intTypePromotion=1

Xác định Riemerella anatipestifer và Escherichia coli nghi ngờ gây hội chứng co giật và tiêu chảy trên vịt ở các cơ sở chăn nuôi ở Long An

Chia sẻ: Angicungduoc2 Angicungduoc2 | Ngày: | Loại File: PDF | Số trang:7

0
34
lượt xem
0
download

Xác định Riemerella anatipestifer và Escherichia coli nghi ngờ gây hội chứng co giật và tiêu chảy trên vịt ở các cơ sở chăn nuôi ở Long An

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Tại Long An và nhiều địa phương, vịt khoảng 3 đến 8 tuần tuổi thường mắc bệnh có biểu hiện tiêu chảy có hoặc không có màu xanh lá, chảy nước mắt và nước mũi, run đầu và cổ được cho là liên quan đến Riemerella anatipestifer và Escherichia coli. Nghiên cứu này được thực hiện như bước đầu tiên để tìm hiểu về nguyên nhân vi khuẩn có thể liên quan các triệu chứng bệnh kể trên. Các mẫu ngoáy hầu họng vịt khỏe và vịt có biểu hiện bệnh (70 mẫu) và 27 mẫu nước ao từ 27 trại vịt được thu thập để tìm vi khuẩn R. anatipestifer và E. coli bằng PCR. Hai quy trình PCR, 16S rDNA-PCR và gyrB-PCR, được dùng tìm R. anatipestifer, và PCR gene phoA dùng cho E. coli. Kết quả là R. anatipestifer đã được phát hiện trên cả vịt có và không có biểu hiện bệnh, và trong một số mẫu nước ao. Tuy nhiên, hai phản ứng PCR xác định R. anatipestifer cho kết quả khác nhau. Bên cạnh đó E.coli cũng phát hiện trên mẫu bệnh lẫn không bệnh và tất cả các nước ao. Các chủng này được lưu lại cho các bước tiếp theo trong việc xác định độc lực. Kết quả cho thấy tình trạng nhiễm trùng trên đàn vịt phức tạp, có vẻ còn có sự bội nhiễm nhiều vi khuẩn khác trên vịt, và chưa xác định được nguyên nhân nguyên phát.

Chủ đề:
Lưu

Nội dung Text: Xác định Riemerella anatipestifer và Escherichia coli nghi ngờ gây hội chứng co giật và tiêu chảy trên vịt ở các cơ sở chăn nuôi ở Long An

Trường Đại học Nông Lâm TP. Hồ Chí Minh 53<br /> <br /> <br /> <br /> <br /> Determination of Riemerella anatipestifer and Escherichia coli suspected to cause a<br /> syndrome including shaking head and trembling, greenish diarrhea on duck farms<br /> in Long An<br /> <br /> <br /> Hien T. Le1∗ , Quan N. Kha1 , Khuong M. Chu1 , Cuong V. Nguyen2 ,<br /> Ngoc H. Le1 , & Hoa T. K. Ho1<br /> 1<br /> Faculty of Animal Science and Veterinary Medicine, Nong Lam University, Ho Chi Minh City, Vietnam<br /> 2<br /> Long An Provincial Department of Animal Husbandry and Veterinary Medicine, Long An, Vietnam<br /> <br /> <br /> <br /> ARTICLE INFO ABSTRACT<br /> <br /> Research Paper In Long An province and other places, ducks at 3-8 weeks of age<br /> often experience a syndrome including greenish diarrhea, eye and<br /> Received: August 16, 2017 nose discharge, shaking head and trembling which is considered to<br /> Revised: October 24, 2017 be related to Riemerella anatipestifer and Escherichia coli. There is<br /> Accepted: November 10, 2017 not any research to prove this hypothesis. For that reason, this study<br /> was as the first step to explore the causes of this syndrome. In to-<br /> Keywords tal, 70 swab samples from