Identification, cloning and characterization of two thioredoxin
h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome
Kenji Maeda, Christine Finnie, Ole Østergaard and Birte Svensson
Department of Chemistry, Carlsberg Laboratory, Copenhagen, Denmark
Two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, were
identified in two and one spots, respectively, in a proteome
analysis of barley (Hordeum vulgare) seeds based on 2D gel
electrophoresis and MS. HvTrxh1 was observed in 2D gel
patterns of endosperm, aleurone layer and embryo of
mature barley seeds, and HvTrxh2 was present mainly in the
embryo. During germination, HvTrxh2 decreased in abun-
dance and HvTrxh1 decreased in the aleurone layer and
endosperm but remained at high levels in the embryo. On the
basis of MS identification of the two isoforms, expressed
sequence tag sequences were identified, and cDNAs enco-
ding HvTrxh1 and HvTrxh2 were cloned by RT-PCR. The
sequences were 51% identical, but showed higer similarity
to thioredoxin h isoforms from other cereals, e.g. rice Trxh
(74% identical with HvTrxh1) and wheat TrxTa (90%
identical with HvTrxh2). Recombinant HvTrxh1, HvTrxh2
and TrxTa were produced in Escherichia coli and purified
using a three-step procedure. The activity of the purified
recombinant thioredoxin h isoforms was demonstrated
using insulin and barley a-amylase/subtilisin inhibitor as
substrates. HvTrxh1 and HvTrxh2 were also efficiently
reduced by Arabidopsis thaliana NADP-dependent thio-
redoxin reductase (NTR). The biochemical properties of
HvTrxh2 and TrxTa were similar, whereas HvTrxh1 had
higher insulin-reducing activity and was a better substrate
for Arabidopsis NTR than HvTrxh2, with a K
m
of 13 l
M
compared with 44 l
M
for HvTrxh2. Thus, barley seeds
contain two distinct thioredoxin h isoforms which differ
in temporal and spatial distribution and kinetic proper-
ties, suggesting that they may have different physiological
roles.
Keywords: barley seed; disulfide reduction; proteomics;
recombinant proteins; thioredoxin h.
Thioredoxins are protein disulfide reductases of molecular
mass 12 kDa [1]. The conserved active-site sequence
WCGPC forms a disulfide bond in the oxidized form of the
protein. The reduced, dithiol form of thioredoxin can
modulate the activity of a variety of target proteins by
reduction of their disulfide bonds. Plants contain several
forms of thioredoxin which differ in their subcellular
localization and thus in the target proteins with which they
interact [2,3]. Thioredoxins f and m are found in chloro-
plasts and are involved in regulation of photosynthetic
enzymes [4], whereas thioredoxin h is primarily cytosolic,
and has also been identified in rice as one of the major
protein components of phloem sap [5]. A mitochondrial
thioredoxin system has been identified in Arabidopsis [6].
The catalytic system comprises, in addition to thioredoxin,
an electron donor and a thioredoxin reductase, which are
required for regeneration of the reduced form of thio-
redoxin. Thioredoxins f and m are reduced by ferredoxin
via ferredoxin-dependent thioredoxin reductase [2]. Thio-
redoxin h is reduced by NADPH via NADP-dependent
thioredoxin reductase (NTR) [7].
Thioredoxin h has been found to have an important
influence on seed germination in barley and other plants
[8,9]. Among the known target proteins of thioredoxin h in
seeds are storage proteins such as hordeins in barley and
glutenins and gliadins in wheat, which are deposited in
disulfide-bound complexes and are mobilized during the
germination process. Reduction by thioredoxin renders
them more soluble and susceptible to proteolytic degrada-
tion [10]. Some a-amylase/trypsin inhibitor proteins [11]
are also known targets of thioredoxin h, as is the barley
a-amylase/subtilisin inhibitor (BASI) [12]. Studies of germi-
nating transgenic barley seeds overexpressing wheat thio-
redoxin h revealed that limit dextrinase activity was
increased [13], and that a-amylase activity increased earlier
than in normal seeds [14]. This implicates thioredoxin h in
regulation of the mobilization of starch reserves during seed
germination.
