intTypePromotion=1

Bước đầu tìm hiểu nguồn gốc và phả hệ của virut gây bệnh “Nhộng Bọc” (Sacbrood) ở ong mật tại Việt Nam

Chia sẻ: Nguaconbaynhay Nguaconbaynhay | Ngày: | Loại File: PDF | Số trang:6

0
6
lượt xem
0
download

Bước đầu tìm hiểu nguồn gốc và phả hệ của virut gây bệnh “Nhộng Bọc” (Sacbrood) ở ong mật tại Việt Nam

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bước đầu tìm hiểu nguồn gốc và phả hệ của virut gây bệnh “Nhộng Bọc” (Sacbrood) ở ong mật tại Việt Nam thông qua nghiên cứu virut cường độc SBV của Việt Nam và tách chiết hệ gien ARN; chọn mồi và thực hiện phản ứng RT-PCR...

Chủ đề:
Lưu

Nội dung Text: Bước đầu tìm hiểu nguồn gốc và phả hệ của virut gây bệnh “Nhộng Bọc” (Sacbrood) ở ong mật tại Việt Nam

26(3): 37-42 T¹p chÝ Sinh häc 9-2004<br /> <br /> <br /> <br /> B−íc ®Çu t×m hiÓu nguån gèc vµ ph¶ hÖ cña virót g©y bÖnh<br /> “nhéng bäc” (sacbrood) ë ong MËt t¹i viÖt nam<br /> <br /> Lª Thanh Hßa<br /> ViÖn C«ng nghÖ sinh häc<br /> Ph¹m ViÕt Liªn<br /> Trung t©m nghiªn cøu ong trung −¬ng<br /> <br /> Sacbrood virót (SBV) lµ lo¹i virót g©y bÖnh ViÖt Nam, b»ng ph¶n øng RT- PCR vµ so s¸nh<br /> “Êu trïng ong d¹ng tói” hay cßn gäi lµ bÖnh ®èi chiÕu víi c¸c chñng SBV cña ch©u ¸, SBV<br /> “nhéng bäc” (sacbrood) ®−îc ph¸t hiÖn lÇn ®Çu cña ViÖt Nam ®W ®−îc gi¸m ®Þnh b»ng ph−¬ng<br /> tiªn vµo n¨m 1913 vµ ®−îc m« t¶ chi tiÕt vµo ph¸p sinh häc ph©n tö, ®−îc ®¨ng ký trong Ng©n<br /> n¨m 1917 [10]. Khi bÞ bÖnh, Êu trïng ngõng hµng Gien víi sè hiÖu: AY216794.<br /> ph¸t triÓn, kh«ng lét x¸c, m« bÞ biÕn hãa, h×nh Tuy nhiªn, SBV cã mèi quan hÖ hä hµng vµ<br /> d¹ng bÞ thay ®æi t¹o thµnh d¹ng tói, tr−íc cã nguån gèc nh− thÕ nµo víi c¸c chñng SBV g©y<br /> mµu vµng, sau chuyÓn thµnh n©u vµ råi kh« ®en bÖnh sacbrood trªn thÕ giíi vÉn lµ vÊn ®Ò cÇn<br /> [1, 2, 4, 5]. SBV thuéc hä Picornaviridae, cã xem xÐt. Trong bµi b¸o nµy, chóng t«i giíi thiÖu<br /> d¹ng h×nh cÇu, ®−êng kÝnh 28 nm; chøa hÖ gien kÕt qu¶ b−íc ®Çu t×m hiÓu nguån gèc vµ ph¶ hÖ<br /> lµ ARN mét sîi cã ®é dµi lµ 8832 nucleotit [7]. cña chñng SBV cña ViÖt Nam vµ chÝnh thøc x¸c<br /> HÖ gien cña SBV chØ cã duy nhÊt mét gien mW ®Þnh chñng SBV g©y bÖnh “Êu trïng ong d¹ng<br /> hãa cho 1 protein chung gåm 2858 axit amin, tói” trªn loµi ong mËt néi (Apis cearana) cã hä<br /> hîp nhÊt cña 4 protein bao gåm: protein cÊu hµng rÊt gÇn víi chñng SBV cña Trung Quèc,<br /> tróc, enzym helicaza, enzym proteaza vµ enzym gÇn gòi víi mét sè chñng kh¸c cña ch©u ¸, kh¸c<br /> ARN-polymeraza (GenBank: AF092924) [7]. xa víi nhiÒu chñng cña ch©u ©u.