Bovine tryptases
cDNA cloning, tissue specific expression and characterization of the lung isoform
Alessandra Gambacurta
1
*, Laura Fiorucci
1
*, Paolo Basili
1
, Fulvio Erba
1
, Angela Amoresano
2
and Franca Ascoli
1
1
Department of Experimental Medicine and Biochemical Sciences, University of Rome ‘Tor Vergata’, Rome;
2
Department of Organic Chemistry and Biochemistry, University of Naples ‘Federico II’, Naples, Italy
A complementary DNA encoding a new bovine tryptase
isoform (here named BLT) was cloned and sequenced
from lung tissue. Analysis of sequence indicates the pres-
ence of a 26-amino acid prepro-sequence and a 245 amino
acid catalytic domain. It contains six different residues
when compared with the previously characterized tryptase
from bovine liver capsule (BLCT), with the most signifi-
cant difference residing at the primary specificity S1
pocket. In BLT, the canonical residues Asp-Ser are pres-
ent at positions 188–189, while in BLCT these positions
are occupied by residues Asn-Phe. This finding was con-
firmed by mass fingerprinting of the peptide mixture
obtained upon in-gel tryptic digestion of BLT. Analysis by
gel filtration of the purified protein shows that BLT is
probably tetrameric, similar to the previously identified
tryptases from other species, with monomer migrating as
35–40 kDa multiple bands in SDS/PAGE. As expected,
the catalytic abilities of the two bovine tryptases are dif-
ferent. The specificity constant values (k
cat
/K
m
) assayed
with model substrates are 10- to 60-fold higher in the case
of BLT. The tissue-specific expression of the two tryptases
was evaluated at the RNA level by analysis of their dif-
ferent restriction patterns. In lung, only BLT was found to
be expressed, while in liver capsule only BLCT is present.
Both isoforms are distributed in similar amounts in heart
and spleen. Analysis of the two gene sequences reveals the
presence of several recognition sequences in the promoter
regions and suggest a role for hormones in governing the
mechanism of tissue expression of bovine tryptases.
Keywords: bovine tryptases; aprotinin; tissue expression;
promoter sequences; mass spectrometry.
Tryptases are trypsin-like proteinases stored in the secretory
granules of human [1–3], dog [4,5], rat [6–8], mouse [9,10],
bovine [11], gerbil [12] and sheep [13] mast cells. These
enzymes are released along with other mediators into the
extracellular medium upon mast cell activation/degranula-
tion. Although their patho-physiological role is not yet
understood, tryptases seem to be involved in several mast
cell-mediated allergic and inflammatory diseases. However,
the underlying molecular mechanism, as well as the
proenzyme/polypeptide target(s) of these enzymes have
not been identified yet, in spite of their involvement in a
variety of biochemical reactions in vitro [14–18]. Recently it
was shown that human tryptase activates by proteolytic
cleavage the proteinase-activated receptor 2, inducing
widespread inflammation by an unknown mechanism and
possibly contributing to the proinflammatory effects of mast
cells in human diseases [19].
Almost all tryptases are made of glycosylated 245 residue
identical subunits, which share many characteristics with the
prototype enzyme trypsin (225 residues), in terms of
sequence (identity around 45%) and overall folding. How-
ever, two main features are peculiar to tryptases. One
feature is the tetrameric structure of most tryptases studied
so far, which is necessary for biological activity and is
maintained in vivo through association with heparin; in
many cases this glycosaminoglycan is required for stabi-
lization of the enzyme after its release from mast cells [20,21].
In the 3 A
˚crystal structure of the tetrameric bII human
enzyme (molecular mass 120–140 kDa), the active site of
each monomer faces a central oval pore, whose dimension
limits the accessibility for macromolecular substrates/inhi-
bitors [22]. A second common feature of tryptases seems to
be their occurrence as a multigene family: in humans, at
least four homologous tryptase cDNAs (tryptases aand
bI–III) have been isolated [23–25] and a gene cluster was
Correspondence to Franca Ascoli, Department of Experimental
Medicine and Biochemical Sciences, University of Rome
Tor Vergata, Via Montpellier 1, 00133 Rome, Italy.
