ATP synthase chloroplast: Báo cáo khoa học về ảnh hưởng của N-terminal deletion c subunit đến hoạt động và ổn định

N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase Zhang-Lin Ni, Hui Dong and Jia-Mian Wei

Shanghai Institute of Plant Physiology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China

Keywords ATP synthase; chloroplast; glutathione S-transferase pull-down assay; abc assembly; c subunit

Correspondence J.-M. Wei, Shanghai Institute of Plant Physiology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China Fax: +86 21 54924015 Tel: +86 21 54924230 E-mail: wjm@iris.sipp.ac.cn

(Received 25 November 2004, revised 22 December 2004, accepted 17 January 2005)

doi:10.1111/j.1742-4658.2005.04570.x

Five truncation mutants of chloroplast ATP synthase c subunit from spin- ach (Spinacia oleracea) lacking 8, 12, 16, 20 or 60 N-terminal amino acids were generated by PCR by a mutagenesis method. The recombinant c genes were overexpressed in Escherichia coli and assembled with ab sub- units into a native complex. The wild-type (WT) abc assembly i.e. abcWT exhibited high Mg2+-dependent and Ca2+-dependent ATP hydrolytic activity. Deletions of eight residues of the c subunit N-terminus caused a decrease in rates of ATP hydrolysis to 30% of that of the abWT assembly. Furthermore, only (cid:1) 6% of ATP hydrolytic activity was retained with the sequential deletions of c subunit up to 20 residues compared with the activ- ity of the abWT assembly. The inhibitory effect of the e subunit on ATP hydrolysis of these abc assemblies varied to a large extent. These observa- tions indicate that the N-terminus of the c subunit is very important, together with other regions of the c subunit, in stabilization of the enzyme complex or during cooperative catalysis. In addition, the in vitro binding assay showed that the c subunit N-terminus is not a crucial region in bind- ing of the e subunit.

The ﬁrst high-resolution X-ray structure of ATP synthase was of bovine mitochondrial F1 in 1994 [6]. The structure is essentially unchanged in X-ray studies of bovine F1 inhibited by N,N¢-dicyclohexylcarbodi- imide (Fig. 1) [7]. Nucleotide bound to all three cata- lytic sites in the aluminum ﬂuoride-inhibited form of bovine F1 [8]. The X-ray structures show that the a and b subunits alternate with each other to form a hexamer surrounding a central cavity, where a coiled- coil structure formed by the N-terminal and C-ter- minal helices of the c subunit penetrates. The three catalytic sites of F1 are located on the b subunits, where the sites interface subunit a in three different conformational states. The importance of the c subunit in the catalytic cycle has been demonstrated previ- is probably related to the ously, showing that sequential conformational changes in the ab pairs in addition to being responsible for the generation of a high-afﬁnity nucleotide-binding site on the b subunits

ATP synthase occurs ubiquitously on energy-transduc- ing membranes such as chloroplast thylakoid mem- branes, mitochondrial inner membranes, and bacterial plasma membranes. This enzyme catalyzes ATP syn- thesis by a proton motive force across the membrane formed by the respiratory chain or photosynthetic elec- (ATPase in Escherichia coli recently tron transport reviewed in [1,2], and ATP synthase in chloroplasts in [3,4]). The general structural features of the enzyme are highly conserved among different organisms. The enzyme in chloroplasts consists of two parts: CF0 and CF1. CF0, a membrane-spanning complex, conducts proton ﬂux through the thylakoid membrane and pro- vides afﬁnity sites for the CF1 complex. CF1, extrinsic to the membrane, contains the nucleotide-binding and catalytic sites, and can hydrolyze ATP at high rates after appropriate treatment [4,5]. The CF1 complex consists of ﬁve types of subunit with the stoichiometry a3b3cde.

Abbreviations CF0, the hydrophobic portion of chloroplast ATP synthase; CF1, coupling factor one; GST, glutathione S-transferase; WT, wild-type.

