Purification, characterization and biosynthesis of parabutoxin 3,
a component of
Parabuthus transvaalicus
venom
Isabelle Huys
1
, Karin Dyason
2
, Etienne Waelkens
3
, Fons Verdonck
4
, Johann van Zyl
5
, Johan du Plessis
2
,
Gert J. Mu¨ ller
5
, Jurg van der Walt
2
, Elke Clynen
6
, Liliane Schoofs
6
and Jan Tytgat
1
1
Laboratory of Toxicology, University of Leuven, Leuven, Belgium;
2
Department of Physiology, University of Potchefstroom,
Potchefstroom, South Africa;
3
Laboratory of Biochemistry, University of Leuven, Leuven, Belgium;
4
Interdisciplinary Research
Centre, University of Leuven Campus Kortrijk, Kortrijk, Belgium;
5
Department of Pharmacology, University of Stellenbosch,
Tygerberg, South Africa;
6
Laboratory for Developmental Physiology and Molecular Biology, University of Leuven, Belgium
A novel peptidyl inhibitor of voltage-gated K
+
channels,
named parabutoxin 3 (PBTx3), has been purified to homo-
geneity from the venom of Parabuthus transvaalicus. This
scorpion toxin contains 37 residues, has a mass of 4274 Da
and displays 41% identity with charybdotoxin (ChTx, also
called Ôa-KTx1.1Õ). PBTx3 is the tenth member (called
Ôa-KTx1.10Õ)ofsubfamily1ofK
+
channel-blocking pep-
tides known thus far. Electrophysiological experiments using
Xenopus laevis oocytes indicate that PBTx3 is an inhibitor of
Kv1 channels (Kv1.1, Kv1.2, Kv1.3), but has no detectable
effects on Kir-type and ERG-type channels. The dissoci-
ation constants (K
d
) for Kv1.1, Kv1.2 and Kv1.3 channels
are, respectively, 79 l
M
,547n
M
and 492 n
M
. A synthetic
gene encoding a PBTx3 homologue was designed and
expressed as a fusion protein with the maltose-binding pro-
tein (MBP) in Escherichia coli. The recombinant protein was
purified from the bacterial periplasm compartment using an
amylose affinity resin column, followed by a gel filtration
purification step and cleavage by factor X
a
(fX
a
) to release
the recombinant toxin peptide (rPBTx3). After final purifi-
cation and refolding, rPBTx3 was shown to be identical to
the native PBTx3 with respect to HPLC retention time, mass
spectrometric analysis and functional properties. The three-
dimensional structure of PBTx3 is proposed by homology
modelling to contain a double-stranded antiparallel bsheet
and a single a-helix, connected by three disulfide bridges.
The scaffold of PBTx3 is homologous to most other a-KTx
scorpion toxins.
Keywords:Parabuthus; purification; synthesis; scorpion;
toxin.
The southern African scorpion Parabuthus transvaalicus
Purcell, 1899, is one of the largest scorpions belonging to the
Buthidae family [1], subphylum Chelicerata, order Scor-
pionis. Severe envenomation with P. transvaalicus causes
primarily neuromuscular effects with involvement of the
heart and parasympathetic nervous system [2], illustrating
that this scorpion can be potentially lethal, especially for
children. P. granulatus scorpionism has been described by
Mu
¨ller [3]. P. transvaalicus scorpionism is clinically similar,
but appears to produce slightly more motor and fewer
sensory symptoms [4]. Crude, diluted venom of P. trans-
vaalicus was already tested on isolated cardiomyocytes and
induced an increase in the sodium current and a retardation
of the time course of inactivation, implicating the presence
of an a-toxin [5]. Verdonck et al. [6] reported the occurrence
of pore-forming activity in the venom of P. transvaalicus,
but the variability was rather high and in some specimens
this activity was absent.
