intTypePromotion=3

Luận văn: NGHIÊN CỨU MỘT SỐ VIRUS TRÊN KHOAI TÂY (PVX, PVY, PLRV) TẠI ĐÀ LẠT BẰNG KỸ THUẬT ELISA, RT-PCR VÀ GIẢI TRÌNH TỰ (part 5)

Chia sẻ: Asdfadf Adgsg | Ngày: | Loại File: PDF | Số trang:9

0
56
lượt xem
7
download

Luận văn: NGHIÊN CỨU MỘT SỐ VIRUS TRÊN KHOAI TÂY (PVX, PVY, PLRV) TẠI ĐÀ LẠT BẰNG KỸ THUẬT ELISA, RT-PCR VÀ GIẢI TRÌNH TỰ (part 5)

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

- Lượng RNA thích hợp cho phản ứng tổng hợp cDNA là 5 µl. Quy trình nhiệt của phản ứng tổng hợp cDNA phải thay đổi so với kit (tăng thời gian của giai đoạn 42oC từ 30 phút lên 40 phút). Chu kỳ nhiệt trong phản ứng tổng hợp cDNA 25oC trong 5 phút 42oC trong 40 phút 85oC trong 5 phút Giữ ở 4oC - Nồng độ hóa chất phù hợp hợp với quy trình đã nêu, kết quả thu đƣợc không có sự hiện diện của sản phẩm phụ. ...

Chủ đề:
Lưu

Nội dung Text: Luận văn: NGHIÊN CỨU MỘT SỐ VIRUS TRÊN KHOAI TÂY (PVX, PVY, PLRV) TẠI ĐÀ LẠT BẰNG KỸ THUẬT ELISA, RT-PCR VÀ GIẢI TRÌNH TỰ (part 5)