Fax: + 39 06 72596477; Tel.: + 39 06 72596474;
E-mail: ascoli@uniroma2.it
Abbreviations: BLCT, bovine liver capsule tryptase; BLT, bovine lung
tryptase; Boc, t-butyloxycarbonyl; BPTI, bovine pancreatic trypsin
inhibitor; DFP, diisopropylfluoro-phosphate; MCA, methyl-
coumarin; MUGB, 4-methylumbelliferyl p-guanidinobenzoate;
STI, soybean trypsin inhibitor; Z, benzyloxycarbonyl.
Dedication: This paper is dedicated to the memory of Eraldo Antonini,
eminent biochemist, prematurely deceased twenty years ago,
on March 19th 1983.
Note: nucleotide sequence data are available in the GenBank database
with the accession numbers AF515641 (full-length bovine lung
tryptase cDNA), X94982 (full-length bovine liver capsule tryptase
cDNA), AF515642 (bovine lung tryptase promoter) and AF516175
(bovine liver capsule tryptase promoter).
*These authors contributed equally to this work.
(Received 8 October 2002, revised 20 November 2002,
accepted 29 November 2002)
Eur. J. Biochem. 270, 507–517 (2003) FEBS 2003 doi:10.1046/j.1432-1033.2003.03406.x
identified for multiple human tryptases [26]; two tryptases
(mMCP-6 and mMCP-7) have been identified in mouse
[9,10], and their genes isolated [27,28].
In a previous paper [11], we reported isolation of a tryptase
isoform (BLCT) from bovine liver connective capsule
(Glisson capsule). This enzyme is made of 245 amino acid
(aa) subunits; its sequence was determined either biochemi-
cally on the purified protein or by isolating and sequencing its
cDNA [29]. The most peculiar and important difference
between BLCT and other tryptases analyzed so far occurs at
positions 188–189 of the primary specificity pocket S1, where
the basic side chain of the substrate P1 residue, Arg or Lys
(whose carbonyl group belongs to the scissile peptide bond of
the substrate), is accommodated. In BLCT, residues Asn188
and Phe189 replace the canonical residues Asp and Ser,
respectively, present in all other tryptases and in all trypsin-
like enzymes. However, these substitutions do not affect
significantly the substrate specificity of the bovine enzyme.
In this paper, we report cloning of a new cDNA from
bovine lung encoding a tryptase isoform (BLT) with the
usual doublet Asp-Ser in the S1 specificity pocket and
isolation of the corresponding protein. Sequence analysis by
mass spectrometry and partial characterization of BLT
revealed more similarities between this enzyme and b-type
tryptases from other species with respect to BLCT. Some
evidence on tissue-specific expression of the two isoforms in
different bovine tissues is also reported and in this light the
different sequence of the two tryptase gene promoter
regions are discussed.
Experimental procedures
Oligonucleotide primers and restriction enzymes
PCR primers were obtained from MWG Biotech (Italy),
Genset (France) or Pharmacia (Italy). Their numbering
refers to the first nucleotide (+1) of cDNA start codon.
Restriction enzymes were obtained from New England
Biolabs (USA).
Amplification reaction (PCR), cloning and sequence
analysis
Unless otherwise indicated, PCRs were conducted using
5U of Taq polymerase (Perkin Elmer, USA), 200 m
M
dNTPs, 1.5 m
M
MgCl
2
,10m
M
Tris/HCl, pH 8.3, 50 m
M
KCl (50 lL final volume).All PCR products were size-
fractionated by agarose gel electrophoresis and the bands
eluted, purified and subcloned in the PCRIITM TOPO
vector containing the lac promoter and the b-galactosidase
gene, using the TA Cloning Kit (Invitrogen, USA).
