Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells

Implications for their paracrine roles

Zongwei Li, Hua Wei, Linzi Deng, Xiangfeng Cong and Xi Chen

Research Center for Cardiac Regenerative Medicine, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China

Keywords IL-10; IL-1b; mesenchymal stem cell; paracrine; TNF-a

Correspondence X. Chen; X. Cong, Research Center for Cardiac Regenerative Medicine, The Ministry of Health, Cardiovascular Institute & Fu Wai Hospital, Chinese Academy of Medical Sciences & Peking Union Medical College, 167 Beilishilu, Beijing 100037, China Fax ⁄ Tel: +86 10 88398584 E-mail: chenxifw@yahoo.com.cn; xiangfeng_cong@yahoo.com.cn

(Received 26 April 2010, revised 27 June 2010, accepted 10 July 2010)

doi:10.1111/j.1742-4658.2010.07770.x

To understand the potential paracrine roles of interleukin-1b (IL-1b), tumour necrosis factor-a (TNF-a) and interleukin-10 (IL-10), the expres- sion and secretion of these factors by rat bone marrow-derived mesenchy- mal cells stimulated by hypoxia (4% oxygen) and serum deprivation (hypoxia ⁄ SD) were investigated. We found that hypoxia ⁄ SD induced nuclear factor kappa Bp65-dependent IL-1b and TNF-a transcription. Fur- thermore, hypoxia ⁄ SD stimulated the translation of pro-IL-1b and its processing to mature IL-1b, although the translation of TNF-a was unchanged. Unexpectedly, the release of IL-1b and TNF-a from hypox- ia ⁄ SD-stimulated mesenchymal cells was undetectable unless ATP or lipo- polysaccharide was present. This result suggests that IL-1b and TNF-a are not responsible for the paracrine effects of mesenchymal cells under ischae- mic conditions. We also found that hypoxia ⁄ SD induced the transcription and secretion of IL-10, which were significantly enhanced by lipopolysac- charide and the proteasomal inhibitor MG132. Moreover, both the condi- tioned medium from hypoxia ⁄ SD-stimulated mesenchymal cells (MSC-CM) and IL-10 efficiently inhibited cardiac fibroblast proliferation and collagen expression in vitro, suggesting that mesenchymal cell-secreted IL-10 pre- vents cardiac fibrosis in a paracrine manner under ischaemic conditions. Taken together, these findings may improve understanding of the cellu- lar and molecular basis of the anti-inflammatory and paracrine effects of mesenchymal cells.

Introduction

Abbreviations BrdU, 5-bromodeoxyuridine; DMEM, Dulbecco’s modified Eagle’s medium; ELISA, enzyme-linked immunosorbent assay; ERK, extracellular signal-regulated kinase; hypoxia ⁄ SD, hypoxia and serum deprivation; IL, interleukin; IMDM, Iscove’s modified Dulbecco’s medium; LPS, lipopolysaccharide; MSCs, mesenchymal stem cells; NF-jBp65, nuclear factor kappa Bp65; p38, p38 mitogen-activated protein kinase; TNF-a, tumour necrosis factor-a.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3688

Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell transplantation as an alternative treatment for heart disease. Bone marrow-derived mesenchymal stem cells (MSCs) are easily obtainable and expandable, multipotent progeni- tor cells [1] that have emerged as attractive candidates for cellular therapies for heart and other organ-system disorders [2]. Although several mechanisms have been proposed for the cardioprotective effects of MSCs, including cardiomyocyte regeneration, spontaneous cell fusion and paracrine action [3], there is a growing

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

[17]. However, it

body of evidence supporting the hypothesis that para- crine mechanisms mediated by MSC-secreted factors play an essential role in the reparative process [4,5]. is not endogenous macrophages known whether MSCs can secrete IL-10 under ischae- mic conditions, resulting in a paracrine anti-fibrotic effect in the heart.

exerting paracrine anti-fibrotic

investigated. Our also

It has been reported that MSC-conditioned medium under normoxic conditions significantly attenuates car- diac fibroblast proliferation and type I and III collagen expression, effects. However, researchers did not analyse the active compo- nents of the conditioned medium [6]. Other researchers have suggested that adrenomedullin and hepatocyte growth factor are paracrine factors secreted by trans- planted MSCs, decreasing myocardial fibrosis [7–9]. Whether other paracrine factors released by MSCs mediate these cells’ anti-fibrotic effects remains largely unknown.

secrete

To assess the paracrine effects of IL-1b, TNF-a and IL-10 released by MSCs on cardiac remodelling under ischaemic conditions, conditioned medium from MSCs (MSCs-CM) was collected during hypoxia and serum deprivation (hypoxia ⁄ SD). This medium was used to treat cardiac fibroblasts, enabling observation of the paracrine effects of MSCs. The expression and secre- tion of IL-1b, TNF-a and IL-10 by hypoxia ⁄ SD-stimu- data lated MSCs were demonstrate that MSCs-CM can inhibit cardiac fibro- blast proliferation and collagen synthesis, with < 30 kDa molecules as its major active components. IL-1b and TNF-a under MSCs did not hypoxia ⁄ SD conditions, although MSC-secreted IL-10 hindered cardiac fibroblast proliferation and collagen expression. These findings suggest that IL-10 may be an important paracrine, anti-fibrotic mediator secreted by MSCs.

Results

MSCs-CM inhibits cardiac fibroblast proliferation and collagen synthesis

Interleukin-1b (IL-1b) and tumour necrosis factor-a (TNF-a) are present in the tissues or systemic circula- tion in many inflammatory conditions. It has also been reported that the expression of IL-1b and TNF-a in MSCs can be augmented by exposure to hypoxia [5]. Furthermore, IL-1b can induce cardiomyocyte growth but inhibits cardiac fibroblast proliferation in culture [10]. By contrast, MSC transplantation in rat models of myocardial infarction has anti-inflammatory effects, decreasing protein production and gene expression for IL-1b and TNF-a [11]. To address these paradoxes of both pro- and anti-inflammatory effects, the secretion of IL-1b and TNF-a from MSCs under ischaemic con- ditions must be further characterized.