  1. 32 cDNA - iScript cDNA kit). Kết quả thu đƣợc ở lần chạy RT - PCR thứ 3 và có đƣợc những thông số nhƣ sau: Bảng 4.5 Kết qủa thành phần hóa chất cho một phản ứng tổng hợp cDNA Thành phần Thể tích 4 µl 5X iScript reaction Mix 1 µl Enzyme 5 µl RNA Nƣớc 10 µl - Lƣợng RNA thích hợp cho phản ứng tổng hợp cDNA là 5 µl. Quy trình nhiệt của phản ứng tổng hợp cDNA phải thay đổi so với kit (tăng thời gian của giai đoạn 42oC từ 30 phút lên 40 phút). Chu kỳ nhiệt trong phản ứng tổng hợp cDNA 25oC trong 5 phút 42oC trong 40 phút 85oC trong 5 phút Giữ ở 4oC - Nồng độ hóa chất phù hợp hợp với quy trình đã nêu, kết quả thu đƣợc không có sự hiện diện của sản phẩm phụ. Lƣợng cDNA thích hợp cho phản ứng PCR là 5 µl. Bảng 4.6 Kết qủa thành phần hóa chất trong một phản ứng khuếch đại cDNA Thành phần Nồng độ cuối Dung dịch đệm PCR 10X 1X MgCl2 1 mM Hỗn hợp dNTP (dNTP Mix) 0,2 mM Mồi xuôi (sens primer) 0,3 µM Mồi ngƣợc (antisens primer) 0,3 µM 1 U / µl iTaq polymerase Nƣớc Cho vào để đủ 25 µl Tổng thể tích 25 µl - Kết quả cũng cho thấy quy trình nhiệt là ổn định. Chu trình nhiệt trong phản ứng PCR - 94oC trong 5 phút - 94oC trong 1 phút - 50oC trong 1 phút 35 chu kỳ
  2. 33 - 72oC trong 1 phút - 72oC trong 10 phút *Kết quả điện di 336bp Hình 4.1 Kết quả điện di cDNA của virus PLRV L1: Thang DNA chuẩn 100 bp L2, L3: cDNA của mẫu 10 (P12) L2: Nồng độ Taq polymerase 1,25 U L3 : Nồng độ Taq polymerase 1 U - Do genome của PLRV không có đuôi poly A, lƣợng cDNA chỉ đƣợc tạo ra từ sự kéo dài các hexamer primer (không có cDNA tạo ra từ primer oligo dT) . Điều này chứng tỏ phản ứng PCR rất nhạy và hiệu quả khuếch đại rất cao. - Sản phẩm RT - PCR từ quy trình có sử dụng Taq của hãng Bio-rad cho kết quả rất chuẩn. Điều này đƣợc chứng minh bằng kết quả giải trình tự có đƣợc mà không cần tinh sạch sản phẩm RT-PCR. - Cặp primer đã sử dụng có độ đặc hiệu rất cao, chỉ cho đúng 1 band ở vị trí 336 bp trên gel điện di. Điều này cho phép khẳng định mẫu này đã bị nhiễm virus PLRV. - Tuy nhiên kết quả trên vẫn còn chƣa thuyết phục lắm. Tức là khả năng tồn tại những đoạn DNA ngoại lai vẫn có thể xảy ra. Do đó để chắc chắn rằng đây là đoạn gen của PLRV ta thực hiện giải trình tự, sau đó so sánh trên ngân hàng gen để có kết luận cuối cùng.
  3. 34 4.4 Kết quả giải trình tự trực tiếp sản phẩm RT-PCR Kết quả giải trình tự sẽ cho ta trình tự dạng chữ (A, G, T, C) và trình tự dạng peak. Trình tự giải từ sens primer đƣợc tổng cộng 314 / 336 nucleotic : GGGGTAGGTAGGACCCTGTGGCACCCAGGCGCCGAAGACGCAGAAGAGGAGGCAATCGCCGCTCTACGAAGAACTGGAGTTCCCCG AGGACGAGGCTCAAGCGAGACATTCGTGTTTACAAAGGACAACCTCGTGGGCAACACCCAAGGAAGTTTCACCTTCGGGCCGAGTCT ATCAGACTGTCCGGCATTCAAGGATGGAATACTCAAGGCCTACCATGAGTATAAGATCACAAGCATCTTACTTCAGTTCGTCAGCGAG GCCTCTTCCACCTCCTCCGGTTCCATCGCTT ATGAGTTGGACCCCCATTGC AA Hình 4.2 Kết quả giải trình tự dạng peak bằng Sense primer Kết quả giải trình tự bằng Antisense primer đƣợc 308 / 336 nucleotic: CTAGAGGAGGAGGTGGAGAGGCCTCGCTGACGAACTGAAGTAAGATGCTTGTGATCTTATACTCA TGGTAGGCCTTGAGTATTCCATCC TTGAATGCCGGACAGTCTGATAGACTCGGCCCGAAGGTGAAACTTCCTTGGGTGTTGCCCACGAGGTTGTCCTTTGTAAACACGAATGT CTCGCTTGAGCCTCGTCCTCGGGGAACTCCAGTTCTTCTTGAGCGGCGATTGCCTCCTCTTCTGCGTCTTCGGCGCCTGGGTTGCCCAGG GGCCGTGACCATAACCACTGGC TGAACTCTGT TAGCGCG A Hình 4.3 Kết quả giải trình tự dạng peak bằng Antisense primer Dùng phần mềm CLUSTAL X để so sánh hai trình tự giải đƣợc. Kết quả so sánh sẽ cho thấy những vị trí tƣơng đồng và không tƣơng đồng trên đoạn gen đó. Vị trí các nucleotide tƣơng đồng đƣợc đánh dấu “ * ”, không tƣơng đồng dấu “ - ”. Những
