Báo cáo khóa học: Nghiên cứu Metal-binding stoichiometry và Selectivity của Copper Chaperone CopZ từ Enterococcus hirae

Metal-binding stoichiometry and selectivity of the copper chaperone

CopZ from

Enterococcus hirae

Agathe Urvoas

, Mireille Moutiez

, Cle

´ment Estienne

, Joe¨ l Couprie

, Elisabeth Mintz

and Loı¨c Le Clainche

´partement d’Inge

´nierie et d’Etudes des Prote

´ines, Direction des Sciences du Vivant, CEA Saclay, Gif sur Yvette, France;

Laboratoire de Biophysique Mole

´culaire et Cellulaire, UMR 5090, CFA-CNRS, Universite Joseph Fourier, Direction des

Sciences du Vivant, CEA Grenoble, France

We studied the interaction of several metal ions with the

copper chaperone from Enterococcus hirae (EhCopZ). We

show that the stoichiometry of the protein–metal complex

varies with the experimental conditions used. At high con-

centration of the protein in a noncoordinating buffer, a

dimer, (EhCopZ)

–metal, was formed. The presence of a

potentially coordinating molecule L in the solution leads to

the formation of a monomeric ternary complex, EhCopZ–

Cu–L, where L can be a buffer or a coordinating mole-

cule (glutathione, tris(2-carboxyethyl)phosphine). This was

demonstrated in the presence of glutathione by electrospray

ionization MS. The presence of a tyrosine close to the metal-

binding site allowed us to follow the binding of cadmium to

EhCopZ by fluorescence spectroscopy and to determine the

corresponding dissociation constant (K

¼30 n

). Com-

petition experiments were performed with mercury, copper

and cobalt, and the corresponding dissociation constants

were calculated. A high preference for copper was found,

with an upper limit for the dissociation constant of 10

)12

These results confirm the capacity of EhCopZ to bind cop-

per at very low concentrations in living cells and may provide

new clues in the determination of the mechanism of the

uptake and transport of copper by the chaperone EhCopZ.

Keywords: copper transport; CopZ; metal binding; metal-

lochaperone; selectivity.

Copper is a first-row transition metal, which plays a

fundamental role in living organisms. Although it is

involved in the catalytic active site of several enzymes [1],

its redox properties can also generate highly toxic hydroxy

radicals in cells [2]. Therefore, its intracellular concentration

has to be tightly regulated. Copper chaperones have recently

been reported to be key proteins in the uptake and transport

of copper in cells, and in the transfer of the metal ion

to appropriate partners [3–5]. Many recent studies have

provided data on their biological function, and an increas-

ing number of 3D structures have been resolved for many

members of this family both in the apo and metal-

loaded state (vide infra).

In this study, we focused on the protein CopZ, which

has been reported to be involved in copper homoeostasis

in Enterococcus hirae (hereafter referred to as EhCopZ)

[6,7]. It belongs to the cop operon, which also encodes

two copper ATPases, CopA and CopB, and a repressor

CopY. EhCopZ has been shown to transfer two copper

ions to CopY [8,9], thereby controlling the expression of

the cop operon. The 3D NMR structure of apo EhCopZ

has been resolved [10]. EhCopZ exhibits a ferredoxin-like

fold (babbab) in which the four b-strands and the two

a-helices are connected by loop regions exposed to the

solvent. The metal-binding site is located at the C-terminal

extremity of the first loop and on the first turn of helix a1

(Fig. 1). Its sequence is highly conserved in the family and

consists of a consensus motif MXCXXC. The binding of

the metal ion is mainly accomplished via the two sulfur

atoms of the side chain of the two cysteine residues Cys11

and Cys14. Surprisingly, various stoichiometries have been

reported so far for metal–chaperone complexes (Table 1).