disease and nondisease ducks and 27 pool<br /> water from 27 duck farms were collected to identify R. anatipestifer<br /> and E. coli using PCR. There were 2 PCR (16S rDNA-PCR and<br /> Diarrhea<br /> gyrB -PCR) used to detect R. anatipestifer while one PCR for gene<br /> Riemerella anatipestifer phoA was used to detect E. coli The result showed that R. anatipes-<br /> Shaking head tifer was found on both disease and non-disease ducks. However, the<br /> Trembling 2 PCRs to detect R. anatipestifer did not agree well. The fact that<br /> these bacteria were found on 22% farms (disease and non-disease<br /> ones) means it is complicated to confirm them in causing the men-<br /> ∗<br /> Corresponding author tioned disease. In addition, E. coli was also found in both types of<br /> duck and from all pool water. These isolates were kept for further<br /> Le Thanh Hien studies to identify their virulence. The result reveals that there may<br /> Email: hien.lethanh@hcmuaf.edu.vn be the cooperation between many factors in causing this disease.<br /> Cited as: Le, H. T., Kha, Q. N., Chu, K. M., Nguyen, C. V., Le, N. H., & Ho, H. T. K. (2018).<br /> Determination of Riemerella anatipestifer and Escherichia coli suspected to cause a syndrome<br /> including shaking head and trembling, greenish diarrhea on duck farms in Long An. The Journal<br /> of Agriculture and Development 17(5), 53-59.<br /> <br /> <br /> <br /> <br /> www.jad.hcmuaf.edu.vn Tạp chí Nông nghiệp và Phát triển 17(5)<br /> 54 Trường Đại học Nông Lâm TP. Hồ Chí Minh<br /> <br /> <br /> <br /> <br /> Xác định Riemerella anatipestifer và Escherichia coli nghi ngờ gây hội chứng co giật<br /> và tiêu chảy trên vịt ở các cơ sở chăn nuôi ở Long An<br /> <br /> <br /> Lê Thanh Hiền1∗ , Kha Ngọc Quân1 , Chu Minh Khương1 , Nguyễn Văn Cường2 ,<br /> Lê Hữu Ngọc1 & Hồ Thị Kim Hoa1<br /> 1<br /> Khoa Chăn Nuôi Thú Y, Trường Đại Học Nông Lâm TP. Hồ Chí Minh, TP. Hồ Chí Minh<br /> 2<br /> Chi Cục Chăn Nuôi Thú Y Long An, Long An<br /> <br /> <br /> <br /> THÔNG TIN BÀI BÁO TÓM TẮT<br /> Bài báo khoa học Tại Long An và nhiều địa phương, vịt khoảng 3 đến 8 tuần tuổi<br /> thường mắc bệnh có biểu hiện tiêu chảy có hoặc không có màu<br /> Ngày nhận: 16/08/2017 xanh lá, chảy nước mắt và nước mũi, run đầu và cổ được cho là<br /> Ngày chỉnh sửa: 24/10/2017 liên quan đến Riemerella anatipestifer và Escherichia coli. Nghiên<br /> Ngày chấp nhận: 10/11/2017 cứu này được thực hiện như bước đầu tiên để tìm hiểu về nguyên<br /> nhân vi khuẩn có thể liên quan các triệu chứng bệnh kể trên.<br /> Các mẫu ngoáy hầu họng vịt khỏe và vịt có biểu hiện bệnh (70<br /> Từ khóa mẫu) và 27 mẫu nước ao từ 27 trại vịt được thu thập để tìm vi<br /> khuẩn R. anatipestifer và E. coli bằng PCR. Hai quy trình PCR,<br /> 16S rDNA-PCR và gyrB -PCR, được dùng tìm R. anatipestifer, và<br /> Co giật<br /> PCR gene phoA dùng cho E. coli. Kết quả là R. anatipestifer đã<br /> Riemerella anatipestifer<br /> được phát hiện trên cả vịt có và không có biểu hiện bệnh, và trong<br /> Tiêu chảy một số mẫu nước ao. Tuy nhiên, hai phản ứng PCR xác định R.