  4. 35 nucleotide tại các vị trí không tƣơng đồng (thƣờng ở đoạn đầu), ta sẽ kết hợp với trình tự dạng peak để hoàn chỉnh đoạn gen mong muốn. Dƣới đây là kết quả so sánh trình tự giải đƣợc từ 2 primer. Hình 4.4 So sánh kết quả giải trình tự từ 2 primer Trình tự tƣơng đồng *: Trình tự không tƣơng đồng -: Trình tự giải đƣợc nhờ Antisense primer anti: Sens: Trình tự giải đƣợc nhờ Sense primer Trình tự hoàn chỉnh của đoạn gen mong muốn sẽ có tổng số 339 nucleotic, trong đó có 3 nucleotide loại A, 1 ở đầu 3’ và 2 đầu 5’. Sở dĩ có thêm 3 nucleotic trên là do kết quả của phản ứng PCR (Dr. Mchael blader). Dƣới đây là trình tự cDNA hoàn chỉnh của PLRV sau khi đối chiếu kết quả giải trình tự dạng peak và dạng chữ từ hai primer Sense và Antisense.
  5. 36 Hình 4.5 Trình tự sợi Sense của đoạn cDNA của PLRV Kết quả so sánh trên ngân hàng gen với độ tƣơng đồng 100% . Nhƣ vậy trình tự ta có đƣợc là chính xác đồng thời kết quả này cũng khẳng định đây chính là đoạn gen của PLRV và mẫu đƣợc kiểm tra đã bị nhiễm virus PLRV chứ không phải virus nào khác. Ngoài ra cũng khẳng định đƣợc rằng tại Đà Lạt không hề có bất kỳ đột biến nào ở đoạn gene trên. r Hình 4.6 Kết quả so sánh trình tự sản phẩm PCR của PLRV trên ngân hàng gen (Query: Trình tự của sản phẩm PCR; Sbjct: Trình tự có sẵn trên ngân hàng gen)
  6. 37 PHẦN 5. KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Từ các kết quả thu đƣợc tôi xin rút ra một số kết luận nhƣ sau: - Tất cả các phƣờng, các giống, các thế hệ đƣợc điều tra đều đã bị nhiễm virus PVX, PVY, PLRV sau khi kiểm tra bằng kỹ thuật ELISA. - Giống 06 nhiễm virus PVY và PLRV ít hơn giống 07, nhƣng lại nhiễm PVX cao hơn giống 07. - Càng về các thế hệ sau thì tỷ lệ nhiễm các loại virus PVY, PLRV càng tăng. - Không có sự khác biệt về mức độ nhiễm các virus trên ở các độ tuổi khác nhau. - Đã phát hiện đƣợc virus PLRV trên khoai tây nhờ phản ứng RT-PCR khuếch đại đoạn gene mã hóa cho protein vỏ (336 bp). - Kết quả giải trình tự sản phẩm RT-PCR của virus PLRV cho kết quả tƣơng đồng 100% với trình tự của virus PLRV trên ngân hàng gen. 5.2 Đề nghị - Ứng dụng các kỹ thuật ELISA, RT-PCR và giải trình tự rộng rãi hơn trong việc chẩn đoán virus trên khoai tây. - Cần nghiên cứu sâu thêm các yếu tố (giống, thế hệ, tuổi) ảnh hƣởng đến sự nhiễm các loại virus kể trên. - Cần tiến hành thực nghiệm trên số lƣợng mẫu lớn hơn với số lần lặp lại nhiều hơn để khẳng định độ chính xác và ổn định của quy trình chẩn đoán bằng RT – PCR. - Tìm các khung đọc (ORF) có thể có dựa trên trình tự đoạn gen giải đƣợc nhằm hiểu rõ hơn về đoạn gen trên.