Transformation was performed in the TOP 10 cells, the
positive clones were isolated and their nucleotide sequence
determined. Sequence analysis was performed on both
strands by the dideoxy-chain termination method, either
using the Sequenase 2.0 Kit (Amersham Pharmacia Biotech
Italia) or automatically.
cDNA synthesis
mRNA was prepared from various bovine tissues using the
Fast Track kit (Invitrogen, USA). The first strand cDNA
was synthesized at 42 C using 0.1–1 lgofmRNAwiththe
cDNA cycle kit (Invitrogen). To obtain partial cDNAs
encoding tryptases (see Results) PCRs were performed as
already described [29], using 2 lL of the RT reaction
products and the primer pair N9 (nt 127–153, 5¢-AGC
CTGAGAGTCAGCCGTCGGTACTGG-3¢)andN10
(nt 790–816 antisense, 5¢-TCAGGGCCCCTGGGGGAC
GTACTGGTG-3¢). Entire tryptase cDNAs were obtained
under the same conditions, at the annealing temperature of
58 C, using the primer pair Met (nt 1–20, 5¢-ATG
CTCCATCTGCTGGCGCT-3¢, designed on the basis of
the 5¢RACE experiments reported below) and Coda
[5¢-CGCGCGCG(T)
16
)3¢] [29] and sequenced.
5¢Rapid amplification of cDNA ends (RACE)
5¢RACE was carried out to determine the 5¢nucleotide
sequence of the tryptase full-length transcripts, using the
RACE System from Gibco (Paisley, USA). One hundred
nanograms of bovine lung and hepatic capsule mRNAs
were reverse transcribed using oligo-dT as primer. After
purification of the first strand cDNA, a dC tail was added to
the 3¢end using dCTP and terminal transferase. PCRs
were conducted on 5 lLofthetailing reaction,usingthe
5¢RACE abridged universal amplification primer
AUAP with a 3¢-G tail (5¢-GGCCACGCGTCGACTAG
TACGGGGGGGGGGGGGG-3¢)as5¢primer and C1
(nt 537–563 antisense, 5¢-TACTTCCTGTCACAGACAC
TGTTCTCC-3¢)as3¢primer. Nested PCRs were then
performed using the same 5¢primer and C2 (nt 372–
396 antisense, 5¢-GTGCCAGGAGATATTCACAAGCT
TG-3¢)as3¢primer. Amplification reactions were con-
ducted using 40 pmol of each primer, under the following
conditions: 2 min at 94 C (1 cycle), 1 min at 94 C, 1 min
at 58 C, 1 min at 72 C (30 cycles) and 10 min at 72 C
(1 cycle).
Evaluation of tissue distribution of bovine tryptases
In order to ascertain the expression of one or both tryptase
isoforms (see Results) in different bovine tissues, tryptase
cDNAs were prepared as described above from mRNAs
isolated from bovine liver capsule, lung, heart and spleen.
The amplification profile was optimized as follows: 1 min at
94 C (1 cycle), 1 min at 94 C, 1 min at 58 C, 2 min at
72 C (30–40 cycles) and 10 min at 72 C(1cycle).The
RT-PCR products were separated by electrophoresis
through a 1.5% (w/v) agarose gel, eluted, cloned in a TA
vector and transformed in the TOP 10 competent cells. The
positive clones were identified by restriction analysis with
NspI (overnight at 37 C) and sequenced.
Identification of 5¢flanking sequences and UTRs
of bovine tryptase genes
A strategy similar to that described in the protocol of the
Universal Genome Walker Kit (CLONTECH, USA) was
employed to identify 5¢flanking sequences and UTRs of
the tryptase genes.
Genomic DNA was obtained from bovine liver using the
DNA TURBOGEN Kit (Invitrogen, USA) at a final
concentration of 100 ngÆlL
)1
and the molecular weight was
508 A. Gambacurta et al. (Eur. J. Biochem. 270)FEBS 2003
checked by 0.8% (w/v) agarose gel electrophoresis. Genomic
DNA(500ng)wasthendigestedwith10Uofthe
restriction enzymes HincII, EcoRV, MscI, SspI, in four
separate reactions. Each digested sample was ligated with
the annealed adaptor oligonucleotides A1 (5¢-GTAATAC
GACTCACTATAGGGCACGCGTGGTCGAC-3¢)and
A2 (5¢-GTCGACCACGCGTGC-3¢, complementary to
15 nt of the A1 3¢region).
Amplification reactions were then conducted for each
digested and ligated genomic DNA sample (10 lL), using
20 pmoles of each primer (see below) and 5 U of the
Elongase enzyme mix(Gibco) in 60 m
M
Tris sulfate pH 9.1,
18 m
M
ammonium sulfate, 1 m
M
magnesium sulfate and
1.5 m
M
magnesium chloride, in a final reaction volume of
50 lL. The conditions used were: 1 min at 94 C(1cycle),
1minat94C, 1 min at 55 C(5¢region) or at 52 C(3¢
region), 4 min at 68 C (32 cycles) and 5 min at 68 C(1
cycle). Two microliters of each PCR was then used as a
template in a nested PCR under the same conditions. The
following oligonucleotides were used as primers: AP1 (5¢-
GTAATACGACTCACTATAGGGC-3¢, identical to 22 nt
of the A1 5¢region); AP2 (5¢-ACTATAGG GCACGCGTG
GT-3¢, identical to 12 internal nt of A1); C3 (nt 41–61
antisense, 5¢-CCTGGCCAGGGGCTGCG GAGA-3¢); C4
(nt 34–54 antisense, 5¢-AGGGGCTGCGGAGACCAGG
CT-3¢). The primer pairs AP1/C3 and AP2/C4 were used in
the first and in the nested PCR, respectively.
In order to assign the two 5¢sequences obtained (from the
genomic DNA sample digested with HincII, see Results) to
the two bovine tryptase genes, two different PCRs were
conducted, using as a template genomic DNA and the
primer pairs U1a/N10 and U1b/N10, respectively. Primers
U1a (5¢-AGATGAAGGAATTAGTAGTTTAATGG-3¢,
nt )374 to )399) and U1b (5¢-ATTAATTTCAGTTTA
AAAGAGCTACT-3¢,nt)374 to )399) were designed on
thebasisofthe5¢sequences obtained (a and b). N10
sequence is reported above. Amplification was conducted
using 20 pmol of each primer and 100 ng digenomic DNA,
with the following parameters: 1 min at 94 C(1cycle);
1mina94C; 1 min at 64 C; 4 min at 72 C (32 cycles);
5 min at 72 C (1 cycle). The PCR products were size-
fractionated by electrophoresis through a 1% (w/v) agarose
gel. After cloning, the PCR IITM TOPO vectors, containing
the inserts, were digested with the restriction enzyme NspIto
distinguish between the sequences encoding the two differ-
ent bovine tryptases (see Results).
Organization of bovine tryptase genes and location
of intron II–V
Intron II–V length of the two genes encoding bovine
tryptases was evaluated by amplification of bovine genomic
DNA, using the following primer pairs: Met/C7 for intron
II amplification; N9/C6 for intron III amplification;
C8/C1 for intron IV amplification; C5/N10 for intron V
amplification. Sequences of primers Met, C1, N9 and
N10 are reported above. Other primers used are: C5,
5¢-CCGTCGTGGAGAACAGTGTC-3¢(nt 530–549); C6,
5¢-TGTCCGCCCCGTTCTTAACGCTGTA-3¢(nt 328–
352, antisense); C7, 5¢-ACGATGCCCGCGCGCTG-3¢
(nt 67–83, antisense); C8, 5¢-ACGGGCTGGGGCAA
CGTGG-3¢(nt 460–478). The primer pair sequences
correspond to cDNA sequences at the intron/exon
junctions, deduced from the homologous sequences of
human and murine tryptase genes. PCRs were conducted
using 100 ng of genomic DNA as a template, 20 pmol of
each primer, and the following conditions for amplification:
3 min at 94 C (1 cycle), 1 min at 94 C; 1 min at the
annealing temperature; 30 s at 72 C (30 cycles); 5 min at
72 C (1 cycle). Annealing temperatures were: 58 Cfor
amplification of introns II and III, 60 C for intron IV and
62 C for intron V. The PCR products were size-fraction-
ated by electrophoresis through a 1% (w/v) agarose gel,
eluted, cloned in the PCR IITM TOPO vectors and
sequenced.
