells. Kidney Int. 44, 1341–1351.