Multiple forms of thioredoxin h exist in plants; at least
five isoforms have been identified in Arabidopsis [15] and
three in wheat [16,17]. Whether these isoforms have
different specificities or functions in the plant is not known.
However, yeast complementation studies have provided
evidence for different target specificities of Arabidopsis
Correspondence to C. Finnie, Department of Chemistry, Carlsberg
Laboratory, Gamle Carlsberg Vej 10, DK-2500 Valby, Copenhagen,
Denmark. Fax: + 45 33274708, Tel.: + 45 33275304,
E-mail: csf@crc.dk
Abbreviations: BASI, barley a-amylase/subtilisin inhibitor; DTNB,
5,5¢-dithio-bis-(2-nitrobenzoic acid); EST, expressed sequence tag;
NTR, NADP-dependent thioredoxin reductase; TC, tentative
consensus; TIGR, The Institute for Genomic Research.
Proteins and enzymes:Arabidopsis NADP-dependent thioredoxin
reductase (Q39243) (EC 1.8.1.9); barley a-amylase/subtilisin inhibitor
(P07596); wheat thioredoxin h TrxTa (O64394); barley thioredoxin h1
HvTrxh1 (AY245454); barley thioredoxin h2 HvTrxh2 (AY245455).
(Received 10 March 2003, revised 23 April 2003,
accepted 28 April 2003)
Eur. J. Biochem. 270, 2633–2643 (2003) FEBS 2003 doi:10.1046/j.1432-1033.2003.03637.x
thioredoxin h isoforms [18]. Three forms of thioredoxin h
have been observed in Western blots with barley seed
extracts [9], and a gene has been identified in the wild barley
Hordeum bulbosum that resembles a subset of thioredoxin h
sequences [19]. However, until now, barley thioredoxin h
has not been characterized at the protein level and target
proteins in barley have been identified using thioredoxins
from other organisms.
Proteomics, based on the techniques of 2D gel electro-
phoresis and MS, offers the opportunity to study the
appearance patterns of many proteins simultaneously, and
to identify proteins of interest. Recently, these techniques
have been applied to the study of seed development and
germination in several plants including Arabidopsis [20,21],
wheat [22] and barley [23–25]. We used 2D gel electropho-
resis to identify thioredoxin h forms in barley seeds and
characterize their patterns of appearance in the seed tissues
and during germination. Identification of thioredoxin h
forms in mature seed extracts by MS peptide mapping
enabled cloning of the corresponding genes encoding two
thioredoxin h forms with different appearance patterns.
Recombinant proteins were produced and found also to
differ in their biochemical properties. This is the first
characterization of barley thioredoxin h proteins, and this
comparative study of their properties extends our know-
ledge of the cereal thioredoxin h family.
Materials and methods
Materials
Rabbit antibody to wheat thioredoxin h was kindly sup-
plied by B. Buchanan (UC Berkeley, CA, USA). Secondary
antibodies were from Dako A/S. Primers were from DNA
Technology (Aarhus, Denmark). Pfu DNA polymerase
and BL21(DE3)Gold were from Stratagene. Restriction
enzymes, DNA ligase and BL21(DE3)pLysS were from
Promega. The pETtrxTa expression system was kindly
provided by M. Gautier (INRA, Montpellier, France).
Purified Arabidopsis thaliana NTR and Populus tremula
thioredoxin h were kindly supplied by J.-P. Jacquot (INRA,
Nancy, France). Bovine pancreas insulin, monobromo-
bimane, isopropyl thio-b-
D
-galactoside, 5,5¢-dithiobis-(2-
nitrobenzoic acid) (DTNB) and NADPH were from Fluka.
Plant material and protein extraction
Spring barley (Hordeum vulgare cv. Barke) was field grown
in Fyn, Denmark, in the 2000 season. Seeds were micro-
malted according to standard procedures [23]. Micromalted
seeds were frozen in liquid nitrogen and freeze-dried before
milling and extraction.
Barley seeds were dissected as previously described [25].
Dissected tissues from five seeds were freeze-dried before
extraction. Proteins were extracted from 4 g milled seeds in
20 mL extraction buffer (5 m
M
Tris/HCl, pH 7.5, 1 m
M
CaCl
2
)for30minat4C, as previously described [24].