A study was undertaken to find compounds or toxins in
the venom of P. transvaalicus that modulate physiological
processes at the cellular level; this was done for the following
reasons: (a) very little is known about the bioactive
substances present in the venom of this scorpion [7,8]; (b)
the discovery of new toxins can be the key to gain insight
into the molecular mechanisms of scorpionism; (c) selective
toxins can be used for purifying channels from native tissue,
determining their subunit composition [9] and for elucida-
ting the pharmacology and physiological roles of voltage-
dependent Na
+
,Ca
2+
and K
+
channels [10–12] in target
tissues. Voltage-dependent K
+
channels in particular serve
important functions in many signal-transduction pathways
in the nervous system: they are involved in neuron
excitability; they influence the resting membrane potential,
the waveforms and frequencies of action potentials; and
they determine the thresholds of excitation [13]. Moreover,
they are the putative target sites in the design of therapeutic
drugs [14].
In our work, a new short-chain toxin acting on Kv1
channels, called parabutoxin 3 (PBTx3), has been purified
to homogeneity from the venom of P. transvaalicus and its
specific function on different channels has been analysed
electrophysiologically. Using a recombinant expression
system, the toxin was produced in high quantity to confirm
our data and to facilitate the screening of the active peptide
Correspondence to J. Tytgat, Laboratory of Toxicology, University
of Leuven, E. Van Evenstraat 4, 3000 Leuven, Belgium.
Fax: + 32 16 32 34 05, Tel.: + 32 16 32 34 03,
E-mail: Jan.Tytgat@farm.kuleuven.ac.be
Abbreviations: PBTx3, toxin from the venom of the scorpion
Parabuthus transvaalicus;AgTx2,toxinfromthevenom
of the scorpion Leiurus quinquestriatus var. Hebraeus; MBP,
maltose-binding protein; fXa, factor Xa.
Note: a website is available at http://www.toxicology.be
(Received 31 December 2001, accepted 12 February 2002)
Eur. J. Biochem. 269, 1854–1865 (2002) ÓFEBS 2002 doi:10.1046/j.1432-1033.2002.02833.x
PBTx3. In this way, a study of the structure–function
relationship of PBTx3 to different ion channels and
receptors could be performed and a structural model for
this novel toxin has been proposed.
MATERIALS AND METHODS
Venom collection and purification
P. transvaalicus scorpions were captured in South Africa.
Venoms were collected by electrical stimulation and lyophi-
lized after dilution in a saline buffer or distilled water. The
lyophilized venom was dissolved in 100 m
M
ammonium
acetate, pH 7 (Merck, Germany). After vortexing, the
sample was clarified by centrifugation at 12 000 gfor
15 min and its supernatant was submitted to gel filtration
(Fig. 1A) using a Superdex 30 prep grade HiLoad 16/60
FPLC column (Pharmacia LKB Biotech, Sweden) equili-
brated with 100 m
M
ammonium acetate, pH 7. The mate-
rial was eluted with the same buffer at a flow rate of
0.2 mLÆmin
)1
. Absorbance of the eluate was monitored at
280 nm and 4-mL fractions were collected automatically.
The fraction containing the toxin was recovered, lyophilized
andappliedonaPepRPCHR5/5C
2
/C
18
reversed-phase
FPLC column (Pharmacia, Sweden) equilibrated with 0.1%
trifluoroacetic acid (TFA, Merck Eurolab, Belgium) in
distilled water (Fig. 1B). Separation was performed by using
a linear gradient of 0–50% UV-grade acetonitrile (LiChro-
SolvÒgradient grade, Merck Eurolab), supplemented with
0.1% TFA, for 30 min. The flow rate was 0.5 mLÆmin
)1
and the absorbance was measured at 214 nm. Fractions
between 17 and 23 min with potential short-chain toxins
were recovered, dried (Speed VacÒPlus, Savant, USA), and
applied to a monomeric 238TP54 C
18
reversed-phase HPLC
column (Vydac, USA) equilibrated with 0.1% trifluoroacetic
acid in distilled water (Fig. 1C). Separation was performed
as follows: after 4 min a linear gradient to 30% acetonitrile,
for 2 min, followed by a linear gradient to 42% for the final
8 min (total run, 14 min). The flow rate was 0.75 mLÆmin
)1
and the absorbance was measured simultaneously at 214,
254 and 280 nm. The toxin-containing fraction (see Fig. 1C)
was recovered and dried (Speed VacÒPlus).