<br /> Vịt anatipestifer cho kết quả khác nhau. Bên cạnh đó E.coli cũng phát<br /> hiện trên mẫu bệnh lẫn không bệnh và tất cả các nước ao. Các<br /> chủng này được lưu lại cho các bước tiếp theo trong việc xác định<br /> ∗<br /> Tác giả liên hệ độc lực. Kết quả cho thấy tình trạng nhiễm trùng trên đàn vịt<br /> phức tạp, có vẻ còn có sự bội nhiễm nhiều vi khuẩn khác trên vịt,<br /> Lê Thanh Hiền và chưa xác định được nguyên nhân nguyên phát.<br /> Email: hien.lethanh@hcmuaf.edu.vn<br /> <br /> <br /> <br /> 1. Đặt Vấn Đề trong số có biểu hiện rõ là 80 – 100%; vịt không<br /> chết bị di chứng (còi, giảm năng suất thịt/trứng);<br /> Tại đồng bằng sông Cửu Long, nuôi vịt trên phòng/ trị kháng sinh không hiệu quả. Cho đến<br /> trên cạn kết hợp ao là phương thức chăn nuôi nay, nghiên cứu về nguyên nhân gây bệnh này<br /> phổ biến ở các tỉnh đồng bằng sông Cửu Long. tại Long An vẫn còn hạn chế. Với các triệu chứng<br /> Điều này dẫn đến khó khăn trong việc kiểm soát hay biểu hiện nói trên, nhiễm trùng do Duck cir-<br /> dịch bệnh. Trong nhiều năm gần đây, đàn vịt ở covirus, R. anatipestifer và E. coli được nghi vấn<br /> các trại tại Long An và các tỉnh đồng bằng sông trước tiên (Bui & ctv., 2016). Tuy nhiên, với đặc<br /> Cửu Long thường bị bệnh với các biểu hiện tiêu tính chăn nuôi vịt ở ao hồ như ở đồng bằng sông<br /> chảy có hoặc không có màu xanh lá, chảy nước Cửu Long, không loại trừ có sự nhiễm trùng ghép<br /> mắt và nước mũi, run đầu và cổ. Trong nhiều của các vi sinh vật gây bệnh trên các hệ cơ quan<br /> trường hợp, vịt bệnh có biểu hiện triệu chứng khác nhau. Mục tiêu của nghiên cứu là kiểm tra<br /> thần kinh, dễ lật ngửa, 2 chân đạp mái chèo. Một sự hiện diện của R. anatipestifer và E. coli trong<br /> số đặc điểm về bệnh có thể kể đến gồm: bệnh thể mẫu ngoáy hầu họng và nước ao ở các trại vịt có<br /> hiện trên cả vả vịt thịt và vịt đẻ; thời điểm biểu hay không có bệnh ở Long An bằng kỹ thuật PCR<br /> hiện khoảng 35-50 ngày (5-8 tuần) tuổi và hậu bị để xem chúng có thể hiện diện trên các trường hợp<br /> (qua thời điểm này, rất ít biểu hiện bệnh); gần biểu hiện hội chứng co giật và tiêu chảy (trong<br /> như 100% đàn vịt có bệnh; khoảng 20% số vịt đó co giật bao gồm đầu – cổ, chân, hay có thể lật<br /> trong đàn có các triệu chứng kể trên; tỉ lệ chết ngửa chân đạp mái chèo; tiêu chảy có thể có phân<br /> <br /> <br /> Tạp chí Nông nghiệp và Phát triển 17(5) www.jad.hcmuaf.edu.vn<br /> Trường Đại học Nông Lâm TP. Hồ Chí Minh 55<br /> <br /> <br /> <br /> xanh) ở các cơ sở chăn nuôi vịt tại Long An. trình PCR trên gene alkaline phosphate (phoA)<br /> đặc hiệu cho E. coli được thực hiện đối với các<br /> 2. Vật Liệu và Phương Pháp Nghiên Cứu các mẫu canh tăng sinh của các mẫu ngoáy hầu<br /> họng và nước ao.