Dissected tissues from five seeds were extracted in the same
buffer for 30 min at 4 C as previously described [25]. After
centrifugation to remove debris, supernatants containing
soluble proteins were transferred to clean tubes and stored
at )80 C until required.
2D gel electrophoresis
Proteins contained in 250 lLand100lL mature seed
extract were applied to the gels for colloidal Coomassie
staining and 2D Western blotting, respectively. Duplicate
gels were run containing proteins from 100 lLdissected
seed extracts. By loading equal volumes, a similar ratio
is seen between the proteins from each tissue on the
dissected seed gels as the whole seed gels [25]. Germi-
nated seed gels were also loaded with proteins from an
equal volume of extract (100 lL), as the soluble protein
content of germinated seeds is increased as the result of
mobilized storage proteins. Thus, by loading equal
volumes, proteins that remain at a constant level during
germination will also appear at similar intensity on the
2D gels.
Proteins were precipitated with 4 vol. acetone at )20 C
for 24 h and resuspended in reswelling buffer [8
M
urea, 2%
(w/v) CHAPS, 0.5% (v/v) IPG buffer 4–7 (Amersham
Biosciences), 20 m
M
dithiothreitol and a trace of bromo-
phenol blue]. IEF was carried out using 18 cm immobilized
linear pH gradient (IPG) strips, pI 4–7, run on an IPGphor
(Amersham Biosciences) as previously described [24].
Second-dimension SDS/polyacrylamide gels (12–14%,
18 ·24 cm; Amersham Biosciences) were run on a Phar-
macia Multiphor II according to the manufacturer’s
recommendations. Gels were stained with silver nitrate
[26] or colloidal Coomassie blue [27].
For immunodetection of thioredoxin h, the 2D gel was
blotted on to a nitrocellulose membrane in 10 m
M
CAPS,
pH 11.0, using a Multiphor II NovaBlot unit (Amersham
Biosciences). Immunodetection was carried out according
to standard protocols, using a 1 : 2000 dilution of rabbit
anti-(wheat thioredoxin h) serum. Goat anti-rabbit horse-
radish peroxidase-conjugated secondary IgGs were used at
a 1 : 5000 dilution, and the signal was detected by enhanced
chemiluminescence [28].
In-gel digestion and MALDI-TOF MS
Spots were excised from the colloidal Coomassie-stained gel
and subjected to in-gel trypsin digestion [29]. Tryptic
peptides were desalted and concentrated on a home-made
5 mm nano-column [30] as previously described [24].
Peptides were eluted with 0.8 lL matrix (20 mgÆmL
)1
a-cyano-4-hydroxycinnamic acid in 70% acetonitrile/0.1%
trifluoroacetate) and deposited directly on to the MALDI
target.
A Bruker REFLEX III MALDI-TOF mass spectrometer
(Bruker-Daltonics, Bremen, Germany) in positive ion
reflector mode was used to analyse tryptic peptides. The
m/zsoftware (Proteometrics, New York, NY, USA) was
used to analyse spectra. Spectra were calibrated using
trypsin autolysis products (m/z842.51 and m/z2211.10) as
internal standards. To identify proteins, the SwissProt and
NCBI nonredundant sequence databases and the NCBI
expressed sequence tag (EST) databases were searched with
peptide masses using the Mascot (http://www.matrix
science.com) server. Tentative consensus (TC) sequences
corresponding to identified EST sequences were obtained by
searching the Institute for Genomic Research (TIGR)
sequence database (www.tigr.org/tdb/tgi/hvgi).
2634 K. Maeda et al.(Eur. J. Biochem. 270)FEBS 2003
Cloning and sequencing of barley thioredoxin h isoforms
Embryos were dissected from five seeds after 24 h micro-
malting, and total RNA was extracted using the RNAeasy
kit (Qiagen) according to the manufacturer’s recommenda-
tions, for use as a template in RT-PCR.
Hvtrxh1. The coding sequence of HvTrxh1 was amplified
by RT-PCR from barley embryo RNA using the primers
trxh8 (TTCATATGGCCGCCGAGGAGGGAG) and
trxh9 (GGGGATCCTAACCGGGCAATCACTCTTC).