The effects of MSCs-CM on cardiac fibroblast prolifer- ation and collagen synthesis were detected by [3H]-thy- midine and [3H]-proline incorporation. As shown in Fig. 1A, MSC-CM treatment significantly inhibited [3H]-thymidine and [3H]-proline incorporation under normoxic or hypoxic culture conditions. To further clarify the molecular mass range of important active factors in the MSCs-CM, the medium was divided into IL-10 is an anti-inflammatory cytokine that has been reported to be involved in the immunomodulation mediated by transplanted MSCs [12,13]. IL-10 is also a potential anti-fibrotic factor in the liver and kidney [14–16]. In addition, the protective effect of MSCs against sepsis is dependent on IL-10, which is not directly produced by the injected MSCs but rather by

A

B

Fig. 1. MSCs-CM inhibits cardiac fibroblast proliferation and collagen synthesis. (A) The effects of MSCs-CM on the incorporation of [3H]-thy- midine and [3H]-proline by cardiac fibroblasts under normoxic or hypoxic conditions. Each data point represents the mean ± SEM of at least three independent experiments. ***P < 0.001 versus normoxic control (Cont) group; ###P < 0.001 and ##P < 0.01 versus hypoxic control (Cont + h) group. (B) The effects of the > 30 kDa and < 30 kDa components of MSCs-CM on the incorporation of [3H]-thymidine and [3H]-proline by cardiac fibroblasts under normoxic or hypoxic conditions. ***P < 0.001 versus Cont group; ###P < 0.001 versus Cont + h group.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3689

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

hypoxia simply augmented this effect whereas (Fig. 2B).

the > 30 kDa components, of

> 30 and < 30 kDa components using a 30 kDa molecular mass cut-off ultrafiltration membrane. Frac- tionation revealed that the < 30 kDa components, but not the MSCs-CM inhibited cardiac fibroblast proliferation and collagen synthesis (Fig. 1B).

Hypoxia ⁄ SD induces NF-jB-dependent IL-1b and TNF-a transcription

It has been reported that the nuclear factor-jB (NF- jB) signalling pathway plays an important role in reg- ulating IL-1b and TNF-a transcription [18,19]. To investigate the role of this pathway in hypoxia ⁄ SD- induced transcription, MSCs were exposed to BAY 11-7082, an NF-jB pathway inhibitor, followed by hypoxia ⁄ SD for 6 h. As shown in Fig. 2C, the tran- scription of IL-1b and TNF-a was significantly attenu- ated by BAY 11-7082. Interestingly, the proteasomal inhibitor MG132 also abrogated hypoxia ⁄ SD-induced IL-1b and TNF-a transcription.

Because transcription of IL-1b and TNF-a can be aug- mented in MSCs by hypoxia [5], and because the molecular masss of IL-1b and TNF-a are both 17 kDa (< 30 kDa), changes in IL-1b and TNF-a gene tran- scription in hypoxia ⁄ SD-stimulated MSCs were exam- ined. As shown in Fig. 2A, the increased transcription of IL-1b and TNF-a occurred after 3 h of hypoxia ⁄ SD with a gradual increase up to 6 h, after which tran- scription decreased. We also found that transcription of IL-1b and TNF-a was mainly induced by SD, Next, to clarify the mechanism by which the NF-jB pathway induces IL-1b and TNF-a transcription, the nuclear translocation of NF-jBp65 was assessed by immunocytochemical staining. As shown in Fig. 2D, NF-jBp65 was mainly distributed in the cytoplasm of control cells. By contrast, hypoxia ⁄ SD treatment significantly stimulated the nuclear translocation of

A

B

C

D

Fig. 2. Hypoxia ⁄ SD induces NF-jB-dependent IL-1b and TNF-a transcription. (A) MSCs were incubated under hypoxia ⁄ SD conditions for the indicated number of hours, and the relative mRNA levels of IL-1b and TNF-a were determined by real-time PCR. The data are the mean ± SEM of at least three independent experiments. *P < 0.05 and **P < 0.01 versus control group (0 h). (B) The relative mRNA levels for IL-1b and TNF-a in MSCs after hypoxia, SD or hypoxia ⁄ SD for 6 h by real-time PCR. **P < 0.01 versus Cont group; #P < 0.05 versus SD group. (C) MSCs were exposed to BAY 11-7082 or MG132, followed by hypoxia ⁄ SD for 6 h and detection of relative mRNA levels of IL-1b and TNF-a by real-time PCR. *P < 0.05 and **P < 0.01 versus hypoxia ⁄ SD treatment group. (D) A representative pattern of the nuclear translo- cation of NF-jBp65, as assessed by immunocytochemical staining of MSCs using anti-(NF-jBp65 primary Ig) (red) and nuclear labelling with 4¢,6-diamidino-2-phenylindone (blue).

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3690

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

was inhibited by 60%, although TNF-a transcription was not affected (Fig. 3B). Like BAY 11-7082, U0126 could also inhibit NF-jBp65 nuclear translocation (Fig. 3C), suggesting that hypoxia ⁄ SD-induced activa- tion of the NF-jB signalling pathway depends on the ERK1 ⁄ 2 signalling pathway.

NF-jBp65, indicated by strong immunostaining in the nucleus. Pretreatment with BAY 11-7082 inhibited hypoxia ⁄ SD-induced NF-jBp65 translocation, with substantial levels of NF-jBp65 staining remaining in the cytoplasm of most cells. These results demonstrate that hypoxia ⁄ SD induces IL-1b and TNF-a transcrip- tion, which are dependent on activation of the NF-jB pathway.