<br /> 2.1. Mẫu và phương pháp thu thập mẫu Trình tự nucleotide của các mồi PCR được<br /> trình bày trong Bảng 1. GoTaq@Green Master<br /> Các mẫu được thu thập từ 27 trại nuôi vịt gia Mix (Promega, M1123) được sử dụng cho tất<br /> đình ở ba huyện: Cần Đước, Cần Giuộc, Tân Trụ cả các phản ứng PCR. Chu trình nhiệt của ba<br /> - tại tỉnh Long An (Tân Trụ - 6 trại; Cần Giuộc PCR như sau: tiền biến tính 940 C/5 phút; 35<br /> – 11 trại; Cần Đước - 10 trại). Tại thời điểm lấy chu kỳ gồm biến tính ở 940 C/1 phút, bắt cặp ở<br /> mẫu, vịt ở những trại đó có độ tuổi từ khoảng 3 550 C/1phút, và kéo dài ở 720 C/60 giây; và kéo<br /> đến 8 tuần tuổi. Đàn vịt lúc đó có thể có hoặc dài cuối cùng ở 720 C/10 phút. Điện di các sản<br /> không có biểu hiện lâm sàng của bệnh. Tại mỗi phẩm PCR bằng gel agarose 0,8% có chứa ethid-<br /> trại, 2 hay 3 mẫu tăm-bông ngoáy dịch hầu họng ium bromide, và kiểm tra DNA trên gel dưới đèn<br /> được lấy từ các vịt có hay không có biểu hiện UV.<br /> bệnh. Mẫu tăm bông được bảo quản trong ống<br /> nghiệm chứa 2 mL Tryptone soya broth (TSB; 2.3. Xử lý số liệu<br /> Himedia, M011-500G). Một mẫu nước ao vịt ở<br /> mỗi trại cũng được thu thập. Mẫu nước được chứa Kết quả tỉ lệ dương tính trên các nhóm mẫu<br /> trong bình 500 mL sạch. Tất cả các mẫu được bảo cho từng vi khuẩn được tính. Chỉ số chênh OR<br /> quản trong thùng đá duy trì nhiệt độ 2-80 C và vận được đánh giá mối liên hệ giữa bệnh và sự hiện<br /> chuyển về phòng thí nghiệm để xét nghiệm trong diện của vi khuẩn. Đối với hai phương pháp PCR<br /> vòng < 5 giờ. Tổng cộng có 70 mẫu dịch ngoáy dùng để xác định R. anatipestifer, chỉ số kappa<br /> hầu họng (54 mẫu từ vịt khỏe mạnh và 16 mẫu được dùng để đánh giá mức tương đồng của hai<br /> từ vịt có các dấu hiệu bệnh), và 27 mẫu nước ao xét nghiệm về mặt thống kê (Trần Thị Dân và<br /> được thu thập. Ngay khi được vận chuyển đến Lê Thanh Hiền, 2007) bằng phần mềm MS Excel<br /> phòng thí nghiệm, 1 mL mẫu nước ao được cho 2013.<br /> vào ống nghiệm chứa 5 mL canh TSB. Các ống<br /> canh chứa tăm bông ngoáy hầu họng và nước ao 3. Kết Quả và Thảo Luận<br /> được ủ trong vòng 48 giờ ở 370 C trong bình đèn<br /> cầy (candle jar). Mẫu đã tăng sinh được ly trích 3.1. Sự thống nhất kết quả phát hiện R.<br /> DNA để dùng cho các phản ứng PCR. anatipestifer của hai quy trình PCR<br /> <br /> 2.2. Kiểm tra sự lưu hành R. anatipestifer và Trong 27 trại khảo sát, 8 trại có 20% vịt có<br /> E.coli trong trại bằng các quy trình PCR các biểu hiện bệnh và 19 trại vịt bình thường.<br /> Tổng cộng mẫu bao gồm: 27 mẫu nước hồ được<br /> Việc phân lập và định danh vi khuẩn R. thu thập (mỗi trại một mẫu); 70 mẫu ngoáy hầu<br /> anatipestifer theo các phương pháp truyền thống họng, trong đó 16 mẫu được lấy từ vịt có các biểu<br /> được nhận định là khá khó khăn (Kardos & ctv., hiện của bệnh và 54 mẫu được lấy từ vịt khỏe<br /> 2007), đồng thời hiện nay chưa có một quy trình mạnh. Kết quả xét nghiệm các mẫu này bằng hai<br /> PCR chẩn đoán R. anatipestifer được công bố quy trình PCR phát hiện R. anatipestifer không<br /> nào có tính đặc hiệu cao (Christensen, 2013). Với giống nhau (Bảng 2). Phương pháp gyrB -PCR<br /> mong muốn xác định sự hiện diện của vi khuẩn cho kết quả dương tính với 24 mẫu ngoáy hầu<br /> này trong các đàn vịt nuôi ở Long An, ngoài cố họng (8 mẫu từ vịt bệnh và 16 mẫu từ vịt khỏe),<br /> gắng phân lập vi khuẩn từ vịt bệnh, hai quy trình và một mẫu nước ao. Trong khi đó, 16S rDNA-<br /> PCR khác nhau được sử dụng để phát hiện R. PCR cho kết quả 18 mẫu dương tính (5 mẫu từ<br /> anatipestifer trong các mẫu canh tăng sinh của vịt bệnh, 10 mẫu từ vịt khỏe) và 3 mẫu nước ao.