The primers were designed on the basis of the sequence of
TC44851 and introduce an NdeI restriction site (underlined
in trxh8) at the start codon (bold) and a BamHI restriction
site (underlined in trxh9) after the stop codon. Reverse
transcription and the following PCR was carried out on
total RNA using an RT-PCR kit (Qiagen) and a PTC-200
Peltier Thermal Cycler (MJ Research). The RT-PCR
product was cloned into pCR4-TOPO (Invitrogen) to give
pCR-h1.
Hvtrxh2. Primers trxh5 (TTGAATTCGCGTGAGAAA
TAAGCCGAGT) and trxh6 (TTCTGCAGTCTTCTT
GAGAGGACCTTTT), based on TC45680, were used for
amplification of the HvTrx2 coding sequence as above. A
second PCR with Pfu DNA polymerase and primers trxh1
(TTCATATGGCGGCGTCGGCAACGGCG) and trxh2
(GGGGATCCTGAGCGGCAATTTTATTTAGGCG)
was used to introduce an NdeI restriction site (underlined in
trxh1) at the start codon (bold) and a BamHI restriction site
(underlined in trxh2) after the stop codon of HvTrxh2. The
resulting PCR product was cloned into pCR Blunt II–
TOPO (Invitrogen) to give pCR-h2.
Construction of expression vectors. Inserts were isolated
from pCR-h1 and pCR-h2 by digestion with Nde1and
BamHI and ligated into the pET11a expression vector
linearized with Nde1andBamHI, to give pETHvTrxh1 and
pETHvTrxh2, respectively. The sequences of the inserts
were determined on both strands and found to be as
expected from the identified TC sequences, and confirmed
that the cloning junctions were correct. Accession numbers
for HvTrxh1 and HvTrxh2 sequences are AY245454 and
AY245455, respectively.
Expression and purification of recombinant barley
thioredoxin isoforms
Saturated cultures of Escherichia coli BL21(DE3)Gold
transformed with pETHvTrxh1 or pETHvTrxh2 were
diluted 100-fold in 2 L Luria–Bertani medium and grown
at 37 C. After reaching an A
600
of 0.6, the cultures were
induced with 100 l
M
isopropyl thio-b-
D
-galactoside for 3 h.
Cells were harvested and stored at )20 C until use. With
the same procedure, wheat TrxTa was expressed in
BL21(DE3)pLysS transformed with pETtrxTa [17].
HvTrxh1, HvTrxh2 and TrxTa were purified by a
procedure for TrxTa [17] with minor modifications. Har-
vested cells were resuspended in 100 mL 50 m
M
Tris/HCl/
1m
M
EDTA, pH 8.0 and lysed by passage three times
through a French Press. The lysate was sonicated to shear
nucleic acids and centrifuged to remove insoluble material.
The supernantant was heat-treated for 7 min at 65 Cand
centrifuged to remove aggregated material. The supernatant
was filtered and loaded on a HiLoad 26/10 Q Sepharose
High Performance column (Amersham Biosciences) equi-
librated with 30 m
M
Tris/HCl, pH 8.0. Proteins were eluted
by a linear gradient from 0 to 700 m
M
NaCl in the same
buffer. Thioredoxin h-containing fractions were detected by
dot blotting 0.5 lL on to a nitrocellulose membrane.
Immunodetection was carried out as described above,
except that an alkaline phosphatase-conjugated swine anti-
rabbit secondary IgG was used, and signal was detected
using a 5-bromo-4-chloro-3-indolyl phosphate/nitroblue
tetrazolium tablet (Sigma Chemical, St Louis, MO, USA).
Thioredoxin-containing fractions were pooled and concen-
trated using a Centriprep YM3 (Millipore, Bedford, MA,
USA) to 2 mL. The concentrated samples were then
loaded on a HiLoad 16/60 Superdex 75 prep grad column
(Amersham Biosciences) equilibrated with 30 m
M
Tris/HCl,
pH 8.0, and eluted at a flow rate 0.2 mLÆmin
)1
. Thio-
redoxin-containing fractions were detected by dot-blotting
as above and pooled.