Hypoxia ⁄ SD increases the translation of pro-IL-1b but not TNF-a

Hypoxia ⁄ SD-induced IL-1b and TNF-a transcription depend on the extracellular signal-regulated kinase pathway

roles

expression protein TNF-a

Having demonstrated significant transcriptional upreg- ulation, we next examined protein levels of IL-1b and TNF-a in MSCs-CM. Unexpectedly, neither IL-1b nor TNF-a was detectable in MSCs-CM using enzyme- linked immunosorbent assay (ELISA) analysis. To determine the reason for this lack of IL-1b and TNF-a secretion by MSCs, changes in these factors’ transla- tion in hypoxia ⁄ SD-stimulated MSCs were investi- gated. As shown in Fig. 4A, hypoxia ⁄ SD increased pro-IL-1b translation in a time-dependent manner, whereas remained unchanged at each time point. Furthermore, MG132, BAY 11-7082 and U0126, all of which abrogated hypoxia ⁄ SD-induced IL-1b and TNF-a transcription, also abolished pro-IL-1b translational upregulation failed to affect TNF-a translation (Fig. 4B,C) but The extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2) and p38 mitogen-activated protein kinase (p38) signal- ling pathways play important in hypoxia ⁄ SD-induced apoptosis of MSCs [20,21] and may also affect IL-1b and TNF-a transcriptional regulation [22]. To confirm this, 20 lm U0126 (Fig. S1A) was used to inhibit the ERK1 ⁄ 2 pathway in MSCs, followed by measurement of IL-1b and TNF-a mRNA levels by real-time PCR. As shown in Fig. 3A, U0126 completely abolished hypoxia ⁄ SD-induced IL-1b and TNF-a transcriptional upregulation. When the MSCs were exposed to 15 lm SB202190 (Fig. S1B), a p38-specific inhibitor, hypoxia ⁄ SD-induced IL-1b transcription

A

B

C

Fig. 3. IL-1b and TNF-a transcriptional induction depends on the ERK1 ⁄ 2 pathway. MSCs were exposed to the ERK1 ⁄ 2 inhibitor U0126 or the p38 inhibitor SB202190, followed by hypoxia ⁄ SD for 6 h. (A,B) Relative mRNA levels for IL-1b and TNF-a, as determined by real-time PCR. *P < 0.05 versus hypoxia ⁄ SD group. (C) A representative pattern of the nuclear translocation of NF-jBp65, as assessed by immunocytochemical staining of MSCs using an anti-(NF-jBp65 primary Ig) (red) and nuclear labelling with 4¢,6-diamidino-2- phenylindone (blue).

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3691

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

B

A

C

Fig. 4. Hypoxia ⁄ SD increases translation of pro-IL-1b but not TNF-a. (A) Representative western blots for pro-IL-1b and TNF-a expression in MSCs stimulated by hypoxia ⁄ SD for the indicated number of hours. (B) Representative western blots for pro-IL-1b and TNF-a expression in MSCs in the presence and absence of BAY 11-7082 or MG132. *, nonspecific band. (C) Representative western blots for pro-IL-1b expression in MSCs in the pres- ence and absence of U0126. *, nonspecific band.

A

(Fig. 4B). These results demonstrate that in hypox- ia ⁄ SD-stimulated MSCs, IL-1b mRNA can be effi- ciently translated into pro-IL-1b protein, whereas the translation of TNF-a mRNA is severely repressed.

Hypoxia ⁄ SD induces cleavage of pro-IL-1b into mature IL-1b

B

Fig. 5. Hypoxia ⁄ SD induces cleavages of pro-IL-1b and pro-cas- pase 1. MSCs were stimulated by hypoxia ⁄ SD in the presence or absence of LPS for the indicated number of hours. (A) Representa- tive western blots for pro-IL-1b and mature IL-1b in MSCs. (B) Rep- resentative western blots for pro-caspase 1 and cleaved caspase 1 in MSCs.

transla- Given that hypoxia ⁄ SD induced significant tional upregulation of pro-IL-1b and that processing of pro-IL-1b into mature IL-1b requires activating cleavage of pro-caspase 1 [23], the cleavage of both pro-IL-1b and pro-caspase 1 was examined in hypox- ia ⁄ SD-stimulated MSCs. As shown in Fig. 5A, hypox- ia ⁄ SD promoted the processing of pro-IL-1b into mature IL-1b, with a stronger induction effect in the presence of the endotoxin LPS. Consistent with these data, hypoxia ⁄ SD also induced the cleavage of pro- caspase 1, with stronger activation in the presence of LPS (Fig. 5B).

Hypoxia ⁄ SD-stimulated MSCs require a second signal for IL-1b and TNF-a release

after hypoxia ⁄ SD treatment for 6 h in the presence of LPS (Fig. 6C). These findings demonstrate that hypoxia ⁄ SD-stimulated MSCs require a second stimulatory signal in order to secrete IL-1b and TNF-a.

Hypoxia ⁄ SD induces the transcription and secretion of IL-10

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3692

Although significant cleavage of pro-IL-1b and pro- caspase 1 occurred intracellularly in hypoxia ⁄ SD-stim- ulated MSCs, mature IL-1b was undetectable in MSCs-CM (Fig. 6A). However, significant release of IL-1b by hypoxia ⁄ SD-stimulated MSCs in the presence of ATP was detected. Furthermore, when both LPS and ATP were present, hypoxia ⁄ SD-stimulated MSCs released a larger amount of IL-1b (Fig. 6A). We also examined TNF-a expression in hypoxia ⁄ SD-stimulated MSCs in the presence of LPS. As shown in Fig. 6B, LPS relieved the translational inhibition of TNF-a. Moreover, TNF-a release by MSCs was detectable Because of the lack of secretion of the inflammatory cytokines IL-1b and TNF-a from hypoxia ⁄ SD-stimu- lated MSCs, as well as the significant anti-inflamma- tory effects of MSCs, expression and secretion of the anti-inflammatory cytokine IL-10 by these cells was shown in Fig. 7A, hypoxia ⁄ SD investigated. As

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

C

A

B

Fig. 6. Hypoxia ⁄ SD-stimulated MSCs require a second signal for IL-1b and TNF-a release. (A) The results of ELISA analysis of supernatants from MSCs after hypoxia ⁄ SD stimulation for 12 h in the presence and absence of ATP and LPS. (B) Representative western blots for TNF-a expression in MSCs stimulated by hypoxia ⁄ SD in the presence or absence of LPS for the indicated number of h. *, nonspecific band. (C) The results of ELISA analysis of supernatants from MSCs after hypoxia ⁄ SD stimulation for 12 h in the presence or absence of LPS.

B

A

C

Fig. 7. Hypoxia ⁄ SD induces expression and secretion of IL-10. (A) Relative IL-10 mRNA levels in MSCs stimulated by hypoxia ⁄ SD for the indicated number of hours. Data are the mean ± SEM of at least three indepen- dent experiments. *P < 0.05 versus control group (0 h). (B) Relative IL-10 mRNA levels in MSCs after hypoxia ⁄ SD treatment for 6 h in the presence and absence of various reagents. *P < 0.05 versus control group; ##P < 0.01 versus hypoxia ⁄ SD treatment group. (C) The results of ELISA analysis of supernatants from MSCs after hypoxia ⁄ SD stimulation for the indicated number of hours in the presence or absence of LPS. *P < 0.05 versus 6-h group; **P < 0.01 versus 12 h group.

IL-10 inhibits cardiac fibroblast proliferation and collagen expression

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3693

The molecular mass of IL-10 is 19 kDa, which is < 30 kDa and thus part of the MSCs-CM fraction that inhibited cardiac fibroblast proliferation and colla- gen synthesis (Fig. 1B). To investigate the potential contribution of IL-10 to the paracrine effects of MSCs, the influence of IL-10 on cardiac fibroblast prolifera- tion was characterized using a 5-bromodeoxyuridine (BrdU) incorporation assay. As shown in Fig. 8A,B, different IL-10 concentrations significantly inhibited induced significant IL-10 transcription after 3, 6 and 12 h. Moreover, the transcriptional induction of IL-10 by hypoxia ⁄ SD was abolished by the p38 inhibitor SB202190 but was unexpectedly augmented by the pro- teasomal inhibitor MG132 and by LPS (Fig. 7B). Next, the secretion of IL-10 from hypoxia ⁄ SD-stimu- lated MSCs was examined by ELISA. As shown in Fig. 7C, a small amount of IL-10 release from MSCs was detected at the 6-h time point, and this release the 12-h time point. Furthermore, was elevated at IL-10 secretion was augmented by the presence of LPS at each time point.

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

A

B

C

D

Fig. 8. MSC-secreted IL-10 is involved in the inhibition of cardiac fibrosis. (A) BrdU incorporation in cardiac fibroblasts grown in standard DMEM at 24 h after IL-10 treatment at different concentrations. **P < 0.01 and ***P < 0.001 versus Cont group. (B) BrdU incorporation in cardiac fibroblasts grown in DMEM with 10% fetal bovine serum at 24 h after IL-10 treatment at different concentrations. **P < 0.01 and ***P < 0.001 versus 10% fetal bovine serum treatment group. (C) The relative mRNA levels of collagen I, collagen III and a-smooth muscle actin (a-SMA) in cardiac fibroblasts in the presence and absence of IL-10. *P < 0.05 and **P < 0.01 versus Cont group. (D) Representative western blots for collagen I and III in the presence and absence of 0.1 lM angiotensin II and IL-10.

and IL-1b after MSC transplantation may be negli- gible. Third, we determined that hypoxia ⁄ SD induces transcription and secretion of IL-10, which signifi- cantly inhibits cardiac fibroblast proliferation and collagen expression. MSC-secreted IL-10 may thus play a role in the attenuation of cardiac fibrosis under ischaemic conditions.

BrdU incorporation into cardiac fibroblast under nor- mal 10% fetal bovine serum or serum-free culture con- ditions. IL-10 also decreased type I and III collagen and a-smooth muscle actin mRNA levels in cardiac fibroblasts (Fig. 8C). Moreover, IL-10 effectively limited angiotensin II-induced type I and III collagen protein expression (Fig. 8D). These results indicate that IL-10 can inhibit cardiac fibroblast proliferation and collagen expression, suggesting a paracrine, anti-fibrotic role for this factor.

Discussion

NF-jB is a ubiquitous protein transcription factor that induces a variety of genes affecting the inflamma- tory processes [24,25]. Normally, NF-jB is inactive and coupled to IjB protein [26,27]. Based on our study, we hypothesize that hypoxia ⁄ SD stimulates the phosphorylation and ubiquitin-related degradation of IjB. The active form of NF-jBp65 is then released and translocated into the nucleus to activate the tran- scription of IL-1b and TNF-a. In this report, hypox- ia ⁄ SD-induced IL-1b and TNF-a transcription were abolished by the ERK1 ⁄ 2 inhibitor U0126, suggesting that hypoxia ⁄ SD-induced NF-jB activation is depen- dent on ERK1 ⁄ 2 signalling. However, the p38 inhibi- tor SB202190 only partly inhibited hypoxia ⁄ SD- induced IL-1b transcription and failed to affect the TNF-a mRNA levels. Activation of p38 may thus be involved in the regulation of IL-1b mRNA stability by a mechanism independent of NF-jB signalling.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3694

In this study, we focused on the paracrine effects of MSCs on cardiac fibroblast proliferation and collagen expression, as well as the possible paracrine roles of IL-1b, TNF-a and IL-10 in cardiac fibrosis. First, our results demonstrate that MSCs-CM have significant anti-fibrotic effects, as indicated by decreased [3H]-thy- midine and [3H]-proline incorporation by cardiac fibroblasts. Moreover, we found that < 30 kDa compo- nents of MSCs-CM play the dominant anti-fibrotic role, suggesting that these anti-fibrotic factors may be soluble small molecules. Second, our data show that hypoxia ⁄ SD induces NF-jB-dependent IL-1b and TNF- a transcriptional upregulation. However, these two fac- secreted from hypoxia ⁄ SD-stimulated tors are not MSCs unless a second signalling stimulus is present. This finding suggests that the paracrine roles of TNF-a Pro-IL-1b is synthesized in the cytosol of activated cells without a signal sequence, precluding secretion via the classical endoplasmic reticulum–Golgi route [28]. Processing of pro-IL-1b into its active form

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

mediator of the cells’ paracrine anti-fibrotic effects. These findings help to improve our understanding of the cellular and molecular basis of MSCs’ anti-inflam- matory and paracrine effects.

Materials and methods

Materials

Iscove’s modified Dulbecco’s medium (IMDM), Dulbecco’s modified Eagle’s medium (DMEM) and Trizol reagent were purchased from Invitrogen (Carlsbad, CA, USA). M-MLV reverse transcriptase was obtained from Promega (Madison, WI, USA) and Power SYBR Green PCR Master Mix was purchased from Applied Biosystems (Foster City, CA, USA). SB202190, U0126, MG132, BAY 11-7082, LPS and angiotensin II were obtained from Sigma (St. Louis, MO, USA). The BrdU cell proliferation assay kit was acquired from Calbiochem (Gibbstown, NJ, USA). ELISA detection kits for IL-1b, TNF-a and IL-10 as well as antibodies against IL-1b and TNF-a were obtained from R&D Sys- tems (Minneapolis, MN, USA), whereas antibodies against ERK, phospho-ERK1 ⁄ 2, p38 and phospho-p38 were pur- chased from Cell Signalling Technology (Danvers, MA, USA). Antibodies against NF-jBp65, caspase 1, collagen I, collagen III and b-actin and horseradish peroxidise-conju- gated secondary antibodies were manufactured by Santa Cruz Biotechnology (Santa Cruz, CA, USA).

requires caspase 1 [29], which is itself activated by a molecular scaffold termed the inflammasome [23]. It is generally accepted that such IL-1b generation and secretion by monocytes occurs in two steps. First, an inflammatory signal, such as the endotoxin LPS, pro- motes the synthesis and cytoplasmic accumulation of pro-IL-1b. A second signal, in the form of exogenous ATP, triggers caspase 1-mediated processing of pro-IL- 1b and secretion of the mature cytokine [30,31]. In our study, hypoxia ⁄ SD enhanced the transcription and translation of pro-IL-1b as well as the cleavage of pro- IL-1b into mature IL-1b. However, IL-1b was not released from hypoxia ⁄ SD-stimulated MSCs unless ATP or LPS was present.

Interestingly, although hypoxia ⁄ SD induced signifi- cant TNF-a transcription, the translation of TNF-a remained unchanged even when TNF-a transcription was inhibited by MG132 or BAY 11-7082. The exact reason for the translational repression of TNF-a is unclear, but there are at least two possibilities: micro- RNA-mediated TNF-a mRNA translational silencing or TNF-a mRNA AU-rich element-mediated post- transcriptional regulation involving AU-rich element- binding proteins and processing bodies (P-bodies) [32]. Such AU-rich element-mediated translational repres- sion of TNF-a may strongly correlate with IL-10 secre- tion by MSCs [33].

Cell culture, inhibitor treatment and conditioned medium collection

Isolation and expansion of MSCs were conducted as previ- ously reported [20]. Briefly, bone marrow was harvested from the tibias and femurs of 80 g rats, plated in IMDM supplemented with 15% heat-inactivated fetal bovine serum and 100 UÆmL)1 penicillin ⁄ streptomycin and incubated at 37 (cid:2)C in a humidified tissue culture incubator containing 5% CO2. The medium was replaced 4 h after plating and to remove nonadherent hematopoietic cells. 24 h later Adherent MSCs were further grown in medium, which was replaced every 48 h. The MSCs used in subsequent experi- ments had been passaged one to three times. All procedures the were approved by the Animal Care Committee of Cardiovascular Institute and Fu Wai Hospital (Beijing, China). For inhibitor-based studies, 15 lm SB202190 (p38 inhibi- tor) [36,37], 20 lm U0126 (ERK1 ⁄ 2 inhibitor) [20], 10 lm inhibitor) or 5 lm BAY 11-7082 MG132 (proteasome (NF-jB inhibitor) was preincubated with MSCs in com- plete medium for 1 h. The cells were subsequently washed in serum-free IMDM and exposed to hypoxia ⁄ SD in the continued presence of inhibitor. Hypoxic conditions were generated by incubating the MSCs at 37 (cid:2)C in a sealed hypoxic GENbox jar fitted with a catalyst to scavenge free oxygen, as described previously [20].

LPS preconditioning enhances the efficacy of MSC transplantation in a rat model of acute myocardial infarction, resulting in superior therapeutic neovascu- larization and decreased fibrosis [34]. Meanwhile, IL-10 has been reported to inhibit fibrosis in the liver [16], kidney [15] and airway [35]. In this study, we found that LPS significantly augmented hypoxia ⁄ SD-induced IL-10 transcription and secretion. Furthermore, IL-10 effectively inhibited cardiac fibroblast proliferation and collagen expression in vitro, suggesting that IL-10 has to prevent cardiac fibrosis. Thus, we the potential hypothesize that the enhanced anti-fibrotic effects of LPS preconditioning may be because of increased IL-10 secretion induced by LPS. MG132 also signifi- cantly inhibited hypoxia ⁄ SD-induced MSC apoptosis in vitro (data not shown) and enhanced IL-10 expres- sion. Therefore, MG132 preconditioning may provide another effective strategy of maximizing the viability, paracrine effects and biological and functional proper- ties of MSCs.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3695

In conclusion, our work demonstrates that hypox- ia ⁄ SD increases the transcription but not the secretion of IL-1b and TNF-a, suggesting that the roles of these factors in the paracrine effects of MSCs are negligible. However, hypoxia ⁄ SD also enhances the transcription and secretion of IL-10, which may be an important

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

smooth muscle

actin alpha CTGTACATCAAGGA; (a-SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢.

MSC-CM was generated as follows. First, 80% confluent cells were administered serum-free DMEM and incubated for 6 h under hypoxic conditions. The medium was then collected, clarified by centrifugation and divided into > 30 and < 30 kDa components using 30 kDa molecular mass cut-off ultrafiltration membranes (Millipore, Billerica, MA, USA) if necessary. As a control, plates containing medium alone were also subjected to the same conditions.

Neonatal cardiac fibroblasts were isolated from Sprague– Dawley rats (1–3 days old) and characterized as previously described [38]. All experiments were performed on the sec- ond or third passage of cardiac fibroblasts after starvation in serum-free DMEM for 24 h. The cells were then treated with control medium or MSCs-CM.

Immunocytochemical staining for NF-jBp65

MSCs in IMDM supplemented with 10% fetal bovine serum were plated on six-well glass slides. When the cells reached 70–80% confluence, they were preincubated with U0126 or BAY 11-7082 as described above and exposed to hypoxia ⁄ SD for 6 h. The cells were then fixed in 2% para- formaldehyde in NaCl ⁄ Pi for 30 min, washed twice with NaCl ⁄ Pi and permeabilized with 0.3% Triton X-100 in NaCl ⁄ Pi for 10 min. Next, the MSCs were blocked in 2% goat serum for 1 h and incubated with rabbit anti-(NF-jBp65 primary IgG) for 1–2 h. The cells were then washed and incubated with rhodamine-labelled goat anti-(rabbit second- ary IgG). After three NaCl ⁄ Pi washes and incubation with the nuclear stain 4¢,6-diamidino-2-phenylindone for 20 min, for 10 min and the MSCs were washed in NaCl ⁄ Pi mounted in gelvatol for microscopic imaging.

[3H]-Thymidine and [3H]-proline uptake assays

Cardiac fibroblasts were transferred to 24-well plates, starved of serum for 24 h and then stimulated with stan- [3H]-Thymidine or dard medium or MSCs-CM for 24 h. [3H]-proline (Institute of High Energy Physics, Chinese Academy of Sciences, Beijing, China) was added to each well to a final concentration of 1 lCiÆmL)1 during the last 6 h of incubation. Stimulation was terminated by rinsing the cardiac fibroblasts three times with NaCl ⁄ Pi and then adding ice-cold 10% trichloroacetic acid for 30 min. Cell precipitates were washed three times with ice-cold NaCl ⁄ Pi and then solubilized in 1% SDS with 0.1 m sodium hydrox- ide overnight at room temperature. The radioactivity of SDS-soluble protein was determined by liquid scintillation spectrometry (Beckman Model LS6000-SC, Brea, CA, USA).

Protein extraction and western blotting analysis

Lysates of stimulated cells were prepared and subjected to SDS ⁄ PAGE as previously described [20]. Briefly, stimulated cells were rinsed twice with ice-cold NaCl ⁄ Pi and lysed in ice-cold lysis buffer for 30 min. Cell lysates were then cen- trifuged at 13 000 g for 10 min at 4 (cid:2)C and their protein concentrations were determined by the BCA Protein Assay. Lysate amounts allowing equal protein loading between lanes were determined and mixed with 5 · SDS sample buf- fer, boiled for 5 min and separated by 10–15% SDS ⁄ PAGE before transferring the proteins onto nitrocellulose mem- branes by semi-dry transfer. After blocking in 5% skim milk for 1 h, the membranes were rinsed and incubated overnight at 4 (cid:2)C with gentle shaking and with the appro- priate diluted primary antibody in 5% BSA, 1 · Tris-buf- fered saline (TBS) and 0.1% Tween-20 (TBS ⁄ T). Excess antibody was then removed by washing the membranes with TBS ⁄ T and subsequent incubation with horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. After further washes in TBS ⁄ T, the bands were visualized using an enhanced chemiluminescence detection kit and radiographic film exposure.

follows:

RNA extraction and real-time PCR analysis

Total RNA was extracted from MSCs using Trizol reagent according to the manufacturer’s instructions. Next, cDNA was generated from 2 lg of total RNA using M-MLV reverse transcriptase and oligo(dT)18 primer. Real-time PCR was performed in a total volume of 25 lL containing 0.5 lL RT product, 0.5 lm primers and 12.5 lL Power SYBR Green PCR Master Mix. Glyceraldehyde-3-phos- phate dehydrogenase mRNA amplified from the same sam- ples served as an internal control. The relative expression of each targeted gene was normalized by subtracting the corresponding glyceraldehyde-3-phosphate dehydrogenase threshold cycle (Ct) values using the DDCt comparative method. The sequences of all primers used in this work are IL-1b: 5¢-GCTGTGGCAGCTACCTATGT- as CTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF-a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ 5¢-CAAGGCTTGGCAA and CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG

The MSCs-CM was concentrated 20 · by ultrafiltration using 10 kDa molecular mass cut-off ultrafiltration mem- branes (Millipore) following the manufacturer’s instruc- tions. Production of IL-1b, TNF-a and IL-10 by MSCs

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3696

ELISA analysis of IL-1b, TNF-a and IL-10 secretion by MSCs

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

of ischemic heart by Akt-modified mesenchymal stem cells. Nat Med 11, 367–368.

5 Kinnaird T, Stabile E, Burnett MS, Lee CW, Barr S,

was then determined by ELISA using the commercially available kits mentioned earlier according to the manufac- turer’s instructions. Absorbance was measured at 450 nm using a microplate reader. Results were compared with a standard curve constructed by titrating rat IL-1b, TNF-a and IL-10.

Fuchs S & Epstein SE (2004) Marrow-derived stromal cells express genes encoding a broad spectrum of arteri- ogenic cytokines and promote in vitro and in vivo arte- riogenesis through paracrine mechanisms. Circ Res 94, 678–685.

6 Ohnishi S, Yasuda T, Kitamura S & Nagaya N (2007) Effect of hypoxia on gene expression of bone marrow- derived mesenchymal stem cells and mononuclear cells. Stem Cells 25, 1166–1177.

7 Li L, Zhang S, Zhang Y, Yu B, Xu Y & Guan Z

(2009) Paracrine action mediates the antifibrotic effect of transplanted mesenchymal stem cells in a rat model of global heart failure. Mol Biol Rep 36, 725–731. 8 Li L, Zhang Y, Li Y, Yu B, Xu Y, Zhao S & Guan Z (2008) Mesenchymal stem cell transplantation attenu- ates cardiac fibrosis associated with isoproterenol- induced global heart failure. Transpl Int 21, 1181–1189.

Cardiac fibroblasts were transferred to 96-well plates, starved of serum for 24 h and stimulated with IL-10 for 24 h. DNA synthesis at 24 h was measured using a BrdU ELISA kit. Briefly, the cells were incubated for 4 h at 37 (cid:2)C with 20 lLÆwell)1 of BrdU. The supernatant was then removed and the cells were fixed in 200 lLÆwell)1 of FixDe- nat for 30 min at room temperature. Subsequently, anti- BrdU Ig, horseradish peroxidase-conjugated goat anti- (mouse IgG) and substrate solution were applied to the wells. The absorbance of the samples was measured at 450 nm using a microplate reader.

BrdU incorporation assay

9 Tang J, Wang J, Guo L, Kong X, Yang J, Zheng F, Zhang L & Huang Y (2010) Mesenchymal stem cells modified with stromal cell-derived factor 1 alpha improve cardiac remodeling via paracrine activation of hepatocyte growth factor in a rat model of myocardial infarction. Mol Cell 29, 9–19.

between

two

10 Palmer JN, Hartogensis WE, Patten M, Fortuin FD &

Data are expressed as the mean ± SEM. Differences among groups were tested by one-way analysis of variance (ANOVA). Comparisons groups were evaluated using Student’s t-test. A value of P < 0.05 was considered statistically significant.

Long CS (1995) Interleukin-1 beta induces cardiac myo- cyte growth but inhibits cardiac fibroblast proliferation in culture. J Clin Invest 95, 2555–2564.

Statistical analysis

Acknowledgement

11 Guo J, Lin GS, Bao CY, Hu ZM & Hu MY (2007) Anti-inflammation role for mesenchymal stem cells transplantation in myocardial infarction. Inflammation 30, 97–104.

12 Liu N, Chen R, Du H, Wang J, Zhang Y & Wen J

(2009) Expression of IL-10 and TNF-alpha in rats with cerebral infarction after transplantation with mesenchy- mal stem cells. Cell Mol Immunol 6, 207–213. 13 Semedo P, Palasio CG, Oliveira CD, Feitoza CQ,

This study was supported by the National Natural Science Foundation of China (30871024) and the Major National Basic Research Program in the People’s Republic of China (Program 973, 2007CB512108 & 2010CB529508).

References

1 Pittenger MF, Mackay AM, Beck SC, Jaiswal RK,

Goncalves GM, Cenedeze MA, Wang PM, Teixeira VP, Reis MA, Pacheco-Silva A et al. (2009) Early modulation of inflammation by mesenchymal stem cell after acute kidney injury. Int Immunopharmacol 9, 677–682.

Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S & Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284, 143–147.

14 Garantziotis S, Brass DM, Savov J, Hollingsworth JW,

2 Porada CD, Zanjani ED & Almeida-Porad G (2006)

Adult mesenchymal stem cells: a pluripotent population with multiple applications. Curr Stem Cell Res Ther 1, 365–369.

3 Wang XJ & Li QP (2007) The roles of mesenchymal stem cells (MSCs) therapy in ischemic heart diseases. Biochem Biophys Res Commun 359, 189–193.

4 Gnecchi M, He H, Liang OD, Melo LG, Morello F,

Mu H, Noiseux N, Zhang L, Pratt RE, Ingwall JS et al. (2005) Paracrine action accounts for marked protection

McElvania-TeKippe E, Berman K, Walker JK & Schwartz DA (2006) Leukocyte-derived IL-10 reduces subepithelial fibrosis associated with chronically inhaled endotoxin. Am J Respir Cell Mol Biol 35, 662–667. 15 Mu W, Ouyang X, Agarwal A, Zhang L, Long DA, Cruz PE, Roncal CA, Glushakova OY, Chiodo VA, Atkinson MA et al. (2005) IL-10 suppresses chemokines, inflammation, and fibrosis in a model of chronic renal disease. J Am Soc Nephrol 16, 3651– 3660.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3697

Z. Li et al.

Paracrine anti-fibrotic effects of MSCs in vitro

30 Perregaux DG, McNiff P, Laliberte R, Conklyn M & Gabel CA (2000) ATP acts as an agonist to promote stimulus-induced secretion of IL-1 beta and IL-18 in human blood. J Immunol 165, 4615–4623.