Monomeric compounds have been found in the case of

BsCopZ–Cu (CopZ from Bacillus subtilis) [11] and with

the homologous proteins MerP–Hg [12], Atx1–Cu [13]

and Atx1–Hg [14], whereas dimers have been reported in

the case of EhCopZ–Cu [10] and BsCopZ–Cu [15,16] and

with the homologous protein HAH1 loaded with Cu, Cd

or Hg [17]. Therefore, it would be interesting to determine

the stoichiometry in solution of copper-loaded EhCopZ

as it may offer a molecular basis for the copper-transfer

mechanism from the copper chaperone to the target

protein.

Another relevant question is the selectivity of these

metallochaperones for different metals. As it is well known

that the MXCXXC motif can bind various metals [18], the

determinants of the selectivity of these proteins for a specific

ion remain poorly understood. For example, in vitro studies

have shown that MNKr2, a copper-binding subdomain of

the Menkes ATPase, is able to bind Ag(I) or Cu(I) but

Correspondence to L. Le Clainche, De

´partement d’Inge

´nierie et

d’Etudes des Prote

´ines, Direction des Sciences du Vivant,

CEA Saclay, 91191 Gif sur Yvette Cedex, France.

Fax: + 33 0169089071, Tel.: + 33 0169084215,

E-mail: leclainche@dsvidf.cea.fr

Abbreviations: EhCopZ, copper chaperone from Enterococcus hirae;

BsCopZ, copper chaperone from Bacillus subtilis;TCEP,

Tris(2-carboxyethyl)phosphine.

(Received 27 November 2003, revised 15 January 2004,

accepted 19 January 2004)

Eur. J. Biochem. 271, 993–1003 (2004) FEBS 2004 doi:10.1111/j.1432-1033.2004.04001.x

cannot bind a larger ion such as Cd(II), as is the case for the

protein HAH1 [19–21]. However, the metal-binding affinit-

ies of any copper chaperone for metal ions have not been

reported so far. Therefore, a study of the strength of

interaction of EhCopZ with different metals and a com-

parison with other proteins could provide a better under-

standing of this selectivity.

Here we describe a study of the binding of several metal

ions to the protein EhCopZ. The stoichiometry of the metal-

loaded chaperone was found to depend on the experimental

conditions used, especially the concentration of the protein

and the presence of an exogenous coordinating molecule.

The dissociation constants for cadmium, mercury and

cobalt were determined using fluorescence spectroscopy,

and the upper limit of the dissociation constant for copper

was also determined.

Materials and methods

Primer design for the synthetic gene

Ehcopz

Oligonucleotides (60-mer) were designed from the sequence

of the gene Ehcopz (E. hirae copZ) with optimized codons

for Escherichia coli; they were synthesized and purified by

MWG-Biotech. The six oligonucleotides used for the syn-

thetic gene construction were: copz-p1, (5¢-GGGCCGGC

GGCCATGGCTAAACAGGAATTCTCGGTTAAAGG

TATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACC

AACAGCTTCTTCGATACGAGCAACGCAGTGGT

TGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAA

GCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTT

AAAGTTCAGCTGAAGAAAGAAAAG-3¢); copz-ap4,

(5¢-GGTAGCCTGAACGTTAGCTTCGTCGAATTTAA

CAACAGCCTTTTCTTTCTTCAGCTGAAC-3¢); copz-

p5, (5¢-GAAGCTAACGTTCAGGCTACCGAAATCTG

CCAGGCTATCAACGAACTGGGTTACCAGGCT-3¢);

copz-ap6, (5¢-GGGCCGGCGCGGTTAGATCTAAGCT

TAGATAACTTCAGCCTGGTAACCCAGTTCGTT-3¢).

Primers 1, 3 and 5 corresponded to the coding strand,

respectively, for positions 1–54, 76–135, 154–213. Primers 2, 4

and 6 corresponded to the complementary strand, respect-

ively, for positions 34–93, 115–174, 193–220 of the coding

strand. Each primer overlapped the following one by 27

bases. Restriction sites for NcoIandBglII were introduced,

respectively, in the N-terminal primer copz-p1 and in the

C-terminal primer copz-ap6.