Purified proteins were quantified by amino-acid analysis.
Amino-acid amounts in protein hydrolysates were deter-
mined using Biochrom 20 (Pharmacia Biotech).
N-Terminal sequencing was performed using a 477A
protein sequencer equipped with a 120A phenylthiohydan-
toin analyzer (Applied Biosystems). Liquid chromatogra-
phy MS spectra of 100 pmol intact purified proteins were
obtained using an HP 1100 LC/MSD (Hewlett-Packard).
For SDS/PAGE, 3 lg HvTrxh1 or HvTrx2 was loaded on
to a NuPAGE Bis/Tris 4–12% gel (Invitrogen) in the
presence of 0.5 m
M
dithiothreitol. For native IEF, 1 lg
HvTrxh1 or HvTrxh2 was loaded on to an IEF PhastGel
covering the range pI 4.0–6.5 (Amersham Biosciences).
Molecular modelling and sequence analysis
The 3D structures of HvTrxh1 and HvTrxh2 were modelled
using the SWISS-MODEL server (http://www.swissmodel.
unibas.ch/) and Swiss PDB-viewer [31], with the crystal
structure of thioredoxin h from Chlamydomonas reinhardtii
(PDB accession 1EP7) [32] as a template. The modelled
structures covered residues 5–115 and 11–121 of HvTrxh1
and HvTrxh2, respectively.
The seqboot, protpars and consense programs in the
PHYLIP
3.5 package [33] were used to generate an unrooted
consensus tree based on an alignment of 46 plant thio-
redoxin h sequences from the NCBI sequence database. In
addition to HvTrxh1 and HvTrxh2, sequences were from
Arabidopsis thaliana (Ata, Q39241; Atb, NP_175128; Atc,
NP_199112; Atd, S58119; Ate, NP_173403; Atf, Q8L907;
Atg, Q39239; Ath, NP_190672; Ati, NP_188415), Brassica
napus (Bna, Q42388; Bnb, Q39362), Brassica oleracea
(Q9FQ63), Brassica rapa (Bra, O64432; Brb, Q8GZT3),
Curcurbita maxima (Q8H9E2), Fagopyrum esculentum (Fe,
Q96419), H. bulbosum (Hb, T50864), Hordeum vulgare
(Hva, Q8GZR4), Leymus chinensis (Lc, AAO16555),
Lolium perenne (Lp, T50865), Nicotiana tabacum (Nta,
Q8H6 ·3); Ntb, Q07090; Ntc, P29449), Oryza sativa (Osa,
Q42443; Osb,Q9FRT3;Osc, AAO37523; Osd,Q9AS75;
Ose,Q8H6·4), Phalaris coerulescens (Pc, T50862), Picea
mariana (Pm, O65049), Prunus persica (Pp, Q93WZ3),
FEBS 2003 Barley seed thioredoxin h isoforms (Eur. J. Biochem. 270) 2635
Pisum sativum (Psa, Q8GUR8; Psb, Q9AR82; Psc,
Q93 ·24; Psd, Q8GUR9), Populus tremula (Pt, Q8S3L3),
Ricinus communis (Rc, Q43636), Secale cereale (Sc, T50863),
Triticum aestivum (Taa, Q8GVD3; Tab, O64394; Tac,
Q9LDX4; Tad,Q8H6·0) Triticum turgidum ssp. durum
(Td, O64395) and Zea mays (Zm, Q8H6 ·5). SwissProt/
TREMBL accession numbers are given where available,
otherwise EMBL/GenBank accession numbers are used.
Enzyme assays
Insulin assay [34]. A 1-mL reaction mixture contained
100 m
M
potassium phosphate, pH 7.0, 0.2 m
M
EDTA,
1 mg insulin, 1 l
M
HvTrxh1, HvTrxh2, or TrxTa, and
0.33 m
M
dithiothreitol. The reactions were initiated by
addition of dithiothreitol. Reactions proceeded at room
temperature (22 C) and were followed by measuring A
650
on a Lambda 2 spectrophotometer (Perkin–Elmer).