Purification of bovine tryptases
BLCT and BLT were purified as previously described for
bovine liver capsule tryptase [11], except that, in the case of
the lung enzyme, the three step procedure (high-salt
extraction followed by hydrophobic chromatography on
octyl sepharose and then an heparin affinity column) was
carried out using pH 5.5 buffers. Tryptase enzymatic
activity was routinely assayed at 30 C monitoring the
fluorescence of 7-amino-4-methyl-coumarin released from
Boc-Phe-Ser-Arg-MCA substrate (Sigma Chemical Co.,
USA), as reported previously [11]. The tryptase-containing
fractions eluted from the heparin column were concentrated
with an Amicon stirred-cell concentrator equipped with a
30 kDa cut-off membrane and stored at )20 Cinthe
heparin column elution buffer containing 20% (v/v)
glycerol. Lung tryptase was purified further by gel filtration
chromatography. The enzyme sample was diluted with four
volumes of 10 m
M
Mes pH 5.5 and injected (100 lL) at a
50 lLÆmL
)1
flow rate onto a Superose 12PC column
(Pharmacia, Italy) pre-equilibrated with the gel filtration
buffer (10 m
M
Mes, 0.4
M
NaCl, pH 5.5). Protein was
detected spectrophotometrically at 280 nm and 100 lL
fractions were collected. Tryptase activity in each fraction
was measured as described previously. The fractions
containing tryptase activity were pooled and used for
characterization of the enzyme. For determination of BLT
molecular weight, the three most active fractions were
pooled, preincubated with heparin (10 lgÆmL
)1
,10minat
room temperature), and reloaded (20 lL) on the gel
filtration column as above.
Tryptase concentrations were determined by active site
titration with 4-methylumbelliferyl p-guanidinobenzoate
(MUGB) (Sigma Chemical Co., USA) for the lung enzyme
as reported in [30], and with radioactive diisopropylfluoro-
phosphate ([
3
H]DFP) (New England Nuclear, UK) for the
liver capsule enzyme, as already described [11]. Western
blotting was performed as already reported using an anti-
(178/191-tryptase-peptide) Ig [31].
Mass spectrometry analysis
Mass spectrometric analysis was performed on the Coo-
massie blue-stained BLT protein excised from a preparative
SDS electrophoresis on a 14% (w/v) polyacrylamide gel.
The excised band was washed first with acetonitrile and then
with 0.1
M
ammonium bicarbonate. Protein samples were
reduced by incubation in 10 m
M
dithiothreitol for 45 min at
FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 509
56 C. The gel particles were then washed with ammonium
bicarbonate and acetonitrile. Enzymatic digestion was
carried out with trypsin (Sigma Chemical Co., USA) at a
final concentration of 15 ngÆmL
)1
in 50 m
M
ammonium
bicarbonate pH 8.5, at 4 C for 4 h. The buffer solution was
then removed and a new aliquot of the enzyme/buffer
solution was added for 18 h at 37 C. A minimum reaction
volume, sufficient for complete rehydration of the gel was
used. Peptides were then extracted washing the gel particles
with 20 m
M
ammonium bicarbonate and 0.1% (v/v)
trifluoroacetic acid in 50% (v/v) acetonitrile at room
temperature and then lyophilized.