<br /> ChÈn ®o¸n SBV chØ dùa vµo gi¸m ®Þnh h×nh<br /> th¸i b»ng kÝnh hiÓn vi ®iÖn tö vµ c¸c ph−¬ng I. ph−¬ng ph¸p nghiªn cøu<br /> ph¸p truyÒn thèng nh− ph¶n øng thÊm miÔn dÞch<br /> (western blot), ph¶n øng miÔn dÞch phãng x¹ 1. Môc ®Ých<br /> (radio-immunoassay) vµ ph¶n øng hÊp phô miÔn Thu nhËn vµ gi¶i tr×nh tr×nh tù nucleotit vµ<br /> dÞch enzym (ELISA). C¸c ph−¬ng ph¸p nµy axit amin mét vïng gien cña chñng SBV cña<br /> kh«ng nh¹y, thiÕu chÝnh x¸c, kh«ng ®Æc hiÖu vµ ViÖt Nam (t−¬ng øng víi vÞ trÝ 5707-6604 [7];<br /> kh«ng x¸c ®Þnh ®−îc chñng, tÝp cña SBV. HiÖn Ng©n hµng Gien: AF092924). Sö dông ch−¬ng<br /> nay ch−a cã dßng tÕ bµo thÝch hîp ®Ó nu«i cÊy tr×nh ph©n tÝch ph¶ hÖ vµ tiÕn hãa (MEGA2.1),<br /> SBV, nªn cho ®Õn gÇn ®©y, viÖc chÈn ®o¸n ph©n so s¸nh ®èi chiÕu c¸c thµnh phÇn nucleotit vµ<br /> lËp SBV vÉn kh«ng thùc hiÖn ®−îc trong phßng axit amin cña chñng SBV cña ViÖt Nam víi c¸c<br /> thÝ nghiÖm [8]. chñng cña ch©u ¸ vµ thÕ giíi thu nhËn tõ Ng©n<br /> T¹i ViÖt Nam, bÖnh do SBV x¶y ra nÆng nÒ hµng Gien, x¸c lËp ph¶ hÖ vµ t×m hiÓu nguån<br /> trªn c¶ n−íc, g©y thiÖt h¹i to lín vÒ kinh tÕ. Do gèc, quan hÖ hä hµng cña chóng.<br /> hÖ gien cña SBV chøa ARN, nªn tr−íc hÕt ph¶i 2. Virót c−êng ®éc SBV cña ViÖt Nam vµ<br /> dïng enzym sao chÐp ng−îc ®Ó chuyÓn ®æi t¸ch chiÕt hÖ gien ARN<br /> thµnh ADN, sau ®ã míi dïng ph¶n øng PCR ®Ó<br /> nh©n vïng cÇn nghiªn cøu, do vËy ph¶n øng nµy BÖnh phÈm nghi cã chøa SBV lµ Êu trïng<br /> ®−îc gäi lµ PCR ng−îc (RT-PCR = reverse “d¹ng tói” ®−îc thu nhËn tõ mét ®µn ong mËt bÞ<br /> transcription PCR). Tõ bÖnh phÈm ph©n lËp t¹i bÖnh sacbrood ®iÓn h×nh do Trung t©m nghiªn<br /> <br /> 37<br /> cøu ong trung −¬ng cung cÊp. Qua kiÓm tra l©m 50oC, vµ giai ®o¹n nh©n ®o¹n gien (PCR) thùc<br /> sµng, triÖu chøng, xem xÐt bÖnh tÝch, ®µn ong hiÖn 1 chu kú trong 15 phót ë 95oC; 35 chu kú<br /> ®−îc x¸c ®Þnh bÞ bÖnh sacbrood. BÖnh phÈm cã (94oC: 20 gi©y; 50oC: 20 gi©y; 72oC: 1 phót) vµ<br /> bÖnh tÝch ®Æc tr−ng ®−îc cÊt gi÷ ë –20oC, cho 1 chu kú cuèi cïng ë 72oC trong 10 phót. S¶n<br /> ®Õn khi sö dông. phÈm RT-PCR cña SBV cña ViÖt Nam ®−îc<br /> HÖ gien ARN hay cßn gäi lµ ARN tæng sè, t¸ch dßng b»ng vect¬ pCR2.1 (Invitrogen Inc.).