NTR assay [35]. A 200-lL reaction mixture contained
50 m
M
Tris/HCl, pH 8.0, 150 l
M
NADPH, 100 l
M
DTNB, 77 n
M
A. thaliana NTR [36], and 1–16 l
M
HvTrxh1, HvTrxh2, TrxTa, or Thioredoxin h-1 from
P. tremulus [35]. Reactions proceeded at room temperature
and were followed by measuring A
405
on a MRX Revelation
absorbance reader (Dynex Technologies).
Reduction of BASI. A 50-lL reaction mixture contained
50 m
M
Tris/HCl, pH 7.5, 0.6 m
M
NADPH, 3.9 lgArabi-
dopsis NTR and either 10 lg recombinant BASI [37] or
10 lg insulin. The mixtures were incubated for 10 min at
room temperature with 0.4 nmol HvTrxh1 or HvTrxh2.
Free thiol groups were then labelled by the addition of
0.2 lmol monobromobimane in 10 lL acetonitrile. After
incubation for 10 min at room temperature, proteins were
precipitated with 80% (v/v) acetone before being loaded on
a NuPAGE Bis-Tris 4–12% gel (Invitrogen). The labelled
proteins were visualized by being photographed under near
UV light.
Results
Identification of thioredoxin h in the barley seed
proteome
To locate spots containing thioredoxin h in the barley seed
proteome, a 2D gel with proteins extracted from mature
barley seeds was electroblotted and probed with antibodies
raised against wheat thioredoxin h. The antibody recog-
nized three spots with an approximate molecular mass of
12 kDa and pI 5.0 (Fig. 1A).
Protein spots excised from a colloidal Coomassie-stained
gel of mature barley seed proteins were digested with trypsin
and analysed by peptide mass mapping using MALDI-TOF
MS. From the position of the spots recognized by the
antibody, spots 296, 297 and 313 (Fig. 1A) were considered
likely to contain thioredoxin h. The approximate molecular
mass and pI of the proteins in these spots were determined
from their positions on the 2D gel to be 12.2 kDa/pI 5.0,
12.5 kDa/pI 5.0 and 11.3 kDa/pI 5.0, respectively. Peptide
mass data obtained for these spots did not lead to
identifications in searches of the NCBI or SwissProt
nonredundant databases, suggesting that the sequence data
for these proteins were not present. However, by searching
the NCBI EST sequence database, matches were obtained
against barley EST accessions BE230983 (both spots 296
and 297) and BF626734 (spot 313).
BLAST
searches using
these EST sequences indicated that both encoded proteins
with homology to thioredoxin h.
As ESTs can contain sequence errors and may not be full-
length, the matched EST sequences were used to search the
TIGR database of TC sequences from barley. TC sequences
were identified that contained the EST sequences and
apparently encoded full-length proteins. This was supported
by the fact that in-frame stop codons were present upstream
of the ATG start codon in each case. The thioredoxin
isoforms predicted to be encoded by these sequences were
designated HvTrxh1 (TC44851; corresponding to spots 296
and 297) and HvTrxh2 (TC45680; spot 313).
Theoretical tryptic digests of these sequences were used to
determine the sequence coverage obtained from peptide
mass mapping of the three spots. Peptide mass data from
spot 313 resulted in 39% sequence coverage with seven
matched peptides (Fig. 2A). Another TC sequence
(TC45681) also matched the peptide masses from spot
313; this encoded a single amino-acid substitution at the
C-terminus of the protein (A119 to G). As the peptide
covering this region was not observed in the mass spectrum,
it was not possible to distinguish between these almost
identical variants. The peptide maps obtained for spots 296
and 297 were highly similar. The peptides matching the
barley thioredoxin h TC sequence were the same in both
cases, resulting in 64% sequence coverage with 12 matched
peptides (Fig. 2A). It was therefore not possible from the
peptide mass data to explain the molecular mass difference
between the two spots on the 2D gel.
Although the same EST sequence was matched for
both spots, it is possible that spots 296 and 297 contain
thioredoxin h isoforms with sequence differences in
regions not covered by the peptide maps. However, no
other barley TC sequences were found in the TIGR
database that matched the peptide mass data for these
spots. A few peptides originating from another protein
(barley dimeric a-amylase inhibitor; P13691) were present
in the spectrum obtained for spot 297 and in smaller
amounts in the spectrum for spot 296. A spot containing
this protein (O. Østergaard, C. Finnie, S. Melchior,
P. Roepstorff & B. Svensson, unpublished results) forms a
horizontal smear overlapping with spot 297 (Fig. 1A, spot
318; the smear is particularly noticeable in the silver-
stained gel), and this electrophoretic smear is probably
the source of the peptides of barley dimeric a-amylase
inhibitor. However, most of the protein in spots 297 and
296 was found to be thioredoxin h.
Previously, evidence has been presented for variation in
the distribution of thioredoxin h forms in seed tissues
[9,16]. To obtain more detailed information about the
origins of HvTrxh1 and HvTrxh2, the occurrence of the
thioredoxin h spots in protein extracts from dissected
barley seeds was analysed by 2D gel electrophoresis
(Fig. 1B). The three thioredoxin h spots are distributed
differently in the tissues of mature seeds (Fig. 1B). Spot
297 is present in extracts made from dissected endosperm,
aleurone layer and embryo. Spot 296 is present in
2636 K. Maeda et al.(Eur. J. Biochem. 270)FEBS 2003
endosperm and embryo, but is much less abundant in
aleurone layer extracts. Spot 313 (containing HvTrxh2) is
more abundant in extracts from the embryo than from
the other tissues. In mature seeds, all three forms of
thioredoxin h were observed on silver-stained 2D gels
(Fig. 1A). Extracts from whole seeds made during
micromalting showed that spots 297 and 313 were
decreased in abundance after 3 and 6 days of germination,
whereas spot 296, containing HvTrxh1, remained at a
high level even after 6 days (Fig. 1C). Analysis of
dissected seed extracts made after 6 days of micromalting
showed that spot 296 remained abundant in the embryo
(Fig. 1C) but was not detectable either in the aleurone
layer or endosperm (not shown). The total amount of
thioredoxin h has been shown to increase in the embryo
and decrease in the endosperm during germination [9], in
agreement with these observations.
Cloning and sequence analysis of barley thioredoxin h
isoforms
Based on the identified EST sequences, specific primers were
designed for cloning of the two thioredoxin h isoforms.
Both transcripts were isolated by RT-PCR using RNA
isolated from barley embryos after one day of germination.
Nucleotide sequencing demonstrated that the isolated
clones were identical with the TC sequences for HvTrxh1
and HvTrxh2 identified on the basis of peptide mass data.
The predicted amino-acid sequences of the proteins were
51% identical. The two thioredoxins were more similar to
thioredoxin h sequences from other plants than to each
other (Fig. 2A), as is also the case for Arabidopsis thio-
redoxins h [15]. HvTrxh1 was 74% identical with a thio-
redoxin h identified in rice as an abundant phloem sap
protein (Q42443) [5]. HvTrxh2 was 53% identical with this
ES
AL EM
B
Seed 6dSeed 3d EM 6d
C
AWestern
297
296
313
Coomassie Silver
318
Fig. 1. Barley thioredoxin h forms visualized on 2D gels. Sections of 2D gels from 11 to 16 kDa and pI 4.85–5.25 are shown. The positions of Trx h
spots are indicated by circles. (A) Identification of Trx h in seed extracts by Western blotting. Corresponding spots 296, 297 and 313 on a colloidal
Coomassie-stained gel were confirmed by MS to contain Trx h, and were also observed by silver staining. Spot 318 contains barley dimeric
a-amylase inhibitor BDAI-1. (B) Tissue distribution of Trx h forms analysed using extracts from dissected barley seeds. AL, Aleurone layer; ES,
starchy endosperm; EM, embryo. Proteins are visualized by silver staining. (C) Fate of Trx h forms during micromalting analysed using extracts
from whole seeds after 3 and 6 days micromalting, and from embryo (EM) after 6 days micromalting. Proteins are visualized by silver staining.
FEBS 2003 Barley seed thioredoxin h isoforms (Eur. J. Biochem. 270) 2637