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1379

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

the c N-terminal domain during catalytic cooperativity [4,7,8]. cSer8 substitution with a Cys residue resulted in it being cross-linked with a different b region in the presence of Mg2+-ADP or Mg2+-ATP [17]. cMet23 substitution caused ATPase uncoupling [18], which was suppressed by amino-acid replacements between 269 and 280 in the C-terminal domain [19]. It has been demonstrated by ﬂuorescence mapping [20] and cross- linking [21] that the e subunit is in close proximity to the c subunit. The e subunit interacts directly with the c subunit [22–24], but does so with a higher afﬁnity when the c subunit is assembled with the a3b3 core [25, 26]. The hybrid enzyme from the a,b subunits of a thermophilic bacterium and the mutant CF1 c subunit (D194–230) was insensitive to added e subunit [25].

Fig. 1. Schematic representation of the bovine heart mitochondria F1 produced from pdb ﬁle 1e79 using DEEPVIEW [37]. Subunit a is on the left, and subunit b is on the right. The N-terminal 20 residues of subunit c are depicted in gray.

by its rotation within the a3b3 core [1–4,6–8]. In F1, rotation of the c subunit coupled with ATP hydrolysis was conﬁrmed by its direct observation in the move- ment of a ﬂuorescence-labeled actin ﬁlament, which was attached to the c subunit of the thermophilic bac- terial F1 subcomplex, a3b3c [9], e subunit F1 [10,11] and CF1 [12].

Studies by Gao et al. [26], who developed an in vitro reconstitution system by assembling the ab complex with an isolated c subunit, showed that this complex was able to obtain the reconstituted core enzyme com- plex as effectively as the native a3b3c. Recently, a hybrid F1-ATPase from Rhodospirillum rubrum or chloroplast subunits was used to study the mechanism of photosyn- thetic F1-ATPase [27,28]. In the present study, we exam- ined the importance of the CF1 N-terminus of the c subunit during hydrolytic turnover using this reconsti- tution system and the binding of e to c through a gluta- thione S-transferase (GST) pull-down assay. To do this, we selectively deleted 8, 12, 16, 20 or 60 residues from the N-terminus of the c subunit. The reconstituted abc assemblies were tested for ATP hydrolytic activity. The results show that the c subunit’s N-terminus is very important for stabilization of the enzyme complex.

Results

Overexpression and assembly of the c truncated mutants

The catalytic core of the enzyme is a3b3c, despite ab exhibiting lower rates of ATP hydrolysis [13]. It is generally accepted that ATP synthase generates coup- ling between cooperative catalysis and proton translo- cation during hydrolysis ⁄ synthesis processes. However, the precise catalytic mechanism of F1-ATPase is still unknown [1,14]. With respect to CF1, it is also pro- posed that isolated CF1 operates through a full 360(cid:1) rotation, like other F1-ATPases [12]. CF1 is unique in that thiol modulation, the structural basis of which is an insert of about 20 amino acids including a regula- tory disulﬁde bond, is reversibly oxidized and reduced. The N-terminus and C-terminus of c subunits from dif- ferent organisms are highly conserved [15]. Deletion of the 20 amino acids in the C-terminus of the c subunit resulted in an active chloroplast enzyme [16]. Crystal structures (Fig. 1) reveal that the N-terminal domain the c subunit makes contact with the bE sub- of unit C-terminal domain containing the conserved DELSEED motif, which is thought to be important for energy-coupling rotation of the c subunit by steric interaction. This indicates the possible importance in

All the plasmids listed in Table 1 were transformed into the expression strain E. coli BL21 (DE3) ⁄ pLysS. The spinach chloroplast atpC gene constructed in the pET11b expression vector had a high expression level in E. coli. More than 100 mg recombinant c protein was obtained per litre of culture medium. Overexpres- sion of the cloned polypeptides in E. coli resulted in the accumulation of insoluble inclusion bodies. The inclusion bodies were solubilized in 4 m urea and recovered by slow dialysis as described previously [16]. Like the wild-type and native c subunits [16], all the c mutants tended to aggregate during dialysis when pro- tein concentration was high. On SDS ⁄ PAGE, wild- type c protein and the truncated polypeptides migrated for distances consistent with the extent of truncation

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1380

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

Table 1. Amino-acid and primer sequences of truncated mutants. Listed below are the amino-acid sequences and PCR primers of truncation mutants (D) of the c subunit of spinach chloroplast ATP synthase. The numbers in the plasmids indicate the numbers of residues deleted fol- lowed by N designating N-terminus truncation, respectively. The truncations begin with deletion of eight residues with successive deletion of four residues up to 20 residues from the N-terminus, and N-terminal mutants with deletion of 60 residues (cDN60).

Plasmid

Amino-acid sequences

Forward primers (5¢-3¢)

Reverse primers (5¢-3¢)

ANLRELRDRIGSVKNTQKITEAMKLVAAAK-31 TTTGTCATATGGCAAACCTCCGTGAGC …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA

ATTCCGGAC

…12VKNTQKITEAMKLVAAAK-31 TCGGCCATATGGTCAAAAACACGCAGAAG …16QKITEAMKLVAAAK-31 TTGGCCATATGCAGAAGATCACCGAAGCA

ACGGATCCA ATTAATCTC

pET11-cWT pET11-cDN8 pET11-cDN12 pET11-cDN16 pET11-cDN20 pET11-cDN60

…20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT

(Fig. 2A). Each of the c constructs reacted with c anti- serum on immunoblots (data not shown). The trun- cated polypeptides were designated cDN8 to cDN60 according to the number of amino-acid residues dele- ted from the c subunit N-terminus. The N-terminus amino-acid sequence of c subunit from chloroplasts is shown in Table 1.

ATP hydrolytic activity of the mutant assemblies

tein))1Æmin)1), consistent with previous results showing that assembling the cloned c polypeptide with the iso- lated ab subunits resulted in a fully active core enzyme complex [26], although there were some differences among the hydrolytic rates. Deletion of eight residues from the c subunit N-terminus impaired the ATP hydrolytic ability, despite differences between Mg2+- ATPase and Ca2+-ATPase. The deletion of 12 residues resulted in a greater decrease in Ca2+-ATPase activity. About 6% of ATP hydrolytic activity retained on dele- tion of 20 residues. When 60 residues were deleted, the rate of ATP hydrolysis of the reconstituted assembly was similar to the ab complex containing no c subunit.

Interaction of subunits c and e in vitro

GST pull-down assays were used to detect c–e interac- tion. The full-length cDNA encoding the e subunit was fused to the C-terminus of the GST gene in the expres- sion plasmid, and the GST-fusion protein was over- expressed in E. coli. As shown in Fig. 4, GST alone did not bind to the wild-type c subunit (cWT); in con- trast, GST–e was able to bind directly to all the c con- structs. It was also able to bind to the cDN8, cDN12

We tested ATP hydrolytic activity of the reconstituted assemblies. Incubation of the native c protein from chloroplasts with isolated ab subunits (Fig. 2B) resul- ted in their assembly into a stable, highly active abc complex under optimal conditions. The cloned c poly- peptide was identical with the native c subunit in its ability to form a fully active core enzyme complex [16,26]. Mg2+-ATPase activity was measured in the presence of sodium sulﬁte, a strong stimulator of ATP hydrolysis [16]. The relative rates of ATP hydrolysis of these reconstituted assemblies in the presence of either Ca2+ or Mg2+ as the bivalent cation substrate were compared (Fig. 3). The wild-type assembly exhibited the maximum activity [14.4 lmol PiÆ(mg pro-

A

B

Fig. 2. Gel electrophoresis proﬁles of prepa- rations of inclusion bodies and the puriﬁed ab complex. Preparations were analyzed by SDS ⁄ PAGE on 15% polyacrylamide gels, and the proteins were stained with Coomas- sie Brilliant Blue R250. Each lane contained 6 lg protein. (A) Lane 1, CF1; lanes 2–7, inclusion body preparations of cWT, DcN8, DcN12, DcN16, DcN20 and DcN60, respect- ively. (B) Lane 1, CF1(–de); lane 2, isolated ab complex.

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1381

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

Inhibition of

shows

the Ca2+-ATPase activities

the Ca2+-ATPase of the reconstituted abc Fig. 5. assemblies by addition of e subunit. Ca2+-ATPase activities were analyzed as described in Experimental procedures. Assemblies were incubated with the e subunit at the molar ratio 10e:1ab. The inset [lmol PiÆ(mg pro- tein))1Æmin)1] in the absence of e subunit, which are set as 100%.

Fig. 3. Relative ATPase activity of reconstituted abc assemblies. Mg2+-ATPase (black columns) and Ca2+-ATPase (gray columns) activities were analyzed as described in Experimental procedures. The ATPase activities [lmol PiÆ(mg protein))1Æmin)1] of the cWT assembly (100%) were: Mg2+-ATPase, 13.8; Ca2+-ATPase, 14.4. The activities of both the ab complex and the abDcN60 assemble were about 0.3.

Inhibitory effects of the e subunit

the e subunit

Given that the N-terminal deletions of the c subunit barely inhibited the interaction between c and e, fur- ther studies were performed to conﬁrm the responses of the mutant assemblies to the inhibitory e subunit. The inhibitory responses of the Ca2+-ATPase activity of the different mutant assemblies were examined after the addition of (Fig. 5). The abcWT assembly that exhibited the highest Ca2+-ATPase activity was inhibited by 84%. The inhibitory effects of the e subunits on hydrolytic rates in the mutant (cDN8, cDN12, cDN16 and cDN20) assemblies varied greatly, ranging from 35% to 63% reduction in hydro- lysis.

Discussion

Interactions of wild-type c and the engineered c with e Fig. 4. in vitro. GST pull-down assays were performed as described in Experimental procedures. GST or GST–e fusion proteins were bound to glutathione–Sepharose 4B beads. 6 lg of each of the c construct proteins were incubated with 20 lL of the beads bound to GST–e. After extensive washing, proteins eluted from the beads were subjected to Western-blot analysis with c antiserum. GST alone was used as a negative control by incubating 20 lL of the beads bound to GST with 6 lg of the wild-type c recombinant.

and cDN16 molecules with similar afﬁnity to cWT. Deletion of 20 residues resulted in slight impairment of the binding activity.

The studies presented here focused on the importance of the N-terminus of the c subunit during ATP hydro- lysis in addition to examining the role of binding and inhibition of the e subunit. A schematic representation of bovine heart mitochondria F1 is shown in Fig. 1. The conserved N-terminal region of the c subunit forms an antiparallel left-handed coiled coil with the C-terminal part, which penetrates into a cavity formed by the a3b3 hexamer. The c subunit’s N-terminus makes contact with the C-terminal domain of the bE subunit, which contains the conserved DELSEED motif [7,8]. It is generally accepted that the c subunit confers the asymmetric properties of the catalytic sites by interacting with the a and b subunits, resulting in catalytic cooperativity. The permanent asymmetry of

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1382

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

catalysis, which is much higher than that of binding e to individual c [26]. The truncation seemed not to change the binding afﬁnity between c and e (Fig. 5), but the altered asymmetrical conformation of a3b3c resulting from deletions in c is enough to decrease the binding of e to a3b3c. Meanwhile, impaired cata- lytic cooperativity may not be efﬁciently inhibited by the e subunit. Both of the above may partially explain the varied inhibitory effect of e on ATP hydrolysis.

isolated CF1 was found in labeling experiments with Lucifer Yellow [29], which possibly indicated that the N-terminal part of subunit c remains in contact with the aE and bE subunits during the complete catalytic turnover without a full 360(cid:1) rotation [4]. However, direct observation of the movement of subunit c in iso- lated CF1 was also determined recently to resemble that of E. coli F1 or thermophilic bacterial F1 subcom- plex, thereby favoring multisite catalysis with a full 360(cid:1) rotation.

Taken together, we have shown that the N-terminal region of the c subunit is important for stabilization of a3b3c or cooperative catalysis of isolated CF1. The N-terminal region of subunit c in CF1 is not crucial for binding of subunit e in vitro. Further studies are needed to determine candidate residues participating in transmission of conformation signals and efﬁcient energy coupling of the c subunit N-terminus.

Experimental procedures

Materials

The data presented here reveal that deletion of 60 residues eliminated almost all hydrolytic activity of the reconstituted assembly; moreover, the removal of eight residues abolished most of the activity. When up to 20 residues were deleted, very low ATP hydro- lytic activity was retained (Fig. 3). There are two possible explanations for the above results. (a) The deletions impaired the stability of the reconstituted assemblies and the efﬁcient assembly of the ab com- plex with recombinant c constructs; or (b) the struc- tural change in the truncated c construct altered the asymmetry conformation of a3b3c, thereby affecting transmission of conformational signals between cata- lytic sites, which resulted in impaired normal catalytic cooperativity. These observations indicate that the N-terminal part of subunit c is indispensable and functions with other regions of c during stabilization of the abc complex and rotational catalysis. Consis- tent with previous studies, we also found that Ca2+- and Mg2+-dependent ATP hydrolytic dependent activities were different, indicating different catalytic mechanisms [28].

Generation of c truncation mutants and GST-fusion protein

It is well established that the e subunit, a regulatory protein of ATPase, binds to c directly and rotates with the c and c (homologous to CF0-III in chloroplasts) subunits as a part of a rotor (cec10) [1,2]. The inter- action of c and e increases when c penetrates into a a3b3 hexamer [26]. The e subunit binds to CF1 with an apparent dissociation constant of < 10)10 m [20]. In the e subunit, the sites of c interaction with e were mapped to between R49 and R70, and the C-terminal part beyond K199 [24]. The regulatory c regions of CF1 seem to be very important for e subunit binding [30]. Our results also show that the e subunit stably binds to c, which is consistent with earlier studies [23–25]. Deletion of 20 residues from the N-terminal region did not markedly decrease the binding afﬁnity between the c and e subunits in vitro (Fig. 4).

Restriction endonucleases, T4 DNA ligase, Klenow frag- ment, and Pfu and Taq DNA polymerase were purchased from Takara (Dalian, China) and Promega (Shanghai, China). Sephadex G-50 was purchased from Pharmacia (Uppsala, Sweden). DEAE-cellulose was obtained from Whatmann (Uppsala, Sweden) and hydroxyapatite from Bio-Rad (Hercules, CA, USA). Other reagents were all standard AR grade.

The engineered c subunit bound to the e subunit with almost identical afﬁnity, although the inhibitory effects of e subunit varied with the number of resi- dues removed. The high binding afﬁnity of a3b3c for for inhibition of ATPase the e subunit

is essential

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1383

Plasmid pJLA503-pchlc, a gift from S. Engelbrecht (Uni- versity of Osnabruck, Germany), contains the atpC genes encoding the ATP synthase c subunit [31]. The wild-type c fragment was PCR ampliﬁed from pJLA503-pchlc, and ﬁve truncation mutants were PCR generated with the mutagen- esis primers (Table 1). The PCR products were digested with NdeI and BamHI, and subsequently subcloned into the pET11b expression vector. The resulting plasmids were conﬁrmed by DNA sequencing. For construction of the GST–e fusion protein, full-length cDNA encoding the e subunit was ampliﬁed by PCR using pJLA-eWT [23] as a template with the following primers: 5¢-GACGGATCC CCATGACCTTAAATCTTTGT-3¢ as the 5¢ primer and 5¢-ATAGTCGACCTGGTTACGAAGAAATCG-3¢ as the 3¢ primer. The PCR products were cleaved with BamHI and EcoRI, and cloned into plasmid pGEX-5X-1 (Amer- sham-Pharmacia Biotech, Shanghai, China). The resulting plasmid pGEX-5X-e was conﬁrmed to be inframe with the GST cassette by DNA sequencing.

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

Solubilization and folding of overexpressed c mutants and GST-fusion protein

transformed into the

carried out in the presence of 5 mm CaCl2, and Mg2+- ATPase in the presence of 2 mm MgCl2 and 20 mm Na2SO3. The reaction was stopped by adding 200 lL 20% trichloroacetic acid. c Antiserum was raised by subcuta- neous injections into rabbits. Inclusion bodies containing recombinant c polypeptide were subjected to SDS ⁄ PAGE. Proteins were recovered from Coomassie Brilliant Blue R250-stained gel bands and used for the immunization of rabbits. Protein concentration was measured by the method of Bradford [36].

Acknowledgements

This work was supported by the National Natural Sci- ence Foundation of China (30170078) and State Key Basic Research and Development Plan (G1998010100).

Preparation and reconstitution of an ab complex and c mutants

The resulting pET11b plasmids containing the atpC gene expression strain E. coli were BL21(DE3) ⁄ pLysS. The resulting E. coli cells were grown at 37 (cid:1)C in Luria–Bertani medium containing l-ampicillin. Cells were induced with 0.4 mm isopropyl thio-b-d-galacto- side in mid-exponential phase, incubated for 7 h, and har- vested as described previously [32]. Solubilization and folding of the insoluble c polypeptide were performed according as described previously [16]. Overexpression and collection of GST or GST–e fusion protein in E. coli were carried out as previously described [23].

References

[26]. Reconstitution of complex the 1 Senior AE, Nadanaciva S & Weber J (2002) The mole-

cular mechanism of ATP synthesis by F1F0-ATP synthase. Biochim Biophys Acta 1553, 188–211. An ab complex was isolated from CF1 (– de) as described previously and c mutants was carried out as described previously [26]. The incubated mixture was assayed directly for ATP hydrolytic activity. 2 Weber J & Senior AE (2003) ATP synthesis driven by

In vitro binding assays of e with c subunit and immunoblotting analysis

proton transport in F1F0-ATP synthase. FEBS Lett 545, 61–70.

3 McCarty RE, Evron Y & Johnson EA (2000) The chloro- plast ATP synthase: a rotary enzyme? Annu Rev Plant Physiol Plant Mol Biol 51, 83–109. 4 Richter ML, Hein R & Huchzermeyer B (2000) Impor-

tant subunit interactions in the chloroplast ATP synthase. Biochim Biophys Acta 1458, 326–342.

5 Richter ML, Patrie WJ & McCarty RE (1984) Prepara- tion of the e subunit and e subunit-deﬁcient chloroplast coupling factor 1 in reconstitutively active forms. J Biol Chem 259, 7371–7373. 6 Abrahams JP, Leslie AGW, Lutter R & Walker J

(1994) Structure at 2.8 A˚ resolution of F1-ATPase from bovine heart mitochondria. Nature 370, 621–628. 7 Gibbons C, Montgomery MG, Leslie AG & Walker JE

(2000) The structure of the central stalk in bovine F1-ATPase at 2.4 A˚ resolution. Nat Struct Biol 7, 1055– 1061. Equal amounts of GST or GST–e fusion proteins were bound to glutathione–Sepharose 4B beads in binding buffer [50 mm Tris ⁄ HCl, 100 mm NaCl, 1 mm EDTA, 1% (v ⁄ v) Triton X-100, 1 mm phenylmethanesulfonyl ﬂuoride and 10% (v ⁄ v) glycerol, pH 8.0] at 4 (cid:1)C for 2 h. The bound glutathione–Sepharose 4B beads were washed three times with binding buffer to remove unbound fusion proteins. These beads were incubated with equal amounts of the c constructs for 4 h at 4 (cid:1)C in binding buffer and washed four times with binding buffer to remove unbound proteins. Subsequently, the beads were suspended in 2· SDS loading buffer and boiled for 3 min. Proteins released from the beads were analyzed by SDS ⁄ PAGE (15% polyacrylamide gel) [23], transferred to nitrocellulose membrane, and detec- ted by western immunoblot analysis using an ECL Western Blotting Detection System (Amersham) and c antiserum. 8 Menz RI, Walker JE & Leslie AG (2001) Structure of

CF1 and CF1 (–de) preparation and measurement of ATPase activity

bovine mitochondrial F1-ATPase with nucleotide bound to all three catalytic sites: implications for the mechan- ism of rotary catalysis. Cell 106, 331–341. 9 Noji H, Yasuda R, Yoshida M & Kinosita K Jr (1997)

Direct observation of the rotation of F1-ATPase. Nature 386, 299–302.

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1384

10 Noji H, Hasler K, Junge W, Kinosita K Jr, Yoshida M & Engelbrecht S (1999) Rotation of Escherichia coli F1- ATPase. Biochem Biophys Res Commun 260, 597–599. 11 Omote H, Sambonmatsu N, Saito K, Sambongi Y, Iwamoto-Kihara A, Yanagida T, Wada Y & Futai M CF1 and CF1 (–d) were prepared from fresh market spinach as described previously [33,34]. Before use, the proteins were desalted on Sephadex G-50 centrifuge columns [35]. ATPase activities were determined by measuring phosphate release for 5–10 min at 37 (cid:1)C. The assay was performed in 1 mL volumes of assay mixture containing 50 mm Tricine ⁄ NaOH, pH 8.0, and 5 mm ATP. Ca2+-ATPase was

Z.-L. Ni et al.

N-Terminal deletion of the c subunit

(1999) The c subunit rotation and torque generation in F1-ATPase from wild-type or uncoupled mutant Escheri- chia coli. Proc Natl Acad Sci USA 96, 7780–7784. 25 Tang C & Capaldi RA (1996) Characterization of the interface between a and e subunits of Escherichia coli F1-ATPase. J Biol Chem 271, 3018–3024. 26 Gao F, Lipscomb B, Wu I & Richter ML (1995)

12 Hisabori T, Kondoh A & Yoshida M (1999) The c sub- unit in chloroplast F1-ATPase can rotate in a unidirec- tional and counter-clockwise manner. FEBS Lett 463, 35–38. In vitro assembly of the core catalytic complex of the chloroplast ATP synthase. J Biol Chem 270, 9763–9769. 13 Matsui T & Yoshida M (1995) Expression of the wild-

type and the Cys- ⁄ Trp-less a3b3c complex of thermophi- lic F1-ATPase in Escherichia coli. Biochim Biophys Acta 1231, 139–146.

27 Tucker WC, Du Z, Hein R, Richter ML & Gromet-Elha- nan Z (2000) Hybrid Rhodospirillum rubrum F0F1 ATP synthases containing spinach chloroplast F1 b or a and b subunits reveal the essential role of the a subunit in ATP synthesis and tentoxin sensitivity. J Biol Chem 275, 906– 912. 28 Du Z, Tucker WC, Richter ML & Gromet-Elhanan Z 14 Ren H & Allison WS (2000) On what makes the c sub- unit spin during ATP hydrolysis by F1. Biochim Biophys Acta 1458, 221–233.

15 Miki J, Maeda M, Mukohata Y & Futai M (1988) The c-subunit of ATP synthase from spinach chloroplasts. Primary structure deduced from the cloned cDNA sequence. FEBS Lett 232, 221–226.

(2001) Assembled F1-(ab) and Hybrid F1-a3b3c-ATPases from Rhodospirillum rubrum a, wild type or mutant b, and chloroplast c subunits. Demonstration of Mg2+ versus Ca2+-induced differences in catalytic site struc- ture and function. J Biol Chem 276, 11517–11523. 29 Nalin CM, Snyder B & McCarty RE (1985) Selective modiﬁcation of an a subunit of chloroplast coupling factor 1. Biochemistry 24, 2318–2324. 16 Sokolov M, Lu L, Tucker W, Gao F, Gegenheimer PA & Richter ML (1999) The 20 C-terminal amino acid residues of the chloroplast ATP synthase c subunit are not essential for activity. J Biol Chem 274, 13824–13829.

30 Hisabori T, Motohashi K, Kroth P, Strotmann H & Amano T (1998) The formation or the reduction of a disulﬁde bridge on the c subunit of chloroplast ATP synthase affects the inhibitory effect of the e subunit. J Biol Chem 273, 15901–15905. 17 Aggeler R, Cai SX, Keana JF, Koike T & Capaldi RA (1993) The c subunit of the Escherichia coli F1-ATPase can be cross-linked near the glycine-rich loop region of a b subunit when ADP + Mg2+ occupies catalytic sites but not when ATP + Mg2+ is bound. J Biol Chem 268, 20831–20837. 31 Lill H, Burkovski A, Altendorf K, Junge W &

Engelbrecht S (1993) Complementation of Escherichia coli unc mutant strains by chloroplast and cyanobacter- ial F1-ATPase subunits. Biochim Biophys Acta 1144, 278–284. 18 Nakamoto RK, Maeda M & Futai M (1993) The c sub- unit of the Escherichia coli ATP synthase. Mutations in the carboxyl-terminal region restore energy coupling to the amino-terminal mutant c Met-23 ﬁ Lys. J Biol Chem 268, 867–872. 19 Nakamoto RK, al-Shawi MK & Futai M (1995) The

32 Ni ZL, Wang DF & Wei JM (2002) Substitutions of the conserved Thr42 increased the roles of the e subunit of maize CF1 as CF1 inhibitor and proton gate. Photosyn- thetica 40, 517–522. ATP synthase c subunit. Suppressor mutagenesis reveals three helical regions involved in energy coupling. J Biol Chem 270, 14042–14046.

20 Snyder B & Hammes GG (1985) Structural organization of chloroplast coupling factor. Biochemistry 24, 2324– 2331. 33 Jagendorf AT (1982) Isolation of chloroplast coupling factor (CF1) and of its subunits. In Methods in Chloro- plast Molecular Biology (Edelman M, Hallick RB & Chua N-H, eds), pp. 881–897. Elsevier Biomedical Press, Amsterdam. 21 Schulenberg B, Wellmer F, Lill H, Junge W & 34 Richter ML, Snyder B, McCarty RE & Hammes GG

Engelbrecht S (1997) Cross-linking of chloroplast F0F1-ATPase subunit e to c without effect on activity. e and c are parts of the rotor. Eur J Biochem 249, 134– 141. (1985) Binding stoichiometry and structural mapping of the e polypeptide of chloroplast coupling factor 1. Biochemistry 24, 5755–5763.

22 Dunn SD (1982) The isolated c subunit of Escherichia coli F1 ATPase binds the e subunit. J Biol Chem 257, 7354–7359. 35 Penefsky HS (1977) Reversible binding of Pi by beef heart mitochondrial adenosine triphosphatase. J Biol Chem 252, 2891–2899.

23 Shi XB, Wei JM & Shen YG (2001) Effects of sequen- tial deletions of residues from the N- or C-terminus on the functions of e subunit of the chloroplast ATP syn- thase. Biochemistry 40, 10825–10831. 36 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein util- izing the principle of protein-dye binding. Anal Biochem 72, 248–254.

FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS

1385

24 Dunn SD (1997) e-binding regions of the c subunit of Escherichia coli ATP synthase. Biochim Biophys Acta 1319, 177–184. 37 Schwede T, Kopp J, Guex N & Peitsch MC (2003) SWISS-MODEL: an automated protein homology- modeling server. Nucleic Acids Res 31, 3381–3385.