MALDI mass spectra were recorded using a Applied
Biosystem Voyager DE-Pro reflector instrument. A mixture
of analyte solution and a-cyanohydroxycinnamic acid
[10 mgÆmL
)1
in acetonitrile/ethyl alcohol/0.1% trifluoro-
acetic acid (1 : 1 : 1 v/v/v)] was applied to the metallic
sample plate and dried under vacuum. Mass calibration was
performed using external standards. Raw data were
analyzed using computer software provided by the manu-
facturer and reported as monoisotopic masses.
Enzymatic assays
Rate assays for the determination of kinetic constants with
7-amino-4-methyl-coumarin (MCA) peptide substrates
(Sigma Chemical Co., USA) were started by addition of
the enzyme (BLT or BLCT) to 0.1
M
Tris/HCl, pH 8.0,
containing the various substrates in a total reaction volume
of 2.0 mL maintained at 25 C during measurements.
Hydrolysis of MCA substrates was monitored using an
excitation wavelength of 370 nm and an emission wave-
length of 460 nm in a Kontron spectrofluorimeter. k
cat
/K
m
values were determined under pseudo first-order conditions.
For all substrates [S
]wasK
m
. Progress curves were fitted
using an exponential function to obtain k
obs
;k
obs
/[E] was
usedtoobtaink
cat
/K
m
, where [E] represents the enzyme
concentration.
To test for susceptibility of BLT to inhibition, the enzyme
(5 n
M
active sites) and various inhibitors were mixed in
2 mL of the assay buffer and maintained at 30 Cfor
30 min. Then 20 lLof1.5m
M
Boc-Phe-Ser-Arg-MCA
were added and residual activity was determined as
described above by comparison with that of an identical
enzyme incubation mixture containing no inhibitor.
Results
Cloning and sequence analysis of full-length tryptase
cDNAs
A partial cDNA (690 bp) encoding a new bovine tryptase
isoform (BLT) was obtained from lung mRNA by
RT-PCR, using primers N9 and N10, and by subsequent
cloning and sequencing. Based on this partial sequence, 5¢
RACE experiments and RT-PCR (using the primer pair
Met and Coda) were performed as described in the
Experimental Procedures. The full-length BLT cDNA
consists of 1078 bp, including the 5¢untranslated 20 nt.
Its sequence is reported in Fig. 1A, with the deduced protein
sequence. An ATG codon is present 20 nt downstream of
the 5¢-end, the stop codon following after 813 nt. Thus, a
271 residue protein precursor chain is encoded by a single
open reading frame. The 242 bp 3¢-UTR, with a polyade-
nylation signal at nt 1039–1043, is identical in the initial
100bptothe3¢-UTR of BLCT cDNA [29], with an overall
difference in 71 positions.
Full-length BLCT cDNA sequence of 1031 nt (Fig. 1B)
was similarly obtained from liver capsule mRNA, by 5¢
RACE experiments and RT-PCR. The BLCT sequence
previously reported [29] is now confirmed by the sequence of
the full-length BLCT cDNA, except for residue 11 of the
mature protein, in that it possesses Arg rather than Gln in
this position (see Fig. 2).
When the deduced amino acid sequence of BLT is
compared with that of BLCT and other tryptases (Fig. 2), it
is evident that the first 26 aa residues of both bovine
isoforms represent the prepro-sequence, the mature protein
starting with residues IVGG, the canonical N-terminal
sequence of tryptases. The serine protease catalytic triad
residues (His44, Asp91 and Ser194) and eight cysteine
residues building the predicted intrachain disulfide bonds
are well conserved, as are many other sequence regions.
Three putative N-linked glycosylation sites at positions 102
(NIS), 171 (NVS) and 203 (NGT) are present in BLT,
whereas only two glycosylation sites were found in BLCT
[29], gerbil tryptase [12] and sheep tryptases 1 and 2 [13]. The
sequence identity of BLT is about 98% with BLCT
(corresponding to six different residues), 70–74% with
tryptases from other species, except in the case of sheep
tryptases 1 and 2 [13], where the identity reaches 82–83%.
The major and more significant difference between BLT
and BLCT resides at positions 188–189 of the S1 specificity
pocket. In BLCT they are occupied by residues Asn-Phe
(from full-length cDNA sequencing, in agreement with
previously reported partial cDNA and protein sequencing
[29]), while in BLT the canonical residues Asp-Ser are
present, as in all tryptases from other species (see also below
for the biochemical analysis of the purified protein).
Tissue-distribution and expression pattern
of bovine tryptases
Another interesting difference between the two bovine
tryptase isoforms occurs at residue 179, which is Met in
BLCT, as in many other tryptases, and is Asn in BLT (see
Fig. 2), while residues 178 and 180 are identical in the two
enzymes. This results, only in BLCT cDNA, in a restriction
site (ACATGT) for NspI endonuclease. Thus, when treated
with this enzyme, BLT and BLCT cDNAs, cloned into the
TA vector, show a different restriction pattern. BLT insert
results in an undigested band, while in the BLCT insert the
presence of the restriction site gives rise to two bands. We
took advantage of this different restriction pattern with
NspI to evaluate the distribution of bovine tryptases in
different tissues (lung, heart, spleen and liver capsule). The
results, reported in Fig. 3, show that in lung only BLT is
expressed, while in liver capsule only BLCT cDNA is
present, in agreement with our previous results [29]. On the
contrary, in heart and spleen both isoforms are expressed.
We were unable to detect BLCT mRNA in lung and BLT
mRNA in the liver capsule, even when 40 cycles of PCR
were performed to allow identification of low abundant
transcripts.
510 A. Gambacurta et al. (Eur. J. Biochem. 270)FEBS 2003
A
-20
AGCAGCCTGGACCTGCCAAG -1
ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72
M L H L L A L A L L L S L V S A A P G Q A L Q R (-3)
GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144
A G I V G G Q E A P G S R W P W Q V S L R V S R (22)
CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216
R Y W R H H C G G S L I H P Q W V L T A A H C V (46)
•
GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGTGAGCAGCACCTGTATTACCAGGACCAG 288
G P E V H G P S Y F R V Q L R E Q H L Y Y Q D Q (70)
CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTACTACAGCGTTAAGAACGGTGCGGACATCGCCCTG 360
L L P I S R I I P H P N Y Y S V K N G A D I A L (94)
•
CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCTGGTCACCCTGCCCCCTGAGTCGGAGACC 432
L E L D K L V N I S W H V Q L V T L P P E S E T (118)
*
TTTCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504
F P P G T Q C W V T G W G N V D N G R R L P P P (142)
TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576
F P L K Q V K V P V V E N S V C D R K Y H S G L (166)
TCCACAGGGGACAACGTATCCATAGTGCAGGAGGATAACTTGTGTGCTGGGGACAGCGGGAGGGACTCCTGC 648
S T G D N V S I V Q E D N L C A G D S G R D S C (190)
*
CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720
Q G D S G G P L V C K V N G T W L Q A G V V S W (214)
• *
GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792
G D G C A K P N R P G I Y T R V T S Y L D W I H (238)
CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864
Q Y V P Q G P ♦ (245)
tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936
cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008
tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058
B
-20
AGCAGCCTGGACCTGCCAAG -1
ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72
GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144
CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216
GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288
CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360
CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432
TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504
TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576
TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648
CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720
GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792
CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864
♦
cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936
ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac 1008
actcattaaagagcatggagagg 1031
Fig. 1. Full-length bovine tryptase cDNAs. Nucleotide numbering begins at the first nucleotide of the preprosequence. Stop codon (r)and
polyadenylation signal (underlined) are indicated. (A) BLT cDNA and deduced amino acid sequence. Potential N-linked glycosylation sites (w),
residues of the serine protease catalytic triad (d) and residues identified by mass spectrometry (underlined) are indicated. Amino acid numbering
startsatthefirstresidueofthematureprotein.(B)BLCTcDNA(seealso[29]).
FEBS 2003 Tissue-specific expression of bovine tryptases (Eur. J. Biochem. 270) 511