<br /> ®−îc t¸ch chiÕt b»ng ph−¬ng ph¸p sö dông hãa Plasmit t¸i tæ hîp ®−îc chän läc theo quy tr×nh<br /> chÊt trizol (hWng GIBCO/BRL) [6]. ARN tæng [9]. ADN cña plasmit t¸i tæ hîp ®−îc t¸ch chiÕt<br /> sè cña SBV cña ViÖt Nam ®−îc t¸ch chiÕt trùc b»ng bé hãa chÊt (kit) cña Qiagen (QiaPrep Spin<br /> tiÕp tõ bÖnh phÈm cña Êu trïng ong mËt bÞ bÖnh. Mini Kit). §é dµi cña ®o¹n gien cã trong<br /> Sau khi t¸ch chiÕt, ARN tæng sè ®−îc kiÓm tra plasmit t¸i tæ hîp ®−îc kiÓm tra trªn th¹ch<br /> trªn th¹ch agaroza 0,8%, tÝnh to¸n hµm l−îng 0,8%, sau khi xö lý b»ng enzym giíi h¹n EcoRI.<br /> ARN cho ph¶n øng RT-PCR, b¶o qu¶n ë –20oC 4. Chän c¸c chuçi t−¬ng øng ®Ó so s¸nh ®èi<br /> cho ®Õn khi sö dông. chiÕu<br /> 3. Chän måi vµ thùc hiÖn ph¶n øng RT-PCR Chóng t«i dïng ph−¬ng ph¸p truy cËp Ng©n<br /> hµng Gien (http://www.ncbi.nlm.nih.gov), ®Ó<br /> Chóng t«i dïng måi xu«i lµ SB11F:<br /> t×m kiÕm tÊt c¶ c¸c chuçi nucleotit hiÖn cã cña<br /> 5’ATATACGGTGCGAGAACTGC3’ (vÞ trÝ: tÊt c¶ c¸c chñng SBV ®W ®−îc ®¨ng ký cho ®Õn<br /> 5707-5726), måi ng−îc lµ SB12R: 5’CTCGGT- hiÖn nay. Chuçi nucleotit cña SBV cña ViÖt<br /> AATAACGCCACTGT3’ (vÞ trÝ: 6585-6604) Nam ®−îc ®¨ng ký trong Ng©n hµng gien lµ<br /> theo thiÕt kÕ cña Grabensteiner vµ cs. (2001) sö AY216794 vµ cña thÕ giíi lµ c¸c sè AF092924<br /> dông cho ph¶n øng RT-PCR ®Ó thu nhËn ®o¹n vµ tõ AF284648 ®Õn AF284660, bao gåm c¸c<br /> gien dµi kho¶ng 0,89 kbp. Ph¶n øng RT-PCR chñng cã nguån gèc tõ Anh, ¸o, §øc, Ên §é,<br /> ®−îc sö dông lµ ph¶n øng mét b−íc (one-step Nªpan, Trung Quèc (b¶ng 1). C¸c chuçi<br /> RT-PCR) cña hWng Qiagen (QIAGEN Inc.) bao nucleotit vµ axit amin cña c¸c chñng SBV cña<br /> gåm 2 giai ®o¹n: giai ®o¹n chuyÓn ®æi (RT) ViÖt Nam vµ thÕ giíi ®−îc chän ®Ó so s¸nh ®èi<br /> biÕn ARN thµnh ADN trong thêi gian 30 phót ë chiÕu vµ ph©n tÝch ph¶ hÖ.<br /> <br /> B¶ng 1<br /> <br /> Tªn vµ sè ®¨ng ký trong Ng©n hµng Gien cña c¸c chuçi nucleotit cña c¸c chñng SBV cña<br /> ViÖt Nam vµ thÕ giíi dïng ®Ó so s¸nh trong nghiªn cøu ph©n tÝch ph¶ hÖ<br /> <br /> Tªn chñng Sè ®¨ng ký trong Ng©n<br /> Nguån gèc Tµi liÖu c«ng bè<br /> (ký hiÖu) hµng Gien (GB)<br /> 1 2 3 4<br /> SB(VN) AY216794 ViÖt Nam Lª Thanh Hßa vµ cs. 2003 (GB)<br /> SB(CN) AF469603 Trung Quèc Zhang vµ cs (Ng©n hµng Gien)<br /> SB(UK1) AF284648 Anh Grabensteiner vµ cs. 2001<br /> SB(AU) AF284649 ¸o Grabensteiner vµ cs. 2001<br /> SB(GER1) AF284651 §øc Grabensteiner vµ cs. 2001<br /> SB(GER2) AF284650 §øc Grabensteiner vµ cs. 2001<br /> SB(GER3) AF284652 §øc Grabensteiner vµ cs. 2001<br /> SB(GER4) AF284653 §øc Grabensteiner vµ cs. 2001<br /> SB(GER5) AF284654 §øc Grabensteiner vµ cs. 2001<br /> <br /> 38<br /> 1 2 3 4<br /> SB(GER6) AF284655 §øc Grabensteiner vµ cs. 2001<br /> SB(GER7) AF284656 §øc Grabensteiner vµ cs. 2001<br /> SB(GER8) AF284657 §øc Grabensteiner vµ cs. 2001<br /> SB(NP1) AF284658 Nªpan Grabensteiner vµ cs. 2001<br /> SB(NP3) AF284659 Nªpan Grabensteiner vµ cs. 2001<br /> SB(IN) AF284660 Ên §é Grabensteiner vµ cs. 2001<br /> SB(UK2) AF092924 Anh Ghosh vµ cs. 1999<br /> <br /> <br /> 5. C¸c ch−¬ng tr×nh sö dông ®Ó ph©n tÝch B¶ng 2 tr×nh bµy kÕt qu¶ so s¸nh ®èi chiÕu<br /> quan hÖ ph¶ hÖ vµ tiÕn hãa ph©n ®o¹n gien cã ®é dµi 818 nucleotit vµ 272<br /> axit amin cña tÊt c¶ c¸c chñng SBV cña ViÖt<br /> Tr×nh tù nucleotit cña c¸c chñng SBV cña<br /> Nam vµ thÕ giíi. C¸c chñng SBV cña thÕ giíi cã<br /> ViÖt Nam ®−îc gi¶i tr×nh trªn m¸y tù ®éng ABI-<br /> 377 cña hWng Perkin-Elmer (Mü), sau ®ã ®−îc nguån gèc ch©u ¸ vµ ch©u ©u, thÝch øng g©y<br /> xö lý b»ng ch−¬ng tr×nh SeqEd1.03 vµ ch−¬ng bÖnh trªn c¶ hai loµi ong Apis cerana (chñ yÕu<br /> tr×nh AssemblyLIGN 1.9 trong hÖ ch−¬ng tr×nh ®−îc nu«i ë ch©u ¸) vµ Apis mellifera (chñ yÕu<br /> MacVector 6.5.3 (Oxford Molecular Inc.). ®−îc nu«i ë ch©u ©u). Møc ®é t−¬ng ®ång gi÷a<br /> So s¸nh ®èi chiÕu vµ xö lý sè liÖu cña tÊt c¶ c¸c chñng kh¸c nhau cña thÕ giíi vÒ nucleotit lµ<br /> c¸c chuçi b»ng ch−¬ng tr×nh GENDOC2.5 88-100%, vÒ axit amin lµ 92-100%. C¸c chñng<br /> (Nicholas vµ Nicholas, 1999). Thµnh phÇn axit cã cïng nguån gèc ph©n lËp (cïng vïng ®Þa lý)<br /> amin ®−îc thu nhËn b»ng c¸ch sö dông bé mW cã møc ®é t−¬ng ®ång cao, cô thÓ gi÷a c¸c<br /> cña vi sinh vËt bËc thÊp (vi khuÈn) trong Ng©n chñng cña ch©u ¸ bao gåm ViÖt Nam, Trung<br /> hµng Gien (b¶ng mW di truyÒn sè 11) th«ng qua Quèc, Ên §é, Nªpan 1 lµ 93-96% (nucleotit) vµ<br /> ch−¬ng tr×nh GENDOC 2.5. 95-97% (axit amin); gi÷a c¸c chñng cña ch©u<br /> TÊt c¶ c¸c chuçi cña 16 chñng SBV trong ®ã ©u, bao gåm ¸o, §øc, Anh lµ 92-99%<br /> cã 1 chñng cña ViÖt Nam ®−îc s¾p xÕp theo xö (nucleotit) vµ 96-99% (axit amin). Riªng chñng<br /> lý cña ch−¬ng tr×nh GENDOC2.5 vµ ®−a vµo SB(NP3) (Nªpan 3) cã møc ®é t−¬ng ®ång víi<br /> ph©n tÝch ph¶ hÖ b»ng ch−¬ng tr×nh MEGA2.1 c¸c chñng cña ch©u ¸ thÊp h¬n (92-93%) so víi<br /> vÒ thµnh phÇn nucleotit vµ axit amin, sö dông hÖ c¸c chñng cña ch©u ©u (96-97%) do chñng nµy<br /> sè tiÕn hãa thÊp ME (minimum evolution index) ph©n lËp tõ ong bÖnh thuéc loµi A. mellifera,<br /> (Kumar vµ cs., 2001).<br /> chø kh«ng ph¶i tõ loµi ong néi A. cerana nh−<br /> 6. §Þa ®iÓm nghiªn cøu chñng SB(NP1). SBV cã quan hÖ hä hµng liªn<br /> C«ng viÖc gi÷ gièng SBV cña ViÖt Nam, quan ®Õn loµi ong bÞ nhiÔm ë c¸c ch©u ©u, ¸,<br /> t¸ch chiÕt hÖ gien ARN, thùc hiÖn ph¶n øng RT- Phi [8]. Víi c¸c chñng ph©n lËp trong mét n−íc,<br /> PCR, t¸ch dßng s¶n phÈm, chän läc plasmit t¸i møc ®é t−¬ng ®ång vÒ nucleotit ®¹t 97-100%,<br /> tæ hîp vµ mét phÇn ph©n tÝch sè liÖu ®−îc thùc vÒ axit amin ®¹t 98-100%; ®Æc biÖt cã nhiÒu<br /> hiÖn t¹i phßng thÝ nghiÖm virót häc, thuéc chñng cã møc ®é t−¬ng ®ång ®¹t tèi ®a (100%)<br /> Phßng miÔn dÞch häc, ViÖn C«ng nghÖ sinh häc. (b¶ng 2).<br /> Gi¶i tr×nh tr×nh tù nucleotit vµ mét phÇn ph©n 2. Ph©n tÝch quan hÖ nguån gèc vµ ph¶ hÖ<br /> tÝch xö lý sè liÖu ®−îc tiÕn hµnh t¹i ViÖn nghiªn cña chñng SBV cña ViÖt Nam<br /> cøu Y häc Queensland, «xtr©ylia.<br /> B»ng ch−¬ng tr×nh MEGA2.1, víi th«ng sè<br /> II. kÕt qu¶ vµ bµn luËn tiÕn hãa thÊp (minimum evolution; ME), chñng<br /> SBV cña ViÖt Nam vµ c¸c chñng cña thÕ giíi<br /> 1. So s¸nh ®èi chiÕu thµnh phÇn ®o¹n gien liÖt kª ë b¶ng 1 ®−îc so s¸nh vÒ thµnh phÇn<br /> cña SBV cña ViÖt Nam vµ thÕ giíi nucleotit vµ axit amin vµ xem xÐt quan hÖ nguån<br /> <br /> 39<br /> B¶ng 2<br /> Møc ®é t−¬ng ®ång (%) vÒ nucleotit (trªn ®−êng chÐo) vµ axit amin (d−íi ®−êng chÐo)<br /> khi so s¸nh mét ph©n ®o¹n gien cña c¸c chñng SBV cña ViÖt Nam<br /> 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16<br /> 1 96 94 93 89 89 89 89 89 89 89 89 88 88 89 89<br /> 2 97 94 93 88 89 89 89 89 89 89 89 88 88 89 89<br /> 3 95 95 94 89 90 90 90 90 90 90 90 89 89 90 90<br /> 4 95 96 95 88 89 89 89 89 89 89 89 89 89 89 89<br /> 5 93 93 94 93 94 94 94 94 94 94 94 93 93 92 92<br /> 6 92 92 93 94 96 98 99 100 100 98 100 97 97 92 93<br /> 7 93 93 94 94 96 98 98 98 98 99 98 97 97 93 93<br /> 8 92 92 93 94 96 100 98 99 99 99 99 97 97 93 93<br /> 9 92 92 93 94 96 100 98 100 100 98 100 97 97 92 93<br /> 10 92 92 93 94 96 100 98 100 100 98 100 97 97 92 93<br /> 11 92 92 93 94 96 99 99 99 99 99 98 97 97 93 93<br /> 12 92 92 93 94 96 100 98 100 100 100 99 97 97 92 93<br /> 13 93 93 94 95 97 98 98 98 98 98 98 98 97 92 93<br /> 14 92 92 93 94 96 98 98 98 98 98 98 98 98 92 93<br /> 15 94 95 96 95 97 96 97 96 96 96 96 96 97 96 99<br /> 16 94 94 95 95 97 97 97 97 97 97 97 97 97 97 99<br /> Ghi chó: 1: SB(VN); 2: SB(CN); 3: SB(IN); 4: SB(NP1); 5: SB(NP3); 6: SB(GER1); 7: SB(GER2); 8:<br /> SB(GER3); 9: SB(GER4); 10: SB(GER5); 11: SB(GER6); 12: SB(GER7); 13: SB(GER8); 14:<br /> SB(AU); 15: SB(UK); 16: SB(UK2). Ký hiÖu vµ nguån gèc cña c¸c chñng tr×nh bµy ë b¶ng 1. Møc<br /> ®é t−¬ng ®ång cao vÒ nucleotit vµ axit amin gi÷a c¸c chñng ph©n lËp trong mét n−íc (§øc) (c¸c<br /> chñng GER1-8) ®−îc ®ãng khung vµ b«i ®Ëm ®Ó nhËn xÐt (cét 6-13, ngang vµ däc).<br /> SB(GER5)<br /> SB(GER7)<br /> Nucleotit<br /> SB(GER4)<br /> SB(GER1)<br /> SB(GER3)<br /> SB(GER2)<br /> SB(GER6)<br /> SB(GER8)<br /> SB(AU)<br /> A SB(NP3)<br /> SB(UK)<br /> SB(UK2)<br /> SB(VN)<br /> SB(CN)<br /> B<br /> SB(IN)<br /> 0,01 SB(NP1)<br /> <br /> H×nh 1. Mèi quan hÖ hä hµng vµ nguån gèc cña c¸c chñng SBV cña ViÖt Nam (SB (VN))<br /> vµ c¸c chñng cña thÕ giíi liÖt kª ë b¶ng 1, qua ph©n tÝch thµnh phÇn nucleotit<br /> b»ng ch−¬ng tr×nh MEGA2.1<br /> Ghi chó: Chñng cña ViÖt Nam (SB(VN)) ®−îc b«i ®Ëm; Nhãm A: nhãm c¸c chñng cña ch©u ©u;<br /> Nhãm B: nhãm c¸c chñng cña ch©u ¸. HÖ sè tiÕn hãa ®−îc tÝnh lµ 0,01.<br /> <br /> 40<br /> Axit amin SB(GER4)<br /> SB(GER5)<br /> SB(GER3)<br /> SB(GER1)<br /> SB(GER7)<br /> SB(GER2)<br /> SB(GER6)<br /> SB(AU)<br /> SB(GER8)<br /> SB(NP3)<br /> A<br /> SB(UK)<br /> SB(UK2)<br /> SB(IN)<br /> B<br /> SB(NP1)<br /> SB(VN)<br /> SB(CN)<br /> 0,01<br /> H×nh 2. Mèi quan hÖ hä hµng vµ nguån gèc cña c¸c chñng SBV cña ViÖt Nam (SB (VN))<br /> vµ c¸c chñng cña thÕ giíi liÖt kª ë b¶ng 1, qua ph©n tÝch thµnh phÇn axit amin<br /> b»ng ch−¬ng tr×nh MEGA2.1<br /> Ghi chó: Chñng cña ViÖt Nam (SB(VN)) ®−îc b«i ®Ëm; Nhãm A: nhãm c¸c chñng cña ch©u ©u;<br /> Nhãm B: nhãm c¸c chñng cña ch©u ¸. HÖ sè tiÕn hãa ®−îc tÝnh lµ 0,01.<br /> <br /> gèc. S¬ ®å mèi quan hÖ gi÷a c¸c chñng ®−îc thÓ còng hîp thµnh nhãm phô.<br /> hiÖn ë hai h×nh 1 vµ 2. C¸c chñng ph©n tÝch ph¶ hÖ<br /> Tuy nhiªn, cã mét chñng cña ch©u ¸ ph©n lËp<br /> dùa vµo c¶ 2 thµnh phÇn ®Òu cho kÕt qu¶ nh− nhau,<br /> t¹i Nªpan (chñng SB(NP3)) l¹i nhãm häp cïng<br /> ®ã lµ c¸c chñng ®−îc ph©n bè trong 2 nhãm, trong<br /> ®ã nhãm A bao gåm c¸c chñng cã nguån gèc ch©u víi c¸c chñng cña ch©u ©u. Theo Grabensteiner<br /> ©u (trõ chñng SB(NP3)); nhãm B bao gåm c¸c vµ cs. (2001), chñng nµy ®−îc ph©n lËp trªn ®µn<br /> chñng cã nguån gèc ch©u ¸, kÓ c¶ chñng SB(VN) ong nhËp tõ ch©u ©u vµo (thuéc loµi ong A.