TNU Journal of Science and Technology
230(01): 24 - 31
http://jst.tnu.edu.vn 24 Email: jst@tnu.edu.vn
CLONING AND DETERMINATION GENE SEQUENCES OF OUTER
MEMBRANE PROTEINS OmpK AND OmpU in Vibrio parahaemolyticus N9
Ngo Thi Huyen1, Dong Van Quyen1, Tran Ngoc Kien2, Pham Thi Tam3, Ngo Duc Manh4,
Le Thi Tuoi5, Vu Thi Bich Huyen5*
1Vietnam Academy of Science and Technology, 2Vinschool The Harmony
3Hanoi Open University, 4University of Science - Vietnam National University,
5Hanoi National University of Education
ARTICLE INFO
ABSTRACT
Received:
02/8/2024
Vibrio parahaemolyticus is one of the dangerous pathogens of aquatic
animals, including fish. The outer membrane proteins play an
essential role in bacterial virulence and are potential candidates for
vaccine development. In this study, the virulence of four V.
parahaemolyticus strains was studied, and the result was that strain.
The V. parahaemolyticus N9 has the strongest virulence with an LD50
of 106.15 CFU/mL. OmpK and OmpU genes from V. parahaemolyticus
N9 strain, which are coding for two outer membrane proteins. Two
genes were determined the sequence of the open reading frame (ORF)
with sizes of 819 bp (OmpK gene) and 1014 bp (OmpU gene),
respectively. In addition, we also successfully cloned these two
antigen genes OmpK and OmpU into pGEM-T and pCE2 TA vectors,
respectively. This is the first step in studying vaccine development
against diseases caused by V. parahaemolyticus in some marine fish
species.
Revised:
16/10/2024
Published:
17/10/2024
KEYWORDS
OmpK
OmpU
Vibrio parahaemolyticus
Cloning
Antigen
TÁCH DÒNG VÀ XÁC ĐỊNH VÙNG TRÌNH TỰ GENE KHÁNG NGUYÊN
MÃ HÓA PROTEIN MÀNG NGOÀI CỦA Vibrio parahaemolyticus N9
Ngô Thị Huyền1, Đồng Văn Quyền1, Trần Ngọc Kiên2, Phạm Thị Tâm3, Ngô Đức Mạnh4,
Lê Thị Tươi5, Vũ Thị Bích Huyền5*
1Viện Hàn lâm Khoa học và Công nghệ Việt Nam, 2Vinschool The Harmony,
3Trường Đại học Mở Hà Nội, 4Trường Đại học khoa học tự nhiên - ĐH Quốc gia Hà Nội,
5Trường Đại học Sư phạm Hà Nội
TÓM TẮT
Ngày nhận bài:
02/8/2024
Vibrio parahaemolyticus là một trong những tác nhân gây bệnh nguy
hiểm cho động vật thủy sản, trong đó có cá. Các protein màng ngoài
đóng vai trò quan trọng trong độc lực của vi khuẩn và là ứng cử viên
tiềm năng để phát triển vaccine. Trong nghiên cứu này, độc lực của
bốn chủng V. parahaemolyticus được nghiên cứu cho kết quả là
chủng V. parahaemolyticus N9 có độc lực mạnh nhất với LD50 là
106,15 CFU/ml. Gene OmpK và OmpU của chủng V.
parahaemolyticus N9 mã hóa các protein màng ngoài đã được xác
định trình tự khung đọc mở (ORF) có kích thước lần lượt là 819 bp
và 1014 bp. Ngoài ra, hai gene mã hóa kháng nguyên OmpK và
OmpU đã tách dòng thành công lần lượt trong vector pGEM-T và
pCE2 TA. Đây là bước đầu nghiên cứu phát triển vaccine phòng
bệnh do V. parahaemolyticus gây ra ở một số loài cá biển.
Ngày hoàn thiện:
16/10/2024
Ngày đăng:
17/10/2024
DOI: https://doi.org/10.34238/tnu-jst.10621
* Corresponding author. Email: huyenvtb@hnue.edu.vn
TNU Journal of Science and Technology
230(01): 24 - 31
http://jst.tnu.edu.vn 25 Email: jst@tnu.edu.vn
1. Introduction
Vibrio parahaemolyticus belongs to the group of gram-negative bacteria, commonly living in
estuaries and coastal areas of most seas in the world. It can be isolated from sand, mud, seawater,
and diseased aquatic products. V. parahaemolyticus is one of the main pathogens of aquatic
animals, appearing widely in seawater environments and isolated from diseased fish samples of
the following species: cod, sardine, mackerel, flounder, etc. [1]. Lopatek et al. (2018) isolated
104 V. parahaemolyticus strains from 595 aquatic species samples and evaluated their antibiotic
resistance. Among them, the isolated strains had high resistance rates to ampicillin (75%), and
streptomycin (68.3%) [2]. Similarly, Oh et al. (2011) evaluated the resistance to 15 types of
antibiotics of 218 strains of V. parahaemolyticus isolated from several farmed fish species in
2005 - 2007. The results showed that the resistance rate to ampicillin is the highest at 57.8%,
rifampin (11.9%), and streptomycin (8.7%) [3]. In 2015, Letchumanan et.al evaluated the
antibiotic resistance of 200 V. parahaemolyticus samples isolated from shellfish in Malaysia.
Results show resistance rates to ampicillin (88%), amikacin (81%), cefotaxime (73%),
kanamycin (70.5%), and ceftazidime (51.5%) [4]. In Vietnam, Vu Thi Thu Tra et al. (2022)
reported on the antibiotic resistance situation of V. parahaemolyticus isolated from seafood
purchased at markets in Hanoi showing that 81.43% were resistant to ampicillin, cefotaxime
(11.43%), ceftazidime (11.43%), trimethoprim-sulfamethoxazole (8.57%) and tetracycline
(2.86%) [5]. Similarly, Truong Thi My Hanh et al. (2016) isolated nine strains of V.
parahaemolyticus from shrimp infected with AHPND in Quynh Luu, Nghe An, here, an
investigation of 34 farming households showed that farming households used at least ten types of
antibiotics in two forms: feeding and dissolving in water. Nine V. parahaemolyticus strains were
resistant to ampicillin (100 %), neomycin (90.09%), erythromycin (66.7%), and tetracycline
(55.6%). Of these, 33.3% of strains were resistant to four types of antibiotics; 22.2% of strains
were resistant to six antibiotics and 11.1% of strains were resistant to five antibiotics [6]. Nguyen
Cong Trang et al. (2019) evaluated the antibiotic resistance of V. parahaemolyticus strains
isolated from pond mud, pond water, river water, and diseased shrimp to 17 types of antibiotics.
The results showed that species show the highest resistance rate to apramycin antibiotics of
73.3% [7]. Huyen et al. (2022) isolated strains of Vibrio spp. from aquaculture water in some
areas of the Northern coastal provinces showing antibiotic resistance rates in ampicillin (100%),
amoxicillin (98.84%), streptomycin (84.88%), oxytetracycline (69, 77%) and the lowest
resistance rate was with phenicol antibiotics including chloramphenicol (32.56%) and florfenicol
(31.4%) [8].
Currently, using antibiotics to control and treat diseases caused by Vibrio spp. in aquatic
animals is a popular, fast, effective, and low-cost method [9], [10]. However, the overuse of
antibiotics and improper use of antibiotics has led to a high rate of antibiotic-resistant bacteria.
Moreover, antibiotic residues in aquatic products affect consumer health [10], [11]. Therefore,
using vaccines to prevent diseases is effective but also helps sustainably develop the aquaculture
industry.
Several types of vaccines to prevent diseases caused by bacteria have been researched and
used for aquaculture such as inactivated vaccines, live attenuated vaccines, subunit vaccines,
recombinant vaccines, DNA vaccines, and total combination/peptide vaccines [12]. Cai et al.
(2010) suggested that outer membrane proteins play an essential role in bacterial virulence and
are potential candidates for vaccine development [13]. Research on the ability of OmpU to create
an immune response in red snapper (Lutjanus erythropterus) shows a high protection rate
(96.43%), with up to 92% similarity to the OmpU protein of another Vibrio spp. Another study
on the ability of the gene encoding the OmpK protein in yellow croaker to create an immune
response showed a protection rate of up to 79.2%. Similarly, Mao et al. (2007) successfully
cloned, expressed, and evaluated the immunogenicity of five outer membrane proteins OmpW,
TNU Journal of Science and Technology
230(01): 24 - 31
http://jst.tnu.edu.vn 26 Email: jst@tnu.edu.vn
OmpV, OmpU, OmpK, and TolC of V. parahaemolyticus zj2003. In particular, the OmpU and
OmpK genes have sizes of 961 bp and 776 bp, respectively, with a protection rate of up to 90%
[14]. Studies show that OmpK and OmpU are potential candidates for vaccine development [13],
[15]. The research results are the first step for research into creating vaccines from genes
encoding outer membrane proteins to prevent disease caused by V. parahaemolyticus in some
marine fish species.
2. Materials and Methods
2.1. Materials
Four strains of Vibrio parahaemolyticus bacterial (QN4, H5, N9, T4) were provided from the
Genetics - Biochemistry Laboratory, Faculty of Biology, Hanoi University of Education.
Bacterial strain Escherichia coli DH5α, E. coli BL21 (DE3), vector pGEM-T-Easy (Promega),
vector pCE2 TA/Blunt-Zero (Vazyme, China), DNA-spinTM Plasmid DNA Purification kit
(iNtRON).
2.2. Methods
2.2.1. Method of determining LD50 value
The LD50 was determined by following the method of Reed and Muench (1938) [16]. Each
group consisted of 30 Epinephelus coioides fish. Group of control were injected with 0.1 mL of
sterile PBS (pH 7.4). Nine experimental groups were injected with 0.1 mL of bacteria from 101 to
109 CFU/mL, respectively. Fish were kept for 2 weeks and observed pathological manifestations.
LD50 =Mortalities above 50% −50
Mortalities above 50% − Mortalities below 50%
2.2.2. Method for determining antigen genes
The bacterial strain V. parahaemolyticus was cultured in LB medium supplemented with 1.5%
NaCl, at 28oC, 180 rpm, for 12 - 16 hours (OD600 = 0.8 - 1.0). Bacterial DNA was extracted using
G-spinTM Total DNA Extraction Mini Kit (Intron, Korea) according to the manufacturer's
instructions.
The gene segment encoding the OmpK and OmpU proteins was amplified from V.
parahaemolyticus N9 strain by PCR using a pair of specific primers with the recognition site of
the enzyme BamHI in the forward primer and HindIII in the reverse primer. Primer sequences are
shown in Table 1, and enzyme restriction sites are underlined.
Table 1. Designing primers pairs for PCR reaction
Primer
Sequence (5’ – 3’)
Size (bp)
Annealing
Temperature
OmpK-N9
F: TGGATCCATGCGTAAATCACTTCTAGCTC
R: TAAGCTTTTAGAACTTGTAAGTTACTGCTACG
819
56
OmpU-N9
F: TGGATCCATGAAAAAGACTCTAATTGC
R: TAAGCTTAGAAGTCGTAACGTAG
1014
56
The PCR reaction was run in a total volume of 50 µL including 25 µL Master mix 2X, 1 µL
forward primer, 1 µL reverse primer, 1 µL DNA, 22 µL H2O. The PCR program is conducted
according to a thermal cycle: denaturation for 5 minutes at 95oC, 30 subsequent cycles: 95oC/30s,
56oC/30s, 72oC/1 minutes, chain extension at 72oC/5 minutes and 25oC /5 minutes.
Nucleotide sequences were analyzed using the BLAST tool on NCBI and CLC Genomics
Workbench 5.
2.2.3. Method of cloning antigen genes
TNU Journal of Science and Technology
230(01): 24 - 31
http://jst.tnu.edu.vn 27 Email: jst@tnu.edu.vn
PCR products were purified with DNA-spinTM Plasmid DNA Purification Kit (Intron, Korea)
and ligated into cloning vector pGEM-T easy (Promega) and pCE2 TA/Blunt-Zero then
transformed into E. coli DH5α. Colonies were selected on LB medium supplemented with
ampicillin (100 µg/mL) for pGEM®-T Easy Vector and kanamycin (50 µg/mL) for pCE2
TA/Blunt-Zero, Xgal (40 mg/mL), IPTG (400 mg/mL). Plasmid pGEM-T easy carrying the
antigen gene was cut for testing with the restriction enzymes BamHI and HindIII and determined
antigen the sequence.
3. Results and Discussion
3.1. Determining LD50 value
The virulence characteristics of the isolated bacteria were determined by their LD50 values in
E. coioides. The results are displayed in Figure 1.
Figure 1. Cumulative mortality rates of E. coioides after infections
As a result, LD50 values were derived from these cumulative mortality rates. The outcomes of
the LD50 calculations are shown in Table 2.
Table 2. LD50 values of four strains of V. parahaemolyticus
Strain
N9
T4
QN4
H5
LD50
106.15
107.24
107.47
108.10
Figure 2. Pictures of dead E. coioides after infection
Table 2 and Figure 1 indicate that the LD50 values of the four bacterial strains N9, T4, QN4,
and H5 are 106.15, 107.24, 107.47, and 108.10, respectively. Strain N9 has the lowest LD50 value,
making it more toxic than the other three strains. Khouadja et al. (2013) assessed the virulence of
V. parahaemolyticus strains isolated from infected sea bass and found LD50 values ranging from
3.52×104 CFU/mL to 2.29×106 CFU/mL [17]. Similarly, Marudhupandi et al. (2017) isolated V.
parahaemolyticus causing disease in aquarium fish Amphiprion sebae and determined the LD50
value to be 1×105 CFU/mL [17].
Based on the LD50 value, the V. parahaemolyticus N9 strain has the lowest value and should
be selected as the cloning material for developing a vaccine to prevent Vibriosis in marine fish.
TNU Journal of Science and Technology
230(01): 24 - 31
http://jst.tnu.edu.vn 28 Email: jst@tnu.edu.vn
3.2. Determine the antigen gene sequence
Amplify the OmpK and OmpU gene segments of the bacterial strains V. parahaemolyticus N9
with a pair of specific primers that have the recognition sites of the BamHI and HindIII enzymes
attached to the 5' ends of the respective forward and reverse primers. The PCR products were
tested by electrophoresis on agarose gel before gene sequencing in Figure 3.
Figure 3. Electrophoresis of gene PCR products
M: DNA ladder 10 kb (Bioline, Germany); 1: OmpU-A2 (~1014 bp); 2: OmpK-N9 (~819 bp)
Electrophoresis results showed that the PCR product had a single band with a size equivalent
to the theoretically predicted size of the OmpU gene (~ 1014 bp) and OmpK gene (~ 819 bp) of
V. parahaemolyticus N9. The PCR product was then purified, and nucleotide sequenced. When
comparing the nucleotide sequences of the above two genes with the OmpU and OmpK gene
sequences on the gene bank (Genbank) using the BLAST tool, the similarity is up to 99%. This
proves that our primer designed to amplify genes is suitable and confirms that we have
successfully amplified the OmpU gene and OmpK gene from the isolated bacterial strain V.
parahaemolyticus N9.
3.3. Separation of antigen genes
Figure 4. Representative electrophoresis results of recombinant plasmid cutting products pGEM-K and
pCE2-U carrying foreign genes, using restriction enzymes BamHI and HindIII
M. DNA ladder 10 kb (Bioline); 1. Plasmid pGEM-K; 2. Plasmid pCE2-U