  7. 38 PHẦN 6. TÀI LIỆU THAM KHẢO Tài liệu tiếng việt 1. Nguyễn Thị Chính - Ngô Tiến Hiển, 2001. Virút học. Nhà xuất bản ĐHQG Hà Nội. 2. Đƣờng Hồng Dật. Khoa học bệnh cây. Nhà xuất bản nông nghiệp. 3. Hồ Hùynh Thùy Dƣơng. Sinh học phân tử, 1998. NXB giáo dục 4. Mai Thạch Hoành (chủ biên) - Nguyễn Công Vinh, 2003. Giống và kỹ thuật thâm canh cây có củ. Nhà xuất bản nông nghiệp Hà Nội. 5. Vũ Triệu Mân-Hội sinh học phân tử bệnh lý thực vật Việt Nam, 2003. Chẩn đoán nhanh bệnh hại thực vật. NXB Hà Nội. 6. Z-Kiraly, Z Klement-F.Solymosy-J.Voros, Vũ Khắc Nhƣợng- Hà Minh trung dịch, 1983. Những phương pháp nghiên cứu cây. NXB nông nghiệp Hà Nội. 7. Nguyễn Văn Sơn, 2003. Một số sâu bệnh chính hại rau ở Lâm Đồng và các biện pháp phòng trừ tổng hợp. Chi cục bảo vệ thực vật Lâm Đồng. 8. Lê Lƣơng Tề - Vũ Triệu Mân, 1999. “Bệnh vi khuẩn và virus hại cây trồng”. NXB Giáo Dục. 9. Nguyễn Văn Thắng – Bùi Thị Mỹ, 1996.”Kỹ thuật trồng cà chua, khoai tây, hành tây và tỏi ta”. NXB Nông nghiệp Hà Nội. 10. Phạm Đức Toàn, 2001. Sử dụng kỹ thuật ELISA để chẩn đoán bệnh Tristeza trên cây cam quýt tại quận 9 TP. Hồ Chí Minh. Luận văn tốt nghiệp kỹ sƣ nông học, Đại học Nông lâm TP. Hồ Chí Minh, Việt Nam. 11. Nguyễn Văn Tuất, 2002. Kỹ thuật chẩn đoán và giám định bệnh hại cây trồng. NXB nông nghiệp Hà Nội. 12. Phạm Văn Ty - Đại học quốc gia Hà Nội, 2001. Miễn dịch học. NXB Đại học quốc gia Hà Nội. 13. Bùi Trang Việt, 2000. Sinh lý thực vật đại cương dinh dưỡng. Đại học quốc gia tp. Hồ Chí Minh. Trƣờng Đại học Khoa Học Tự Nhiên.
  8. 39 Tài liệu tiếng nƣớc ngoài 14. Ahmed M. Soliman, Hamed Mazyad and Ahmad Shalaby, 2002. Virus detection: Potato leaf roll virus Agriculture Research Center, Giza, Egypt. 15. Joe O’Connell, 2002. Methods in moleculer biologyTM. Volume 193 (RT-PCR protocol). Humana Press. Totowa, New Jersey. 16. John R. Crowther, 2001. Methods in moleculer biologyTM. Volume 149 (The ELISA guidebook). Humana Press. Totowa, New Jersey. 17. Jay A.Levy., Heinz Fraenkel-conrat.,Robert A. Owen. Virology, 1994. Prentice-Hall, Inc. 18. Kamil Haliloglu and Hidayet Bostan, 2002. Nucleotide sequence analysis for assessment of variability of potato leafroll virus and phylogenetic comparisions. Online journal of biological sciences 2 (9): 582 – 586. 19. M. J. McPherson and S. G. Moller. PCR, 2000. BIOS Scientific Publishers Limited. 20. Sambrook and Russell.Molecular cloning-A laboratory manual. Volume 2. 3rd edition, 2001. Cold spring harbor laboratory press, New York. 21. S. B. Ghosh, L. H. S. Nagi, T. R. Ganapathi, S. M. Paul Khurana and V. A. bapat, 2002. Clone and sequencing potato virus Y coat protein gene from an Indian isolate and development of transgenic tobacco for PVY resistance, 2002. Current Science, vol. 82, NO 7. 22. W. J. Hooker. Compendium of potato diseases, 1981. American Phytopathological Society. Các trang web http://www.bspp.org.uk/publications/pathprofiles/pathprofile24.htm http://www.dpvweb.net/dpv/showdpv.php?dpvno=354 --> http://images.google.com.vn http://www.intl-pag.org http://www.ncbi.nlm.nih.gov http://molcho.org.il http://www.image.fs.uidaho.edu http://www.nal.usda.gov/bic/Biotech_Patents http://i.timeinc.net http://thaibinhdost.gov.vn http://www.vista.gov.vn:9000
  9. 40
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản