Two independent, light-sensing two-component systems
in a filamentous cyanobacterium
Helena J. M. M. Jorissen
1
, Benjamin Quest
2
, Anja Remberg
1
,The
´re
`se Coursin
3
, Silvia E. Braslavsky
1
,
Kurt Schaffner
1
, Nicole Tandeau de Marsac
3
and Wolfgang Ga¨ rtner
1,2
1
Max-Planck-Institut fu
¨r Strahlenchemie, Mu
¨lheim an der Ruhr, Germany;
2
Max-Planck-Institut fu
¨r Biochemie, Martinsried,
Germany;
3
Unite
´des Cyanobacte
´ries, De
´partement de Microbiologie Fondamentale et Me
´dicale, Institut Pasteur (URA-CNRS 2172),
Paris, France
Two ORFs, cphA and cphB, encoding proteins CphA and
CphB with strong similarities to plant phytochromes and to
the cyanobacterial phytochrome Cph1 of Synechocystis sp.
PCC 6803 have been identified in the filamentous cyano-
bacterium Calothrix sp. PCC7601. While CphA carries a
cysteine within a highly conserved amino-acid sequence
motif, to which the chromophore phytochromobilin is co-
valently bound in plant phytochromes, in CphB this position
is changed into a leucine. Both ORFs are followed by rcpA
and rcpB genes encoding response regulator proteins similar
to those known from the bacterial two-component signal
transduction. In Calothrix, all four genes are expressed under
white light irradiation conditions, albeit in low amounts. For
heterologous expression and convenient purification, the
cloned genes were furnished with His-tag encoding
sequences at their 3¢end and expressed in Escherichia coli.
The two recombinant apoproteins CphA and CphB bound
the chromophore phycocyanobilin (PCB) in a covalent and a
noncovalent manner, respectively, and underwent photo-
chromic absorption changes reminiscent of the P
r
and P
fr
forms (red and far-red absorbing forms, respectively) of the
plant phytochromes and Cph1. A red shift in the absorption
maxima of the CphB/PCB complex (k
max
¼685 and
735 nm for P
r
and P
fr
, respectively) is indicative for a
noncovalent incorporation of the chromophore (k
max
of P
r
,
P
fr
of CphA: 663, 700 nm). A CphB mutant generated at the
chromophore-binding position (Leu246 fiCys) bound the
chromophore covalently and showed absorption spectra
very similar to its paralog CphA, indicating the noncovalent
binding to be the only cause for the unexpected absorption
properties of CphB. The kinetics of the light-induced P
fr
formation of the CphA–PCB chromoprotein, though sim-
ilar to that of its ortholog from Synechocystis, showed dif-
ferences in the kinetics of the P
fr
formation. The kinetics were
not influenced by ATP (probing for autophosphorylation)
or by the response regulator. In contrast, the light-induced
kinetics of the CphB–PCB complex was markedly different,
clearly due to the noncovalently bound chromophore.
Keywords:Calothrix sp. strain PCC 7601; flash photolysis;
heterologous expression; phytochrome-like apoproteins
CphA and CphB; response regulators RcpA and RcpB.
A precise qualitative and quantitative measurement of the
surrounding light is essential to photosynthetic organisms in
order to either adapt to the environmental light conditions
or, in the case of motility, to proceed towards a favorable
habitat. Higher plants have developed the phytochromes, a
chromoprotein family, which absorb light in the long-
wavelength region and regulate numerous photomorpho-
genetic processes [1–3]. In cyanobacteria, the presence and
molecular structure of comparable sensory system(s) have
long been debated. It has been suggested that the photo-
synthetic apparatus itself or blue-light- and/or other non-
characterized light-absorbing photoreceptors might fulfil
these functions [4–7].
The complete sequencing of the genome of the cyano-
bacterium Synechocystis sp. [8] has afforded some clues on
the components putatively involved in light sensing. Probing
this genome with phytochrome consensus sequences has
yieldedanORF(slr0473) encoding a protein of 85 kDa
(Cph1) that exhibits in its N-terminal part strong homol-
ogies to the phytochromes of higher plants [9]. Besides this
particular ORF, also others with lower similarities to
phytochromes have been identified in Synechocystis sp. [10]
and in Fremyella diplosiphon (rcaE) [11], a mutant of
Calothrix sp. [12], as well as in other phototrophic and
heterotrophic prokaryotes [13–15].
Correspondence to W. Ga
¨rtner, Max-Planck-Institut fu
¨r
Strahlenchemie, Postfach 10 13 65, D-45413 Mu
¨lheim an der Ruhr,
Germany.
Fax: + 49 208 306 39 51, Tel.: + 49 208 3 06 36 93,
E-mail: gaertner@mpi-muelheim.mpg.de or N. Tandeau de Marsac,
Unite
´des Cyanobacteries, De
´partement de Microbiologie
Fondamentale et Medicale, Institut Pasteur (URA-CNRS 2172), 28
rue du Docteur Roux, F-75724 Paris Cedex 15, France.
Fax: + 33 1 40613042, Tel.: + 33 1456 88415,
E-mail: ntmarsac@pasteur.fr
Abbreviations:Anabaena sp., Anabaena/Nostoc sp. strain PCC 7120;
Calothrix sp., Calothrix sp. strain PCC 7601; CphA and CphB,
recombinant phytochrome-like apoproteins of Calothrix sp.;
CphA-PCB and CphB/PCB, chromoproteins obtained by covalent
binding of CphA to PCB and by noncovalent complexing of CphB to
PCB, respectively; PCB, phycocyanobilin; P
r
and P
fr
,redandfar-red
absorbing forms of phytochrome, respectively; Synechocystis sp.,
Synechocystis sp. strain PCC 6803.
Note: The sequences reported in this paper have been deposited in the
GenBank database (accession nos. AF309559 for cphA-rcpA,
AF309560 for cphB-rcpB.
(Received 12 November 2001, revised 20 March 2002,
accepted 12 April 2002)
Eur. J. Biochem. 269, 2662–2671 (2002) FEBS 2002 doi:10.1046/j.1432-1033.2002.02928.x
The strong similarity of slr0473 to the genes of the plant
phytochromes is also evident when the amino-acid sequences
and properties of the corresponding recombinant proteins
are compared. The cyanobacterial apoprotein (Cph1) binds
to both the chromophores of the plant phytochromes,
phytochromobilin, and to the closely related phycocyanobi-
lin (PCB). Moreover, the assembled chromoproteins can be
cycled between P
r
and P
fr
forms in a way reminiscent of the
plant phytochromes [k
max
668 nm (P
r
) and 717 nm (P
fr
)with
phytochromobilin as a chromophore, and 654 nm (P
r
)and
706 nm (P
fr
) with PCB] [16–18]. This discovery of a new
group of light-sensing signal transduction proteins has also
raised new questions on their function as putative photo-
receptors. In particular, as in the case of the gene product of
rcaE of Fremyella diplosiphon, the covalent binding of a
chromophore by the recombinant protein is still question-
able. Therefore, functional assays [18] were performed which
revealed signal transduction in Synechocystis sp. once the
photoreceptor is activated by absorption of a photon. While
the N-terminal part of the phytochrome-like protein of
Synechocystis sp. incorporates the chromophore, its
C-terminal part exhibits sequence motifs with a strong
similarity to the well-characterized two-component system
of other bacteria [19,20]. As found in the bacterial system,
this process of signal transduction functions via auto-
phosphorylation of a conserved histidinyl residue in the
receptor molecule (Cph1) and transphosphorylation to an
aspartate of a response regulator (Rcp1). The target amino
acids for both reactions, the autophosphorylation and
the phosphate transfer could be identified in vitro for
the recombinant Synechocystis proteins by site-directed
mutagenesis [18].
Extensive search for DNA sequences similar to those
found in Synechocystis sp. has revealed further members of
this protein family in a number of other cyanobacteria and
eubacteria [14,21]. Some of these proteins even lack the
covalent-binding forming cysteine, but nevertheless undergo
light-induced signal transduction via a Schiff base bonded
biliverdin chromophore (covalent bond to a histidine
residue) [14]. The widespread presence of this signal
transduction principle is further supported by the finding
that the ORFs of all these receptors are accompanied by a
coding sequence for a response regulator protein capable of
transferring the biological signal into the cell interior.
Here, we describe the biochemical and spectral charac-
terization of two independently functioning, light-sensing
receptor proteins and their cognate corresponding response
regulators as new members of the two-component signal
transduction protein family from the filamentous cyano-
bacterium Calothrix sp. PCC 7601.
MATERIALS AND METHODS
Strain and growth conditions
TheaxenicstrainCalothrix sp. strain PCC 7601 (this strain
has also been named Fremyella diplosiphon UTEX 481 and
Tolypothrix sp., however, in order not to cause confusion we
wish to remain with Calothrix sp. PCC 7601 [22]) was grown
at 30 C in liquid BG-11 medium containing 0.4 m
M
Na
2
CO
3
and supplemented with 10 m
M
NaHCO
3
.The
culture was stirred with a magnetic bar under a continuous
stream of air/CO
2
(99 : 1, v/v). White light of fluorescent
tubes (Universal White) provided a photosynthetic photon
flux density of 50 lmol photonsÆm
)2
Æs
)1
(measured with
a LICOR LI-185B quantum/radiometer/photometer
equipped with a LI-190SB quantum sensor).
The purity of the cultures was checked on plates of
medium BG-11 [22], supplemented with glucose and
casamino acids (0.2% and 0.02% w/v, respectively) and
solidified with Difco Bacto agar (1% w/v).
Plasmids were maintained in the E. coli strain DH5aF¢.
Recombinant E. coli strains were grown at 37 Cina
Luria–Bertani medium supplemented with 100 lgÆmL
)1
ampicillin.
Cloning of phytochrome- and response
regulator-encoding DNAs
Calothrix sp. genomic DNA was extracted from a culture
growntoanD
750
value of 0.8, using the Nucleobond for the
isolation of genomic DNA of bacteria (Macherey–Nagel).
Total genomic DNA digested with NheIorHindIII gave
strong hybridization signals (5.5 and 6 kb, respectively) with
the PCR products [21] corresponding to a portion of the
cphA and cphB genes, respectively. Two partial libraries
were constructed by ligating NheIandHindIII DNA
fragments of 6 kb into the dephosphorylated pBluescript
SK
–
vector digested with XbaIandHindIII, respectively, as
described previously [23]. Ligated DNA was transformed by
electroporation (Bio-Rad, GENE PULSER) into the E. coli
strain DH5aF¢[24]. The clones carrying the proper inserts
were selected by colony hybridization with either the cphA
or cphB PCR products as probes. The recombinant plasmid
DNAs were purified with the QIA filters (Qiagen kit 12262)
according to manufactors’ instructions, and they were
sequenced (3200 nucleotides) on both strands (Genome
Express, Paris, France).
The full-length DNAs encoding the cyanobacterial
phytochrome-like proteins and their respective response
regulators were synthesized with an octadecamer oligonu-
cleotide at their 3¢end encoding for six histidine residues and
with restriction sites for cloning into the E. coli vector
pMEX8 (Medac). For cphB and rcpA the putative trans-
lation start codons TTG and GTG, respectively, were
replaced by ATG. The cphA gene was cloned between the
NcoIandSalI sites of the vector. The cphB,rcpA and rcpB
genes were cloned between the EcoRI and SalIsitesofthe
vector. The following primers (5¢to 3¢) were used (restriction
sites and sequences coding for a His6 tag are underlined,
start and stop codons are given in bold, and gene-specific
sequences in italics): cphA:forward,GCGATA
CCATGG
TATCCGAATTCCAAG and reverse, ACCCGGGTCG
ACTCAGTGATGGTGGTGATGGTGTCCTCGACC
AAAAAGATC;rcpA:forward,GCGATA
GAATTCATG
AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT
GTCGACTCAGTGATGGTGGTGATGGTGCTCCG
ACGGCAATGTCG;cphB:forward,GCGATA
GAATTC
ATGACGAATTGCGATCGCGA and reverse, ACCCGG
GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC
CTCCTGCAATGT;cphBlong:forward,GCGATA
GAA
TTCATGTTGCAGTTAATTTATAACAATT; the reverse
primer was identical to that used for cphB;rcpB:forward,
GAGGCTGAATTCATGGTAGGAAACGCTACTCAAC;
reverse, CGAAGCTTGTCGACTCAGTGATGGTGGT
GATGGTGACCCATCTCAGGAAGTACAAC.
FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2663
Total RNA extraction, cDNA synthesis
and specific mRNA detection
Total RNA from white light-grown cells from Calothrix
PCC 7601 was extracted as described previously [25] with
the following modifications: cells were resuspended in BG11
medium to a D
750
of 50 and disrupted in a Mickle
desintegrator six times for 1 min at 4 C. The ethanol-
precipitated total RNA pellets were taken up in 50 lLof
sterile water containing 0.1% (v/v) DEPC and directly
treated with DNAse I ribonuclease-free as follows. A
sample of total RNA (300 lg) was resuspended in a buffer
containing 50 m
M
Tris/HCl pH 7.5, 10 m
M
MgCl
2
,0.1 m
M
dithiothreitol and treated twice with 200 U of DNase I
ribonuclease-free (Boehringer Mannheim) for 45 min at
37 C. After two phenol/chloroform treatments, total RNA
was ethanol-precipitated for 12 h at 20 C and resuspended
in 50 lL of DEPC-treated water. As a control for RNA
purity, a DNase I-treated sample (1 lg) of total RNA was
amplified by PCR with the primers used for further cDNA
detection. No amplification product was obtained confirm-
ing the absence of DNA in the RNA preparations.
A pool of total cDNAs was synthesized using random
primers with the SuperScriptTM First-Strand Synthesis
System for reverse transcriptase PCR amplifications (Gibco
BRL) as recommended by the manufacturer. A second set
of specific cDNAs was synthesized using the following
primers specific of the cphA,rcpA,cphB and rcpB genes:
cphA primer: 5¢-GGTAGCACCTTCGCCCAGTTGTGA
CTC-3¢;rcpA primer: 5¢-GCTGGCTCAGGTTGCGAGA
TTTGGTG-3¢;cphB primer: 5¢-CGCGATGGTTAGCCC
TGCACCCG-3¢;rcpB primer: 5¢-GTCTGAACCGTCTC
GGTGAGACG-3¢.
Total RNA (5 lg) was incubated with 120 pmoles of
each of the primers specific of the cphA,rcpA,cphB and
rcpB genes in 12 lL of DEPC-treated water for 10 min at
70 C. Samples were cooled down on ice and incubated with
the SuperScriptTM First-Strand buffer (Gibco BRL) con-
taining 10 m
M
dithiothreitol and 0.5 m
M
dNTP for 2 min at
42 C. After addition of 200 U of SuperScript II RNase H
–
reverse transcriptase and incubation for 50 min at 42 C,
followed by 15 min at 70 C, 2 lL of cDNA containing
samples were used for PCR amplifications in the presence of
5U of rTaq polymerase (Amersham Pharmacia) and
different combinations of the following forward and reverse
primers (170 pmol of each): cphA gene: primer 1, 5¢-GGTA
GAGTGATATTTACAG-3¢(forward); primer 2, 5¢-CGCT
TCATTGGGATTACC-3¢(reverse); cphB gene: primer 3,
5¢-CCCTATGAAATCCGTAGCG-3¢(forward); primer 4,
5¢-GGTAGAGATTGTCGCTGCAC-3¢(reverse); primer
5, 5¢-CAAACAGCCGCGCCTGTAGC-3¢(reverse); rcpA
gene:primer6,5¢-GCTGATATCCGCTTAATCC-3¢(for-
ward); primer 7, 5¢-GACGTGTAAGTCGTAGCTATG-3¢
(reverse); rcpB gene: primer 8, 5¢-GGAAACGCTACTCAA
CCGTTGC-3¢(forward); primer 9, 5¢-TCCCGCCCATCA
GTTCCTGG-3¢(reverse).
The program for PCR (Robocycler gradient 40, Strata-
gene) was one cycle for 5 min at 95 C, 1 min at 55 Cand
30 s at 72 C, 40 cycles at the same temperatures for 1 min,
1 min 30 s and 1 min, respectively, and one cycle for 1 min,
1 min and 5 min, respectively. The PCR products were
analyzed by electrophoresis (1.2% (w/v) agarose gels, Tris/
borate buffer) [23].
Generation of the Leu246 fiCys mutant of CphB
A point mutation was introduced into cphB, converting the
leucine-encoding codon into TGT, encoding for cysteine,
thus principally allowing covalent chromophore binding.
Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTT
CGCCGTGTCACATTGAATATTTGCACAATATGG
-3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAA
TGTGACACGGCGAAACGCTGCGGAGTACCGAG
TG-3¢. Sequences different from the wild-type CphB
sequence are given in bold.
Expression of (apo)proteins, chromoprotein assembly
and affinity purification
This followed recently published procedures [26]. In brief,
the E. coli strain C600 was used as a host (for expression of
CphB L246C mutant, E. coli BL21DE3RIL from Strata-
gene was used), and was grown at 37 C in Luria–Bertani
medium [23] containing penicillin (150 lgÆmL
)1
)to
D
600
¼1.8. BL21DE3RIL cells were induced with IPTG
following the instructions of the manufacturer. Cells were
harvested by centrifugation (2200 g,10min,4C) and
opened at liquid nitrogen temperature by treatment with an
Ultraturrax (Jahnke & Kunkel T25, 10 000 r.p.m.). The
cellular debris was pelleted by centrifugation (39 000 g,
30 min, 4 C). The supernatant was cleared by ultracentrif-
ugation (200 000 g,45min,4C). After readjusting the pH
to 8.0, the cleared crude extract was incubated with PCB.
The amount of assembled chromoprotein was determined
from the difference spectrum (P
r
)P
fr
), based on the P
r
absorption coefficient of the recombinant phytochrome-like
protein of Synechocystis sp. (e
max
85 000
M
)1
Æcm
)1
at
656 nm [27]). Purification of the assembled chromoproteins
was accomplished by affinity chromatography on a Talon
metal affinity resin (Clontech). The analysis of protein
content and purity was performed by polyacrylamide gel
electrophoresis and Western blotting (PHAST system,
Pharmacia) employing an anti Penta-His antibody from
Qiagen.
Assembly kinetics, determination of absorption maxima/
difference spectra, P
fr
stability, and P
r
-to-P
fr
kinetics
For the determination of the assembly kinetics, the
apoproteins were purified as described for the assembled
chromoproteins and were incubated in the dark with a
10-fold excess of PCB. The assembly kinetics was followed
at 10 C and at room temperature. In addition to normal
buffer, deuterated buffers were also used for these meas-
urements. For CphA–PCB, the absorption rise at 663 (k
max
of P
r
) and 700 nm was recorded. For the CphB/PCB
complex, spectra were run from 600 to 750 nm, and the
absorption rise at 685 nm (k
max
of P
r
) was determined. The
fully assembled chromoproteins were subjected to repetitive
red and far-red irradiations [interference filter at
658 ± 7 nm and cut-off filter > 715 nm, Schott] for P
fr
and P
r
formation, respectively. Absorption spectra were
recorded with a Shimadzu spectrophotometer UV-2102/
2402PC. For the determination of the thermal stability of
the P
fr
form, the samples were irradiated at 658 nm until
a maximum of P
fr
was formed. Subsequently, the
spectral changes of the sample during the storage at room
2664 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269)FEBS 2002
temperature in the dark were recorded by measuring spectra
(500–800 nm) at various time intervals.
The laser flash-induced P
r
-to-P
fr
formation was followed
in the time range from 1ls to 5 s essentially as described
previously [28]. In some experiments, ATP was added to a
final concentration of 1.5 m
M
. When the response regulator
was added during the measurements, it was used in about
eight-fold molar excess over the amount of phytochrome.
Recorded data were averaged and treated by a global fit
analysis as described previously [28].
RESULTS
Two ORFs of the cyanobacterium Calothrix sp., cphA (2304
nucleotides, GenBank accession number AF309559) and
cphB (2298 nucleotides, AF309560), initially cloned in part
by using the same PCR primer sets [21], have now been fully
characterized. Both ORFs encode proteins with strong
sequence similarities to plant phytochromes and to Cph1 of
Synechocystis sp., the first phytochrome protein identified in
cyanobacteria. However, despite a particularly high
sequence degree of similarity in the chromophore region
for both the CphA and CphB proteins of Calothrix sp.
(Fig. 1), in the latter protein the chromophore-binding
cysteine is replaced by a leucyl residue (position 246; Fig. 1).
A comparison of their complete amino-acid sequences with
those of the cyanobacterial phytochromes available to date
(Table 1, see also gene sequences deposited at GenBank)
confirms the membership of the new Calothrix proteins to
this protein family, the highest score being found between
Calothrix sp. CphA and Anabaena sp. AphA (GenBank
accession no. AB028873).
The translation starting point of cphA is identified by the
putative Shine–Dalgarno sequence, GAGGA at nucleotide
positions 33–37 (Fig. 2), and the ATG at position 46
indicating the first amino-acid residue. For the cphB gene,
there are two possible translation initiation sites. The first
one is at position 28 (TTG, coding for leucine and preceded
by a stop codon) with a putative Shine–Dalgarno sequence
AAGG at positions 18–21. Another one is located at
position 118 (TTG) with a putative Shine–Dalgarno
sequence GAGG at positions 109–112. In both cases, a
leucine is encoded as the first amino acid, which for
heterologous expression was replaced by methionine
(ATG).
In addition to the high sequence similarity to the
phytochromes in the N-terminal half, a motif (ASHDL)
reminiscent of the histidine kinases of the two-component
signal transduction were found in the C-terminal parts of
CphA and CphB with the histidinyl residues prone to
autophosphorylation (positions 538, CphA, and 526, CphB).
The response regulator-encoding genes rcpA and rcpB
(447 and 450 nucleotides, respectively, corresponding to 148
and 149 amino acids) were found downstream from cphA
and cphB, respectively (Fig. 2). The sequence of rcpA over-
laps by more than 50 nucleotides with that of cphA,
assuming an operon-like arrangement. In the case of cphB
and rcpB, the stop codon of the receptor gene and the ATG
of the response regulator gene are separated by four
nucleotides. A comparison of the deduced amino-acid
sequences of response regulators reveals a high degree of
conservation: RcpA is 66% identical with its Synechocystis
sp. ortholog and 39% with its Calothrix paralog. All motifs
common to the two-component response regulators, in
particular those involved in the phosphate transfer from the
receptor, are conserved and can readily be identified
(Fig. 3).
Fig. 1. Sequence alignment of the chromo-
phore-binding domain of phytochrome-like
proteins of cyanobacteria (Calothrix sp. CphA
and -B, Synechocystis sp. Cph1, and Anabaena
sp. AphA and AphB, GenBank numbers
AB028873 and AB034952), Arabidopsis thali-
ana (At phyA and -C) and Solanum tuberosum
(St phyA and -B). Grey boxes: amino acids
identicalinnomorethaneightofthenine
sequences. The position of covalent chromo-
phore attachment (in case a cysteinyl residue is
present) is indicated by an asterisk.
Table 1. Percentage of sequence identity of prokaryotic phytochrome-
like apoproteins.
7601CphB 6803Cph1 7120AphA 7120AphB
a
7601CphA
b
43 58 81 45
7601CphB
b
–424563
6803Cph1
c
––5942
7120AphA
d
–––46
Phytochrome-like apoproteins of:
a
Anabaena sp. (Genebank
accession no. AB028873),
b
Calothrix sp.,
c
Synechocystis sp. [8].,
and
d
Anabaena sp. (GenBank accession no. AB034952).
FEBS 2002 Light sensing two component systems in Calothrix (Eur. J. Biochem. 269) 2665
A transcription analysis indicated that both the receptor-
and the response regulator-encoding ORFs are expressed,
albeit in low yields as the transcripts could not be detected
by Northern hybridizations but only by PCR amplification
of either pools of total cDNAs or of cDNAs specific of the
cphA,rcpA,cphB and rcpB genes. In each case, the size of
PCR products obtained were as expected from the combi-
nation of the primers used for the amplification (Fig. 4).
Moreover, a PCR product was obtained when the specific
primers 1 and 2 were used to amplify cphA from the cDNA
synthesized with the rcpA primer (Fig. 4). This demonstra-
ted that cphA and rcpA form an operon. In contrast, no
PCR product was obtained when the specific primers 3 and
4 were used to amplify cphB from the cDNA synthesized
with the rcpB primer, suggesting that cphB and rcpB are
transcribed independently.
Both receptor-encoding ORFs were furnished at their 3¢
end with a His6-encoding octadecanucleotide tail and were
cloned into the E. coli vector pMEX8 for heterologous
expression. For cphB, two different starting sites were used
(Fig. 2). While the expression of cphA was sufficiently high
(based on Western blot analysis, and also estimated from
incubation experiments with linear tetrapyrrole chromo-
phores, see above), the yield of the gene product of cphB was
considerably lower, irrespective of which of the two cphB
constructs was expressed, and a large amount of the protein
was found in inclusion bodies.
Fig. 3. Sequence alignment of the cyanobacte-
rial response regulators 7601RcpA and -B (of
Calothrix sp.), and 6803Rcp1 (of Synechocystis
sp.). Grey boxes: amino acids identical in two
out of the three sequences. The phosphate-
accepting aspartate (Asp69 in RcpA) is indi-
cated by an asterisk, and the other amino acids
generating the binding site (Glu13, Asp14,
Thr99, Lys121) are marked by a diamond.
Fig. 4. Expression of the cphA,rcpA,cphB and rcpB genes in Calothrix
PCC 7601 cells grown under 50 lmol photonsÆm
)2
Æs
)1
of white light.
PCR products of the cDNA specific of cphA amplified with primers 1
and 2 specific of cphA (450 bp, line 1), of the cDNA specific of cphB
with primers 3 and 5 specific of cphB (200 bp, line 4), of the cDNA
specific of rcpA amplified with primers 1 and 2 specific of rcpA (450 bp,
line 2), of the cDNA specific of rcpB amplified with primers 3 and 4
specific of rcpB (no detectable product, line 5), and of the cDNA pool
with primers 6 and 7 specific of rcpA (290 bp, line 3) or primers 8 and 9
specific of rcpB (230 bp, line 6).
Fig. 2. Genomic arrangement of phytochrome and response regulator
ORFs of Calothrix sp. showing the start and stop regions of the genes.
Putative Shine–Dalgarno sequences and start positions of the coding
regions are underlined. For cphB both putative starting sequences are
indicated. In all cases, the nucleotides encoding leucine/valine at
position one of the protein were changed for heterologous expression
into methionine (ATG codons).
2666 H. J. M. M. Jorissen et al. (Eur. J. Biochem. 269)FEBS 2002