<br /> ph©n lËp t¹i ViÖt Nam (h×nh 1 vµ 2). mellifera). Râ rµng, tuy ph©n lËp t¹i cïng vÞ trÝ ®Þa<br /> lý (Nªpan), nh−ng chñng SB(NP3) g©y bÖnh trªn<br /> Chñng SBV ph©n lËp t¹i ViÖt Nam cã thµnh<br /> loµi ong ngo¹i A. mellifera cã quan hÖ ph¶ hÖ víi<br /> phÇn nucleotit vµ axit amin t−¬ng ®ång víi<br /> chñng cã nguån gèc Trung Quèc (b¶ng 2) vµ SBV g©y bÖnh trªn ong cña ch©u ©u vµ hoµn toµn<br /> ph©n tÝch ph¶ hÖ còng cho thÊy chóng cã quan kh¸c vÒ quan hÖ hä hµng víi chñng SB(NP1) lµ<br /> hÖ hä hµng gÇn nhau. Tuy còng n»m trong nhãm mét chñng SBV g©y bÖnh trªn loµi ong néi A.<br /> B (cã nguån gèc ch©u ¸) nh−ng c¸c chñng cña cerana ë Nªpan.<br /> Ên §é (SB(IN)) vµ Nªpan 1 (SB(NP1)) cã xu HiÖn nay, ë ViÖt Nam cã nhiÒu gièng ong<br /> h−íng xa h¬n víi c¸c chñng cña ViÖt Nam vµ ®ang ®−îc nu«i, tr−íc hÕt ph¶i kÓ ®Õn gièng ong<br /> cña Trung Quèc. TÊt c¶ c¸c chñng SBV cña néi A. cerana rÊt phæ biÕn vµ gièng ong ngo¹i<br /> ch©u ¸ nµy ®Òu ®−îc ph©n lËp tõ loµi ong Apis cã nguån gèc tõ Italia lµ A. mellifera ligustica<br /> cerana. Trong nhãm A cña c¸c chñng cã nguån ®−îc nhËp vµo ViÖt Nam tõ 30 n¨m nay. LiÖu ë<br /> gèc ch©u ©u, 8 chñng ph©n lËp t¹i §øc ®øng ViÖt Nam cã tån t¹i mét chñng SBV ngo¹i nh−<br /> gÇn nhau vµ c¸c chñng cña Anh (UK vµ UK2) chñng SB(NP3) ë Nªpan hay kh«ng lµ mét vÊn<br /> <br /> 41<br /> ®Ò cÇn nghiªn cøu. Chóng t«i ®ang thu thËp vµ quÇn thÓ SBV g©y bÖnh "nhéng bäc" t¹i<br /> ph©n tÝch c¸c chñng SBV ph©n lËp trªn ®µn ong ViÖt Nam.<br /> ngo¹i nu«i ë ViÖt Nam ®Ó cã cø liÖu t×m hiÓu vÒ<br /> nguån gèc vµ quan hÖ hä hµng cña chóng. Tµi liÖu tham kh¶o<br /> <br /> III. kÕt luËn 1. Bailey L., 1968: Annu. Rev. Entomol., 13:<br /> 191-212.<br /> 1. Virót g©y bÖnh “Êu trïng ong d¹ng tói” hay 2. Bailey L., 1976: Adv. Virus Res., 20: 271-<br /> cßn gäi lµ bÖnh “nhéng bäc” (sacbrood) ë 304.<br /> ViÖt Nam hoµn toµn thuéc nhãm ph¶ hÖ 3. Bailey L. and Fernando E. F. W., 1972:<br /> cïng víi c¸c chñng SBV cña ch©u ¸. Ann. Appl. Biol., 72: 27-35.<br /> 2. Ph©n tÝch ph¶ hÖ trªn hai d÷ liÖu vÒ nucleotit 4. Bailey L., Carpenter J. M. and Woods R.<br /> vµ axit amin ®Òu cho kÕt qu¶ lµ chñng SBV D., 1982: J. Invertebr. Pathol., 39: 264-5.<br /> cña ViÖt Nam cã quan hÖ hä hµng gÇn víi<br /> 5. Bailey L., Gibbs A. J. and Woods R. D.,<br /> chñng cña Trung Quèc, Ên §é vµ Nªpan 1964: Virology, 23: 425-429.<br /> (chñng SB(NP1)).<br /> 6. Chomczynski P. and Sacchi N., 1987:<br /> 3. C¸c chñng SBV cña ch©u ¸ cã quan hÖ Anal Biochem., 162(1): 156-159.<br /> nguån gèc vµ hä hµng hoµn toµn xa víi c¸c<br /> 7. Ghosh R. C. et al., 1999: J. Gen. Virol., 80:<br /> chñng SBV cña ch©u ©u do c¸c chñng SBV 1514-1549.