Fig. 1. 3D NMR structure of apo-EhCopZ (PDB ID: 1CPZ) and Cu(I)-loaded BsCopZ (PDB 10: 1K0V). apo-EhCopZ (right) BsCopZ (left).

Hydrogens have been omitted for clarity, and only one of the multiple structures is represented for both proteins. Selected bond (A

˚)andangles():

C13

–Cu 2.16, S

C16

–Cu 2.17, S

C13

–Cu–S

C16

, 115.31.

Table 1. Conditions used and observed stoichiometries for different metal–chaperone complexes. DTT, dithiothreitol, ICP-AES, inductively coupled

plasma-atomic emission spectrometry.

Protein

[Protein]

) Metal Buffer used Reducing agent

Stoichiometry

(metal:protein) Analytical method Reference

EhCopZ 5, 10 Cu, Cd Mops No 0.5 Fluorescence, CD, UV This work

EhCopZ 5, 10 Cu, Cd Mops TCEP 1 Fluorescence, CD, UV This work

EhCopz 0.5 Cd, Cu, Co, Hg Mops No 1 Fluorescence This work

EhCopZ 10 Cu Phosphate No 1 UV 9

BsCopZ 2000 Cu Phosphate DTT 0.77 ICP-AES 11

BsCopZ 300 Cu Mops No 0.5 Gel filtration 15

BsCopz 300 Cu Mops DTT 1 Gel filtration 15

MerP 1000 Hg Phosphate No 1 ICP-AES 12

yAtx1 2400 Cu, Hg Phosphate, Mes DTT removed 0.6–0.8 ICP-AES 25

yAtx1 100–400 Cu Tris/Mes

phosphate

No, DTT, GSH 1 ICP-AES 26

HAH1 500–1300 Cu, Cd, Hg Mes No 0.2–0.5 ICP-AES, X-Ray 17

994 A. Urvoas et al.(Eur. J. Biochem. 271)FEBS 2004

Construction of the synthetic gene

Ehcopz

and

expression vector PQE-

cop

The six oligonucleotides were assembled in a first PCR step.

The reaction was carried out in 25 lL, using 3 pmol of each

oligonucleotide, 0.2 m

each dNTP, 1·Pfu buffer and

1.75 U Pfu turbo (Stratagene). The assembling PCR was

performed in an MWG-Biotech Primus thermocycler with

the following program: 94 Cfor60 s;94Cfor45s,47C

for 30 s, 72 C for 15 s (55 times); and 72 C for 5 min. The

assembled fragment was amplified by a second PCR step.

The reaction was performed in 25 lL, using 7 pmol of

the N-terminal and C-terminal oligonucleotides (1 and 6),

0.2 m

each dNTP, 1·Pfu buffer, 1.75 U Pfu turbo

(Stratagene) and 1 lL of the previous PCR product. The

PCR program was: 94 C for 60 s; 94 C for 45 s, 47 Cfor

30 s, 72 C for 35 s (30 times); and 72 Cfor5min.After

analysis of the PCR product on a 1.6% (w/v) agarose gel in

a TAE buffer (40 m

Tris, 20 m

sodium acetate, 1 m

EDTA, pH 8.3), the 220-bp fragment of interest was

digested with NcoIandBglII, purified using a Nucleospin

extraction kit (Macherey Nagel) and ligated into PQE60

(Qiagen) digested with NcoIandBglII. The final construct

PQE-cop was verified by DNA sequencing. E. coli XL1 blue

(Stratagene) was used as the host strain for plasmid

propagation. The expected molecular mass calculated by

MassLynx from this sequence is thus 7592.9 Da. It is in

good agreement with the experimental molecular mass

found of 7592.3 ± 0.6 Da. It should be noted that the

calculated mass of Eh-CopZ in the NCBI database (acces-

sion No. 1361370) is 7521.8 Da. The 71-Da difference

between this value and the experimental mass is due to the

insertion of an N-terminal alanine during the primer design

for the plasmid construction.

Expression and purification of recombinant EhCopZ

E. coli M15 (Qiagen) was used as the host strain for the

expression of EhCopZ. The cells were grown at 37 Cin

Luria–Bertani medium containing 200 mgÆL

ampicillin

and 25 mgÆL

kanamycin to an absorbance of 0.6 at

600 nm. Protein expression was induced by the addition of

isopropyl b-

-thiogalactoside to a final concentration of

200 l

, and the cells were further incubated for 4 h. The

cells were harvested, resuspended in 50 m

sodium phos-

phate, pH 7.2, containing 5% glycerol, 2 m

EDTA, 5 m

dithiothreitol, and lysed by Eaton pressure cell. The cell

extract was incubated for 1 h at 4 Cwith1m

phenyl-

methanesulfonyl fluoride, DNase I and RNase. After

filtration on a 0.45-l

nitrocellulose membrane, it was

loaded on to a 3 ·10 cm S15 Sepharose fast flow column

(Pharmacia) equilibrated in buffer A (50 m

sodium

phosphate, pH 7.2). EhCopZ was eluted with a linear

gradient (0–1

) of NaCl in buffer A. The EhCopZ

fractions were pooled and concentrated to less than 5 mL

with an Amicon YM3 membrane, and stored at )20 C

after the addition of 2 m

dithiothreitol. The purity was

checked by SDS/PAGE on 20% (w/v) polyacrylamide

gels after silver staining. Gel filtration was performed to

exchange the buffer before functional characterization of

the protein.

Protein and metal quantification for titration

experiments

Ameane

280

of 2000

Æcm

was determined by amino-

acid quantification for EhCopZ in buffer C (20 m

Mops, 150 m

NaCl, pH 7.2) used for fluorescence

experiments. Protein concentration was then measured

using the UV absorbance at 280 nm for all titration

experiments. All metal solutions were prepared in water

except for Cu(I)Cl which was prepared as a 4 m

solution in acetonitrile or 0.1

HCl/1

NaCl [22].

Tris(2-carboxyethyl)phosphine (TCEP) was prepared in

the buffer used for the titration.

Metal titration by fluorescence

Fluorescence measurements were performed with a Cary

Eclipse spectrofluorimeter (Varian) in a thermostatically

controlled cell holder, using a 1-cm-path-length quartz cell.

All the experiments were carried out under argon. The

spectra were recorded with a bandwidth of 5 nm for both

excitation and emission beams at a scan rate of 250 nmÆ-

min

. Intrinsic protein fluorescence measurements were

recorded at 22 C between 260 and 400 nm using an

excitation wavelength of 278 nm. The protein was reduced

in 5 m

dithiothreitol and desalted by gel filtration on

Superdex 75 (Pharmacia) in buffer C (20 m

Mops,

150 m

NaCl, pH 7.2) or in the appropriate buffer for

further functional characterization (NaHCO

). The fluor-

escence emission spectrum of EhCopZ exhibited a maxi-

mum at 305 nm, which is consistent with its single tyrosine

Tyr63. Typically 500 lLof5 l

,0.5 l

or 50 n

EhCopZ

in buffer C was titrated with additions of 0.5–1 lLCdCl

the appropriate concentration. In some experiments, TCEP

was added as a reducing agent. As no effect of CuCl, HgCl

or CoCl

was detected with direct fluorescence measure-

ments, the titration of these metals was performed by

competition in the presence of Cd. Equilibrium was

established within 2 min of the addition of the metal.

The data corresponding to the titration of EhCopZ with

cadmium were fitted using either the binding isotherm or a

Scatchard plot. In the first case, the isotherm corresponds to

the equilibrium: CopZ + Cd «CopZ–Cd. At equilib-

rium, the law of mass action gives:

Kd¼ð½CopZ½CdÞ=½CopZCdð1Þ

The fluorescence intensity of the protein can be written as:

I¼Imax½CopZCd=½CopZ0ð2Þ

where [CopZ]

is the initial protein concentration and I

max

maximum intensity corresponding to 100% of the complex

in solution. At equilibrium, the concentrations in solution

can be expressed as:

½CopZ¼½CopZ0½CopZCd;

½Cd¼½Cdi½CopZCdð3Þ

where [Cd]

is the concentration of added cadmium in

solution. Inserting Eqn (3) into Eqn (1) leads to the

equation:

FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 995

½CopZCd2ð½CopZ0þ½CdiþKdÞ½CopZCd

þ½CopZ0½Cdi¼0

which can be combined with Eqn (2) to give:

I¼ð1=2½CopZ0ÞImax  ðð½CopZ0þ½CdiþKdÞ

 fð½CopZ0þ½CdiþKdÞ24½CopZ0½Cdig1=2Þ

A Scatchard plot is obtained by calculating the free and

bound cadmium concentration at equilibrium with the

following expressions:

½Cdfree ¼½CdI½CopZ0ðII0Þ=ðImax I0Þ;

½Cdbound ¼½CopZ0ðII0Þ=ðImax I0Þ

where I

and I

max

are, respectively, the initial and maximal

fluorescence intensities.

CD spectroscopy measurements

CD measurements of EhCopZ were recorded on a JS 810

spectropolarimeter (Jasco). The scans were recorded using a

bandwidth of 2 nm and an integration time of 1 s at a scan

rate of 100 nmÆmin

. For near-UV measurements between

250 nm and 310 nm, a 1-cm-path-length quartz cell con-

taining 2 mL protein sample was used. A total of 20 scans

were recorded and averaged for each sample. All resultant

spectra were baseline subtracted. Aliquots of volume

200 lL of these protein sample solutions were used for

far-UV measurements between 190 nm and 250 nm in a

1-mm-path-length quartz cell. A total of 10 scans were

recorded and averaged for each sample.

Protein samples of concentration 20 l

were prepared in

an anaerobic atmosphere in 40 m

Mops/10 m

NaCl,

pH 7.0. CD spectra were recorded after each addition of

1lL metal aliquots. The total volume added to the 2 mL-

buffered protein solution was less than 20 lLofthemetal

stock solution. The titration experiment was performed

under argon. The pH and ionic strength of the reaction

mixture remained unchanged throughout the titration.

UV-vis absorption spectra

UV-vis absorption spectra were recorded on a Lambda 35

spectrophotometer (Perkin–Elmer) using a 1-cm-path-

length quartz cell. Protein samples of 10 l

or 20 l

apo-EhCopZ were prepared in buffer C. Optical spectra

were recorded from 190 to 700 nm after each TCEP, GSH

or metal addition. Corrected spectra were obtained after

baseline subtraction.

Sample preparation for electrospray ionization (ESI)-MS

analysis

For functional ESI-MS analysis under nondenaturing

conditions, the protein samples were thawed on ice, reduced

with 5 m

dithiothreitolanddesaltedbygelfiltrationona

Superdex 75 column (Pharmacia) equilibrated in freshly

prepared 20 m

HCO

, pH 8.0. The fractions collec-

ted were freeze-dried and stored under argon at 4 Cbefore

use. The protein was suspended in MS buffer (4 m

HCO

, pH 8.0), centrifuged (7200 g) and quantified.

For the functional ESI-MS study, the samples were

prepared as 50 lL aliquots of 15 l

EhCopZ in 4 m

HCO

(pH 8.0)/15% methanol with the appropriate

metal or GSH concentrations.

ESI-MS measurements

ESI mass spectra were acquired using a Micromass

Q-TOFII instrument under control of the MassLynx 3.5

data acquisition and analysis software (Micromass Ltd,

Manchester, UK). The MS buffer was used as the

electrospray carrier solvent. Samples were introduced into

the ion source at a flow rate of 10 lLÆmin

,andmass

spectra were acquired from m/z 400–2200 in positive

ionization mode with a scan time of 5 s. External calibration

of the mass scale was performed with horse heart myoglobin

(Sigma). The spectra were analyzed with

MASSLYNX

3.5.

Light-scattering measurements

Dynamic light-scattering data were obtained with the

DynaPro-801 instrument (Protein Solutions Inc, High

Wycombe, Bucks, UK) using a 30 mW, 833 nm wave-

length argon laser at 22 C and equipped with a solid-state

avalanche photodiode. During illumination, the photons

scattered by proteins were collected at 90 Cona10s

acquisition time and were fitted with the analysis software,

DYNAMICS

. Intensity fluctuations of the scattered light

resulting from Brownian motion of particles were analyzed

with an autocorrelator to fit an exponential decay function

and then measuring a translational diffusion coefficient D.

For polydisperse particles, the autocorrelation function was

fitted as the sum of contributions from the various size

particles using the regularization analysis algorithm. Dis

converted into a hydrodynamic radius Rthrough the

Stokes–Einstein equation (R¼k

T/6pgDwhere grepre-

sents the solvent viscosity, k

the Boltzmann constant, and

Tthe temperature). Ris defined as the radius of a

hypothetical hard sphere that diffuses with the same speed

as the particle under examination. However, the particle

may be nonspherical and solvated. Therefore, the molecular

mass Mof a macromolecule is estimated using Mvs. R

calibration curves developed from standards of known

molecular mass and size. Thus, the estimated mass of a

given particle is subjected to error if it deviates from the

shape and solvation of the molecules used as standards

(globular proteins). The molecular mass for a protein is

estimated from the curve that fits the equation

M¼(1.68 ·R)

2.3398

as implemented in the

DYNAPRO

software.

Results

The analysis of the 3D structure of EhCopZ shows that

Cys11 and Cys14 were at 5.73 A

˚Ca–Cadistance. This

value is within the range of the average Ca–Cadistance of

bridged cysteine residues generally found in proteins [23].

The spatial proximity between the two cysteine residues

could make the protein very sensitive to oxidation. While

these two residues are involved in the metal-binding site, it is

crucial that the protein remains reduced throughout the

experiment. A control experiment was performed under

996 A. Urvoas et al.(Eur. J. Biochem. 271)FEBS 2004

conditions favorable to oxidation: an apoprotein sample

was left under aerobic conditions for 2 h and the free-thiol

quantification using Ellman’s reagent showed that less than

8% of the protein was oxidized. Consequently, all the

experiments described hereafter were performed within 2 h

under argon to further minimize CopZ oxidation.

Interaction between copper and EhCopZ

In a first set of experiments the binding of copper to the

chaperone was studied using CD and UV-vis spectroscopy.

To a 20 l

solution of apo-EhCopZ in 40 m

Mops/

10 m

NaCl, pH 7, were added aliquots of a solution of

Cu(I), stabilized using 0.1

HCl, under anaerobic condi-

tions [22]. The far-UV region of the CD spectrum displayed

no significant modification on the addition of the metal,

indicating that the global fold of the protein was preserved

throughout the titration. The dichroic signal at 265 nm

increased with the concentration of copper, as could be

expected with a change in the hydrophobicity of the local

environment of Tyr63 and/or a contribution of the binding

of the copper to the thiolates of the protein. A plot of the

intensity of the signal at 265 nm against the concentration

of added copper showed that a plateau was reached when

0.5 equivalents of copper had been added, compatible with

a 2 : 1 EhCopZ–Cu complex (Fig. 2). The UV-vis spectrum

of the reaction mixture in the presence of the metal ion

exhibited strong absorption at 260 nm compatible with a

metal to ligand charge transfer band (data not shown). The

intensity of this band increased with the concentration of

added copper in solution, and the plot of A

260

vs. concen-

tration of copper indicated in this case also a 2 : 1 EhCopZ/

Cu ratio.

This result is in contrast with the 1 : 1 stoichiometry

reported for a similar UV-vis experiment described previ-

ously [9]. Several hypotheses were explored to explain this

difference. As mentioned above, experiments were per-

formed under conditions in which the oxidation of EhCopZ

is not significant. Partial oxidation of the protein can

thereforebeexcludedtoexplainthe2:1proteintometal

stoichiometry.

Although precautions were taken to avoid any oxidation

of the metal, a change in the oxidation state of the metal

may be responsible for this unexpected stoichiometry. The

CD experiment described above with Cu(I) was therefore

repeated with Cu(II) in order to study the influence of the

oxidation state of copper on the complex stoichiometry. The

spectra showed an increase in the signal of the tyrosine at

265 nm with increasing concentrations of copper up to a

plateau reached for 0.5 molar equivalents of Cu(II) added

per protein. A similar experiment was described by Kihlken

et al. [15] with BsCopZ. It was shown that Cu(II) was

reduced to Cu(I) on coordination to the protein. A similar

process cannot be excluded in our case. However, no

difference in stoichiometry in the complex was detected

using either Cu(I) or Cu(II). SDS/PAGE analysis of

EhCopZ was performed under nondenaturing conditions

for the protein in the presence of increasing copper

equivalents. A band corresponding to the molecular mass

expected for a dimer appeared in the presence of the metal,

confirming the dimeric nature of the EhCopZ–Cu (Fig. 3).

Lastly, in previous studies [11,15,24–26], reducing mole-

cules such as dithiothreitol or TCEP were added in the

solution of copper chaperone to prevent the formation

of the disulfide bridge. The interaction of such a small

organic molecule present in the solution with the metal

center could greatly influence the stoichiometry by changing

the form of the complex. As these compounds can compete

with the protein to bind the metal ion, their influence on the

stoichiometry of the complex EhCopZ–metal was studied.

Cadmium was substituted for copper to avoid any redox

reaction involving the metal ion. Although Cd(II) is not a

usual substitute for Cu(I), the available 3D structures of a

homologous protein, HAH1, show that the copper-loaded

and cadmium-loaded structures of the chaperone are very

similar (PDB ID: 1FEE and 1FE0, respectively [17]).

Moreover, the single tyrosine Tyr63 located on loop 5

at the beginning of the last strand b4 is close to the

Fig. 2. CD titration of EhCopZ against Cu(I). CD spectra of EhCopZ

(20 l

;40m

Mops/10 m

NaCl, pH 7) in the presence of Cu(I)

(from top to bottom) at 0, 2, 4, 6, 8, 10, 12, 16, 20 l

. The insert shows

the plot of the intensity of the dichroic signal at 265 nm vs. the con-

centration of introduced copper.

Fig. 3. SDS/PAGE analysis of the protein EhCopZ in the presence of

various concentrations of copper. Left lane, MultiMarkMulti-

Colored standard (Invitrogen); lane 1, apo-EhCopZ; lane 2, in the

presence of 1 equivalents CuCl

; lane 3, in the presence of 4 equiva-

lents CuCl

. Experiments were performed with a solution of 25 l

EhCopZ in 20 m

Mops/150 m

NaCl,pH 7.2.The6·sample buffer

was:glycerol50%,BromophenolBlue0.5%,MopspH7.Samples

containing 3 lg protein were loaded on a 4–12% NuPAGEBis/Tris

gel (Invitrogen). The electrophoresis was performed with a Mes run-

ning buffer (Invitrogen).

FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 997

Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae

Chủ đề:

Tài liệu liên quan

Tài liêu mới

AI tóm tắt

Giới thiệu tài liệu

Đối tượng sử dụng

Từ khoá chính

Nội dung tóm tắt

Hỗ trợ

Phương thức thanh toán

Theo dõi chúng tôi