<br /> các mẫu ngoáy hầu họng và nước ao tại các trại Chỉ có 9 mẫu ngoáy hầu họng cùng dương tính<br /> vịt. Một quy trình PCR có mục tiêu là gene gyrB với cả hai PCR. Chỉ số kappa = 0,275 (95% độ<br /> (Wang & ctv., 2012), và một quy trình PCR gene tin cậy từ 0,055 đến 0,494), mức tương đồng dạng<br /> 16S rDNA do Qu & ctv. thiết kế và được sử dụng “vừa”.<br /> bởi Wei & ctv. (2013). Ngoài ra, để khảo sát<br /> Chẩn đoán R. anatipestifer khá khó khăn vì<br /> khả năng hiện diện E. coli ở các trại, một quy<br /> dựa vào triệu chứng lâm sàng có thể nhầm lẫn<br /> <br /> <br /> www.jad.hcmuaf.edu.vn Tạp chí Nông nghiệp và Phát triển 17(5)<br /> Trường Đại học Nông Lâm TP. Hồ Chí Minh<br /> <br /> <br /> <br /> <br /> www.jad.hcmuaf.edu.vn<br /> Bảng 2. So sánh kết quả hai phản ứng PCR để phát hiện R. anatipestifer<br /> Mẫu ngoáy hầu họng Mẫu nước hồ của trại<br /> Mẫu Tổng<br /> Vịt có dấu hiệu Vịt không có dấu hiệu Trại có dấu hiệu Trại không có dấu hiệu<br /> lâm sàng lâm sàng lâm sàng lâm sàng<br /> Tổng 16 54 70 8 19<br /> Dương tính 8 16 24 0 1<br /> (GyrB -PCR) (50,0%) (29,6%) (34,3%) (0%) (5,2%)<br /> Dương tính 5 10 15 3 0<br /> (16S rDNA-PCR) (31,3%) (18,5%) (21,4%) (37,5%) (0%)<br /> Bảng 1. PCR và các đoạn mồi dùng xác định sự hiện diện của R. anatipestifer và E. coli trong nghiên cứu này1<br /> <br /> <br /> <br /> <br /> Tạp chí Nông nghiệp và Phát triển 17(5)<br /> PCR và gene mục tiêu Mồi Trình tự của mồi (50 - 30 ) Kích thước sản phẩm (bp)<br /> gyrBP1 AGAGCGAGAAGAAAAAACCT 194<br /> R. anatipestifer, gene gyrB<br /> gyrBP2 CTCCCATAAGCATAGAGAAGA<br /> 190F GTATTGAAAGCTCTGGCGG 654<br /> R. anatipestifer, gene 16S rDNA<br /> 843R TCGCTTAGTCTCTGAACCC<br /> Pho-F GTGACAAAAGCCCGGACACCAGAAATGCCT 903<br /> E. coli gene phoA<br /> Pho-R TACACTGTCATTACGTTGCGGATTTGGCGT<br /> 1<br /> M = C:A, Y = C:T; all 1:1<br /> 56<br /> Trường Đại học Nông Lâm TP. Hồ Chí Minh 57<br /> <br /> <br /> <br /> với các bệnh khác có các bệnh tích tương tự, ví Nếu coi như một trong hai PCR dương tính một<br /> dụ như colibacillosis, salmonellosis, và chlamydio- mẫu thì trại có sự hiện diện của R. anatipestifer<br /> sis (Christensen, 2013; Glisson & ctv., 2013). Sự thì chỉ số OR = 2,18 (0,28 - 26,89), điều này cho<br /> phát triển chậm của R. anatipestifer và/hoặc sự thấy hiện diện vi khuẩn R. anatipestifer có liên<br /> đồng nhiễm với các vi khuẩn khác ở thủy cầm có quan đến bệnh nhưng không có ý nghĩa thống kê<br /> thể là nguyên nhân làm phân lập R. anatipestifer (P = 0,349).