<br /> cña ch©u ¸ lµ SBV g©y bÖnh trªn loµi ong<br /> 8. Grabensteiner E. et al., 2001: Clin. Diagn.<br /> néi (ong ch©u ¸) A. cerana, cßn c¸c chñng Lab. Immunol., 8(1): 93-104.<br /> cña ch©u ©u g©y bÖnh trªn loµi ong ngo¹i 9. Sambrook J. and Russell D., 2001:<br /> (ong ch©u ©u) A. mellifera. Molecular Cloning: A Laboratory Manual.<br /> 4. CÇn ph©n lËp thªm nhiÒu chñng SBV kh¸c, (3rd ed.) Cold Springs Harbor Press, Cold<br /> ®¹i diÖn cho c¸c vïng ®Þa lý trong c¶ n−íc, Springs Harbor N. Y.<br /> vµ ®¹i diÖn c¸c loµi ong mËt ®ang ®−îc nu«i 10. White G. F., 1917: Sacbrood. U. S. Dep.<br /> ë n−íc ta, nh»m thùc sù x¸c ®Þnh di truyÒn Agric. Bull. 431: 1-55.<br /> <br /> <br /> PRELIMINARY STUDIES ON THE ORIGIN AND THE PHYLOGENETIC RELATEDNESS OF THE<br /> SACBROOD VIRUS ISOLATED IN VIETNAM<br /> Le Thanh Hoa, Pham Viet Lien<br /> <br /> SUMMARY<br /> The 818 nucleotides sequence of a sacbrood virus (SBV) strain isolated from Vietnam was obtained by<br /> RT-PCR (reverse transcription polymerase chain reaction), cloned into a TA-vector (Invitrogen Inc.) and<br /> sequenced. This sequence was phylogenetically analyzed with the representative corresponding SBV<br /> sequences of asian and european origins. Using MEGA2.1 program (Molecular Evolution Genetics Analysis<br /> version 2.1), the phylogenetic relatedness and molecular evolutionary analyses of the SBV strains were<br /> established. Both nucleotide and amino acid phylogenetic analysis indicated that all the SBV strains of the<br /> asian origin fall into one group being completely separated from the another group of those of the european<br /> origin. The vietnamese SBV strain closely clustered with those of the mainland China and India and a SBV<br /> strain of Nepal (SB (NP1)). These SBV strains were isolated from the infected Apis cerana honeybee. All the<br /> european SBV strains performed a distinct group completely different from the asian SBV strains, except one<br /> SBV strain isolated from Nepal (SB (NP3)). These are due to the SBV strains isolated from the infected Apis<br /> mellifera honeybee. Phylogenetic analysis revealed that the vietnamese SBV strain was of geographically<br /> asian origin, having close biogeographic relatedness with those of mainland China and the neighbouring<br /> countries.<br /> Ngµy nhËn bµi: 23-1-2004<br /> 42<br />
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2