16 Lan L, Chen Y, Sun C, Sun Q, Hu J & Li D (2008) Transplantation of bone marrow-derived hepatocyte stem cells transduced with adenovirus-mediated IL-10 gene reverses liver fibrosis in rats. Transpl Int 21, 581–592.

31 Mehta VB, Hart J & Wewers MD (2001) ATP-stimulated

release of interleukin (IL)-1beta and IL-18 requires priming by lipopolysaccharide and is independent of caspase-1 cleavage. J Biol Chem 276, 3820–3826.

17 Nemeth K, Leelahavanichkul A, Yuen PS, Mayer B, Parmelee A, Doi K, Robey PG, Leelahavanichkul K, Koller BH, Brown JM et al. (2009) Bone marrow stro- mal cells attenuate sepsis via prostaglandin E(2)-depen- dent reprogramming of host macrophages to increase their interleukin-10 production. Nat Med 15, 42–49. 18 Lu WQ, Qiu Y, Li TJ, Tao X, Sun LN & Chen WS (2009) Timosaponin B-II inhibits pro-inflammatory cytokine induction by lipopolysaccharide in BV2 cells. Arch Pharm Res 32, 1301–1308.

19 Shao DZ & Lin M (2008) Platonin inhibits LPS-induced

32 Nguyen Chi M, Chalmel F, Agius E, Vanzo N, Khabar KS, Jegou B & Morello D (2009) Temporally regulated traffic of HuR and its associated ARE-containing mRNAs from the chromatoid body to polysomes during mouse spermatogenesis. PLoS ONE 4, e4900. 33 Kontoyiannis D, Kotlyarov A, Carballo E, Alexopou- lou L, Blackshear PJ, Gaestel M, Davis R, Flavell R & Kollias G (2001) Interleukin-10 targets p38 MAPK to modulate ARE-dependent TNF mRNA translation and limit intestinal pathology. EMBO J 20, 3760–3770. 34 Yao Y, Zhang F, Wang L, Zhang G, Wang Z, Chen J & Gao X (2009) Lipopolysaccharide preconditioning enhances the efficacy of mesenchymal stem cells transplantation in a rat model of acute myocardial infarction. J Biomed Sci 16, 74–84.

NF-kappaB by preventing activation of Akt and IKKbeta in human PBMC. Inflamm Res 57, 601–606. 20 Chen J, Baydoun AR, Xu R, Deng L, Liu X, Zhu W, Shi L, Cong X, Hu S & Chen X (2008) Lysophospha- tidic acid protects mesenchymal stem cells against hypoxia and serum deprivation-induced apoptosis. Stem Cells 26, 135–145.

21 Li Z, Wei H, Liu X, Hu S, Cong X & Chen X (2010)

LPA rescues ER stress-associated apoptosis in hypoxia and serum deprivation-stimulated mesenchymal stem cells. J Cell Biochem, doi:10.1002/jcb.22731.

35 Wilson MS, Elnekave E, Mentink-Kane MM, Hodges MG, Pesce JT, Ramalingam TR, Thompson RW, Kamanaka M, Flavell RA, Keane-Myers A et al. (2007) IL-13Ralpha2 and IL-10 coordinately suppress airway inflammation, airway-hyperreactivity, and fibrosis in mice. J Clin Invest 117, 2941–2951.

36 Liu CH & Hwang SM (2005) Cytokine interactions in mesenchymal stem cells from cord blood. Cytokine 32, 270–279.

37 Kitamura H & Okazaki M (2005) AG-041R, a novel

indoline-2-one derivative, stimulates chondrogenesis in a bipotent chondroprogenitor cell line CL-1. Osteoarthri- tis Cartilage 13, 287–296.

22 Rutault K, Hazzalin CA & Mahadevan LC (2001) Combinations of ERK and p38 MAPK inhibitors ablate tumour necrosis factor-alpha (TNF-alpha) mRNA induction. Evidence for selective destabilization of TNF-alpha transcripts. J Biol Chem 276, 6666–6674. 23 Martinon F, Burns K & Tschopp J (2002) The inflam- masome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417–426.

38 Chen J, Han Y, Zhu W, Ma R, Han B, Cong X, Hu S

24 Li Q & Verma IM (2002) NF-kappaB regulation in the

immune system. Nat Rev Immunol 2, 725–734.

& Chen X (2006) Specific receptor subtype mediation of LPA-induced dual effects in cardiac fibroblasts. FEBS Lett 580, 4737–4745.

25 Richmond A (2002) Nf-kappa B, chemokine gene tran- scription and tumour growth. Nat Rev Immunol 2, 664–674.

26 Whiteside ST & Israel A (1997) I kappa B proteins:

Supporting information

structure, function and regulation. Semin Cancer Biol 8, 75–82.

27 Karin M & Ben-Neriah Y (2000) Phosphorylation meets ubiquitination: the control of NF-[kappa]B activity. Annu Rev Immunol 18, 621–663.

28 Rubartelli A, Cozzolino F, Talio M & Sitia R (1990)

The following supplementary material is available: Fig. S1. Dose–response data for U0126 and SB202190. This supplementary material can be found in the online version of this article.

A novel secretory pathway for interleukin-1 beta, a pro- tein lacking a signal sequence. EMBO J 9, 1503–1510. 29 Thornberry NA, Bull HG, Calaycay JR, Chapman KT, Howard AD, Kostura MJ, Miller DK, Molineaux SM, Weidner JR, Aunins J et al. (1992) A novel heterodi- meric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356, 768–774.

FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS

3698

Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.