<br /> bị thất bại. Bên cạnh đó, xác định các đặc điểm Vi khuẩn R. anatipestifer cũng được tìm thấy<br /> kiểu hình của R. anatipestifer thường cho kết quả trong mẫu nước ao. Vi khuẩn được phát hiện<br /> trái nhau (Christensen & Bisgaard, 2010), do đó trong một mẫu nước với gyrB -PCR và trong 3<br /> phương pháp phân lập, định danh không được ưu mẫu với 16S rDNA-PCR. Điều này cho thấy rằng<br /> tiên. Vì vậy, nhiều nhà khoa học đã phát triển các nước hồ là môi trường quan trọng trong việc lây<br /> quy trình PCR trên những gene mục tiêu khác lan R. anatipestifer và các mầm bệnh khác giữa<br /> nhau nhằm phát hiện vi khuẩn này. Tuy nhiên, các thủy cầm trong đàn và các đàn khác trong<br /> các kết quả dương tính giả của nhiều quy trình khu vực xung quanh.<br /> đã được đề cập (Christensen & Bisgaard, 2010;<br /> Tỉ lệ phát hiện R. anatipestifer ở vịt tại ba<br /> Wang & ctv., 2012; Rubbenstroth & ctv., 2013).<br /> huyện khảo sát được trình bày trong Bảng 4. Tại<br /> Hơn thế nữa, PCR đi kèm với enzyme cắt giới<br /> 6 trại ở Tân Trụ, không phát hiện vi khuẩn từ các<br /> hạn để xác định tính đặc hiệu hơn cho vi khuẩn<br /> mẫu ngoáy họng, nhưng có một mẫu nước dương<br /> cũng dường như không khả quan (Rubbenstroth<br /> & ctv., 2013). tính với gyrB -PCR. Ở hai huyện Cần Giuộc và<br /> Cần Đước, vi khuẩn được tìm thấy từ vịt và nước<br /> Do đó, với mong muốn có được kết quả có mức<br /> ao. Ba huyện này đều nằm ở vùng thấp và tập<br /> tin cậy cao trong việc xác định hiện diện của R.<br /> trung nhiều vịt. Năm 2015, số lượng trại nuôi vịt<br /> anatipestifer trong các trại, 2 quy trình PCR với<br /> ở Tân Trụ, Cần Giuộc, Cần Đước theo thứ tự là<br /> các gene mục tiêu được sử dụng. Kết quả cho<br /> 259, 128 và 217 trại, với số lượng vịt là 473.128;<br /> thấy tỉ lệ phát hiện R. anatipestifer của gyrB -<br /> 119.222 và 11.4871 vịt (Chi cục thú y tỉnh Long<br /> PCR cao hơn 16S rDNA-PCR. Tuy nhiên, ở giai<br /> An, 2015, số liệu thu thập qua giao tiếp cá nhân).<br /> đoạn nghiên cứu, chưa thể so sánh mức độ tin<br /> cậy của mỗi phản ứng về sự hiện diện của R. 3.2. Phát hiện E. coli trong mẫu ngoáy hầu<br /> anatipestifer trong các trại vịt. Mặc dù vậy, có 9 họng và nước ao<br /> mẫu ngoáy hầu họng cho kết quả dương tính với<br /> cả hai PCR, điều này xác nhận có sự lưu hành Colibacillosis gây ra bởi E. coli là bệnh được<br /> của vi khuẩn trong các trại vịt. báo cáo phổ biến nhất gây ra thiệt hại kinh tế<br /> Để tiện hơn cho việc đánh giá và thảo luận, kết nghiêm trọng trong sản xuất gia cầm (Nolan &<br /> quả của các trại dương tính với R. anatipestifer ctv., 2013). Để kiểm tra sự hiện diện của E. coli,<br /> được trình bày trong Bảng 3 theo hai cách: trại canh tăng sinh của các mẫu ngoáy họng vịt và<br /> được xem là dương tính với R. anatipestifer khi nước ao được phân tích bằng quy trình PCR trên<br /> có ít nhất một mẫu (mẫu ngoáy hầu họng hoặc gene mã hóa cho alkaline phosphate ở E. coli (Wei<br /> mẫu nước) dương tính với một trong hai PCR, & ctv., 2013). Một sản phẩm PCR được giải trình<br /> hoặc dương tính với cả hai PCR. tự nucleotide và xác nhận tính đặc hiệu bằng<br /> Trại nhiễm R. anatipestifer được phát hiện BLAST. E. coli được phát hiện từ 64 trong số<br /> bằng gyrB -PCR (51,9%) cao hơn 16S rDNA- 70 mẫu ngoáy hầu họng (91,4%). Vi khuẩn được<br /> PCR (37%) (Bảng 3). Kết quả này tương tự với phát hiện từ tất cả 27 mẫu nước ao. Do kinh<br /> kết quả trình bày trong Bảng 2, tỉ lệ gyrB -PCR phí giới hạn, nghiên cứu dừng lại ở giai đoạn tìm<br /> phát hiện vi khuẩn từ mẫu ngoáy họng là 34,3% hiểu sự hiện diện của E. coli trên niêm mạc hầu<br /> (24 trong 70 mẫu) trong khi của 16S rDNA-PCR họng và trong nước ao. Tuy nhiên, các mẫu canh<br /> phát hiện vi khuẩn từ 21,4% mẫu (15 trong 70 tăng sinh và gốc vi khuẩn phân lập trên EMB<br /> 0<br /> mẫu). Nếu kết hợp kết quả của hai PCR, vi khuẩn được giữ lại (trong glycerin, ở -20 C) để sau này<br /> được tìm thấy ở 6 trong số 27 trại (22,2%), trong có thể nghiên cứu các dạng độc lực và xác định<br /> đó có 2 (trong số 8) trại có vịt biểu hiện các triệu chủng.<br /> chứng bệnh và 4 trong số 19 trại không có biểu<br /> hiện bệnh. Kết quả xác định có sự lưu hành của vi<br /> khuẩn trong đàn vịt không thấy biểu hiện bệnh.<br /> <br /> <br /> www.jad.hcmuaf.edu.vn Tạp chí Nông nghiệp và Phát triển 17(5)<br /> Trường Đại học Nông Lâm TP. Hồ Chí Minh<br /> <br /> <br /> <br /> <br /> www.jad.hcmuaf.edu.vn<br /> Bảng 4. Tỉ lệ phát hiện R. anatipestifer tại 3 huyện bằng các quy trình PCR<br /> Mẫu ngoáy hầu họng (70) Số trại (27) Mẫu nước ao của trại (27)<br /> Huyện (số trại)<br /> Dương tính Dương tính Dương tính Dương tính Số mẫu<br /> Số mẫu với một PCR với cả hai PCR Số trại với một PCR với cả hai PCR dương tính<br /> 1 1 (gyrB -PCR)<br /> Tân Trụ (6) 12 0 0 6 (16,6%) 0 (16,7%)<br /> 15 2 9 2 0<br /> Cần Giuộc (11) 26 (57,7%) (7.7%) 11 (81,8%) (18.2%)<br /> 14 7 7 4 3 (16S rDNA-PCR)<br /> Cần Đước (10) 32 (43,8%) (21.8%) 10 (70,0%) (40%) (30,0%)<br /> Bảng 3. Phát hiện R. anatipestifer tại 27 trại vịt ở Long An bằng các quy trình PCR<br /> Số trại Nước ao của trại<br /> Tổng<br /> Có vịt Không có vịt Có vịt Không có vịt<br /> <br /> <br /> <br /> <br /> Tạp chí Nông nghiệp và Phát triển 17(5)<br /> biểu hiện bệnh biểu hiện bệnh biểu hiện bệnh biểu hiện bệnh<br /> Số trại 8 19 8 19 27<br /> 4 10 0 1 14<br /> Có mẫu dương tính với gyrB -PCR (50%) (52,6%) (5,3%) (51,9%)<br /> 4 6 3 0 10<br /> Có mẫu dương tính với 16S rDNA-PCR (50%) (31.6%) (37.5%) (37,0%)<br /> 6 11 3 1 17<br /> Có mẫu dương tính với một PCR (75%) (57,9%) (37,5%) (5,3%) (63,0%)<br /> 2 4 0 0 6<br /> Có ít nhất một mẫu dương tính với cả hai RA PCRs (25%) (21,1%) (22,2%)<br /> 58<br /> Trường Đại học Nông Lâm TP. Hồ Chí Minh 59<br /> <br /> <br /> <br /> 4. Kết Luận Glisson, J. R., Charles, L. H., & Jens, P. C. (2013). Fowl<br /> Cholera. In Swayne, D. E., Glisson, J. R., McDougald,<br /> L. R., Nolan, L. K., Suarez, D. L., & Nair, V. L. (Eds).<br /> Nghiên cứu này là bước đầu trong nổ lực tìm Diseases of Poultry (13rd ed., 807-823). New Jersey,<br /> ra nguyên nhân gây bệnh phổ biến trên vịt ở các USA: Wiley-Blackwell.<br /> trại với đặc điểm co giật kết hợp tiêu chảy. Vi<br /> Kardos, G., Nagy, J., Antal, M., Bistyák, A., Tenk, M.,<br /> khuẩn R. anatipestifer được phát hiện đang lưu<br /> & Kiss, I. (2007). Development of a novel PCR assay<br /> hành trong các đàn vịt bệnh nhiều hơn. Có thể specific for Riemerella anatipestifer. Letters in Applied<br /> do khó khăn trong chẩn đoán, cũng như số lượng Microbiology 44(2), 145-148.<br /> mẫu hạn chế, chưa thấy rõ mối liên quan của vi<br /> Nolan, L. K., John, H. B., Jean-Pierre, V., Tahseen, A.,<br /> khuẩn này với bệnh. Ngoài ra, với cách nuôi vịt & Catherine, M. L. (2013). Colibacillosis. In Swayne,<br /> hiện nay ở các trại, việc kiểm soát vệ sinh và an D. E., Glisson, J. R., McDougald, L. R., Nolan, L.<br /> toàn sinh học trong môi trường chăn nuôi đặc K., Suarez, D. L., & Nair, V. L. (Eds). Diseases of<br /> Poultry (13nd ed., 751-805). New Jersey, USA: Wiley-<br /> biệt là ao nuôi là rất khó khăn. Từ đó, khả năng<br /> Blackwell.<br /> bội nhiễm các mầm bệnh khác nhau trong đàn<br /> vịt là điều khó tránh khỏi, làm khó khăn trong Rubbenstroth, D., Ryll, M., Knobloch, J. K. M., Kohler,<br /> việc xác định nguyên nhân nhiễm trùng là nguyên B., & Rautenschlein, S. (2013). Evaluation of different<br /> diagnostic tools for the detection and identification of<br /> phát hay thứ phát. Riemerella anatipestifer. Avian Pathology 42(1), 17-<br /> 26.<br /> Tài Liệu Tham Khảo (References)<br /> Wang, X. P., Zhu, D. K., Wang, M. S., Cheng, A. C.,<br /> Jia, R. Y., Chen, S., Chen, X. Y., & Tang, T. (2012).<br /> Bui, D. H., Do, D. T., Nguyen, T. T., Nguyen, N. T. T., Development and application of specific polymerase<br /> Le, H. T., & Nguyen, N. T. P. (2016). Determination chain reaction assay targeting the gyrB gene for rapid<br /> of duck circovirus (DuCV) and Riemerella anatipes- detection of Riemerella anatipestifer. Poultry Science<br /> tifer (RA) in several cases of septicemia disease from 91(10), 2450-2453.<br /> duck flocks by PCR technique. Journal of Veterinary<br /> Science and Technology 6, 14-21. Wei, B., Cha, S. Y., Kang, M., Park, I. J., Moon, O. K.,<br /> Park, C. K., & Jang, H. K. (2013). Development and<br /> Christensen, H., & Bisgaard, M. (2010). Phylogenetic re- application of a multiplex PCR assay for rapid detec-<br /> lationships of Riemerella anatipestifer serovars and re- tion of 4 major bacterial pathogens in ducks. Poultry<br /> lated taxa and an evaluation of specific PCR tests re- Science 92(5), 1164-1170.<br /> ported for R. anatipestifer. Journal of Applied Micro-<br /> biology 108(5), 1612-1089.<br /> <br /> Christensen, J. P. (2013). Overview of Riemerella<br /> anatipestifer infection in poultry. Veteri-<br /> nary manual. Retrieved July 12, 2013, from<br /> https://www.msdvetmanual.com/poultry/riemerella-<br /> anatipestifer-infection/overview-of-riemerella-<br /> anatipestifer-infection-in-poultry.<br /> <br /> <br /> <br /> <br /> www.jad.hcmuaf.edu.vn Tạp chí Nông nghiệp và Phát triển 17(5)<br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2