Sequence determination
The first 36 residues of the primary structure of the peptide
were resolved by direct sequencing (Edman degradation)
(Fig. 2A). A glass fibre disk was coated with Biobrene
(Applied Biosystems) and precycled for four cycles. Subse-
quently, the sample (18 pmol) was loaded onto the glass
fibre disk and subjected to N-terminal amino-acid sequenc-
ing on a Perkin Elmer/Applied Biosystems Procise 492
microsequencer (PE Biosystems) running in pulsed liquid
mode. To identify the last C-terminal residue, a sample of
peptide was also cleaved by cyanogen bromide. By this
reaction, three fragments were produced (E
1
–M
4
,R
5
–M
28
and N
29
–R
37
), separated by HPLC by using the same C
18
analytical column as described above, and then sequenced.
The last amino acid (arginine) was elucidated.
Construction of the recombinant genes
A cDNA fragment encoding a 36 amino-acid peptide,
corresponding to PBTx3 without the C-terminal arginine,
was designed as follows (Fig. 3A). Two overlapping
oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA
AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG
CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG
CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG
CCCGGCC-5¢,and5¢-GCGACGGGCCGGCCGAACG
GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC
CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC
CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect-
ively, ranging in length from 49 to 66 base pairs, were
synthesized chemically on an Applied Biosystem device
(Amersham Pharmacia Biotech, The Netherlands), purified
by PAGE and phosphorylated at the 5¢end. The comple-
mentary oligomers (100 pmol of each) were annealed to
generate two duplexes that were ligated using T4 DNA ligase
(NEB). The synthetic PBTx3 gene was inserted into the
vector pMAL-p2X (NEB) downstream from the malE gene
of Escherichia coli and also directly downstream of a fX
a
site
Fig. 1. Purification of native PBTx3 from the venom of P. transvaali-
cus. (A) Crude venom was first fractionated by FPLC gel filtration,
yielding four peaks. The labelled fraction (*) was recovered and lyo-
philized. Based on a constructed gel filtration calibration curve, the
molecular mass of the material in this fraction ranged from 3 to 6 kDa.
(B) The second purification step was carried out using a FPLC C
2
/C
18
reversed-phase column. Fractions eluting at 17–23 min (*) contain
ÔpotentialÕshort-chain toxins and were recovered and dried. (C) The
third step involved a HPLC C
18
reversed-phase purification.
ÓFEBS 2002 Novel K
+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1855
into a XmnI site. The gene possessed an overhang at the
3¢end (BamHI) to direct the orientation of the insert into
pMAL-p2X. The transformants containing the correctly
constructed DNA fragments for PBTx3 were analysed by
digestion with two different restriction enzymes NaeIand
XmnI (NEB). Because insertion of the synthetic gene disrupts
the XmnI recognition site, this enzyme cannot cleave the
recombinant plasmid. To cleave the gene in the second part
of its sequence, NaeI was used as a double control of the
original duplexes. In both cases, E. coli JM109 (Promega,
The Netherlands) was used for plasmid propagation. A
translation termination codon was inserted at the end of the
PBTx3 coding sequence. The vector possesses malEtrans-
lation initiation signals to direct the toxin-fusion proteins to
the periplasm, thus allowing folding and disulfide bond
formation to take place in E. coli [15,16]. The method for the
expression of our toxins used the strong P
tac
promoter, which
gave a high-level expression of the cloned sequences encoding
the fusion. For comparison with PBTx3, the high affinity K
+
channel blocker AgTx2 [17], which is structurally related to
PBTx3, was produced by a similar strategy.
Expression, purification and cleavage
of fusion proteins
Rich Luria–Bertani medium containing bactotryptone
(Sigma, Belgium), yeast (Remel, BioTrading, Belgium),
NaCl (Merck Eurolab, Belgium), glucose (Merck Eurolab)
and ampicillin (1 lgÆmL
)1
) was inoculated with an over-
night culture of E. coli DH5acells, carrying the gene fusions
encoding either rAgTx2 or rPBTx3, in a culture shaker
incubator (Innova 4000, New Brunswick Scientific). In both
situations, the cells were grown at 37 °C and when the cell
density had reached A
600
¼0.5, expression of the fusion
proteins was induced by adding isopropyl thio-b-
D
-galacto-
side (Sigma) to a final concentration of 0.2 m
M
. Cells were
harvested by centrifugation at 2660 gat 4 °Cfor20min
and subjected to osmotic shock according to the following
procedures. The cells were resuspended in 400 mL 30 m
M
Tris/HCl (Sigma) with 20% sucrose (Sigma) pH 8.0 at
25 °C. The suspension was treated with Na
2
EDTA (Sigma)
to give a concentration of 1 m
M
and incubated at room
temperature with shaking. After 10 min, the mixture was
centrifuged for 20 min at 2660 gat 4 °C. The supernatant
was removed and the well drained pellet was resuspended in
400 mL ice-cold 5 m
M
MgSO
4
(Sigma) in an ice bath for
10 min and centrifuged at 2660 gat 4 °C. The supernatant
is the cold osmotic shock fluid which contains the periplas-
mic extracts. The periplasmic extracts (400 mL) were loaded
Fig. 2. Sequence determination of native PBTx3. (A) The first 36
amino acid residues of PBTx3 were identified by direct sequencing
a
.
Sequencing the last fragment, produced after cyanogen bromide
cleavage, identified the C-terminal residue arginine
b
. (B) Alignment of
the amino acid sequences of the members of subfamily 1 of short-chain
a-KTx toxins isolated from scorpion venom. Dashes represent gaps
that were introduced to improve the alignment. Identical amino acids
are indicated with a black background. Homologous residues are
indicated with a grey background. The percentage identity with ChTx
is shown. ChTx (charybdotoxin [24]), charybdotoxin-Lq-2 [10], Lqh
15–1 [25] and AgTx2 (agitoxin 2 [15]), were purified from Leiurus
quinquestriatus var. Hebraeus; BmTx1–2 [26] was purified from Buthus
martensi Karsch; HgTx2 (hongotoxin 2 [27]), and LbTx (limbatotoxin
[34]), were purified from Centruroides limbatus; IbTx (iberiotoxin [28]),
and TmTx (tamulotoxin [56]), were purified from Buthus tamulus;
PBTx3 (parabutoxin 3, this study) was purified from Parabuthus
transvaalicus.
Fig. 3. Schematic diagram of the pMAL-p2X vector containing the
synthetic gene for the PBTx3 homologue. (A) Two ligations were
performed using a 6706-bp pMAL-p XmnI/BamHI fragment and a
111-bp fragment encoding the PBTx3 homologue, immediately
downstream of the fX
a
cleavage site in the vector. Amp
R
, ampicillin
resistance gene; ori, origin. (B–D) Chromatographic profiles after
purification of the fusion protein (B) and recombinant toxin (C,D)
rPBTx3. Fractions containing the MBP-fusion proteins were collected
and prepared for cleavage with fX
a
. The restriction digests were
applied on the same HPLC C
18
column as in Fig. 1 and material
eluting between 8 and 15 min was purified further on a HPLC C
2
/C
18
column and tested on Kv1 channels expressed in Xenopus oocytes.
1856 I. Huys et al. (Eur. J. Biochem. 269)ÓFEBS 2002
to an amylose affinity resin (1.5 ·23 cm column, Biolabs,
NEB) at a flow rate of 1 mLÆmin
)1
in column buffer
containing 20 m
M
Tris/HCl, 200 m
M
NaCl (Merck Eur-
olabs, Belgium), and 1 m
M
Na
2
EDTA buffer, pH 7.4. After
washing of the unbound proteins, the bound maltose-
binding protein (MBP)-fusion products were eluted from
the amylose resin using the same column buffer containing
10 m
M
maltose (Merck Eurolabs). Twenty 3-mL fractions
were collected and the fusion protein was easily detected by
the UV absorbance spectrophotometer (UV/VIS Spectro-
photometer lambda 16, PerkinElmer) at 280 nm. The
protein-containing fractions were pooled and purified
further using a Superdex Peptide gel filtration column on
the SMART System (Pharmacia Biotech). The elution was
performed with a buffer containing 20 m
M
Tris/HCl and
100 m
M
NaCl, pH 8.0 (Fig. 3B). Controls were performed
with cells containing no vector or cells containing the vector
without insert.
The synthetic gene encoding the PBTx3 homologue was
designed such that an fX
a
cleavage site (Ile-Glu-Gly-Arg-)
immediately preceded the N-terminal Glu of the toxin
(Fig. 3A). The enzymatic cleavage of the pooled fusion
proteins was carried out at various conditions by fX
a
(different sources: Boehringer, Sigma, NEB). Optimal
cleavage could be performed in the following conditions:
72 h incubation at room temperature and a concentration
of 0.5 UÆlg
)1
fusion protein in a buffer containing 20 m
M
Tris/HCl, 100 m
M
NaCl and 2 m
M
CaCl
2
,pH8.0.After
cleavage with this enzyme, the recombinant toxin was
generated without vector-related fragments. In a parallel
experiment with AgTx2, chromatographic profiles of
rAgTx2 and commercially available rAgTx2 (Alomone
Laboratories) under the same conditions were compared
and were identical.
HPLC
Separations of the recombinant proteins were first per-
formed with a 218TP104 C
18
reversed-phase HPLC column
(Vydac) and equilibrated with 0.1% trifluoroacetic acid
(Sigma)at25°C (Fig. 3C). After 4 min an immediate step
to 5% acetonitrile (with 0.1% trifluoroacetic acid) was
followed by a linear gradient to 30% acetonitrile for 5 min
and then by a linear gradient to 60% for the last 12 min.
The flow rate was 0.75 mLÆmin
)1
and the absorbance was
measured simultaneously at 214, 254 and 280 nm. The
fraction containing the recombinant toxin (arrow) was
recoveredandappliedtoalRPC C
2
/C
18
SC 2.1/10
reversed-phase HPLC column (Vydac). A linear gradient,
starting after 6 min and ranging from 0% to 30% up to
100 min with a flow rate of 200 lLÆmin
)1
(Fig. 3D), was
applied and the toxin was collected, dried (Speed VacÒ
Plus) and prepared for functional analysis.
Mass spectroscopy
For examination of mass, 1 pmol of the venom was dried
and redissolved in acetonitrile (+ 0.1% trifluoroacetic
acid). The molecular mass of the compounds in the venom
and the masses of rAgTx2 (used as a control toxin) and
rPBTx3 were determined with MALDI-TOF MS on a VG
Tofspec (Micromass, UK) operating in the linear and in the
reflectron mode.
Electrophysiological recording
Oocyte expression – Kv1.1. For in vitro transcription,
plasmids were first linearized with PstI (New England
Biolabs) 3¢to the 3¢nontranslated b-globin sequence in our
custom-made high expression vector for oocytes, pGEMHE
[18–20] and then transcribed using T7 RNA polymerase and
a cap analogue diguanosine triphosphate (Promega). Kv1.2.
The cDNA encoding Kv1.2 (originally termed RCK5) in its
original vector, pAKS2, was first subcloned into pGEM-
HE [19]. The insert was released by a double restriction
digest with BglII and EcoRI. Next, the cDNA was loaded
onto an agarose gel, fragments of interest were cut out, gene
cleaned (QIAGEN) and ligated into the BamHI and EcoRI
sites of pGEM-HE. For in vitro transcription, the cDNA
was linearized with SphI and transcribed using the large-
scale T7 mMESSAGE mMACHINE transcription kit
(Ambion). Kv1.3. Plasmid pCI.neo containing the gene for
Kv1.3 was linearized with NotI (New England Biolabs) and
transcribed as for Kv1.2 [21]. Stage V–VI Xenopus laevis
oocytes were isolated by partial ovariectomy under anaes-
thesia (tricaine, 1 gÆL
)1
). Anaesthetized animals were kept
on ice during dissection. The oocytes were defolliculated by
treatment with 2 mgÆmL
)1
collagenase (Sigma) in zero
calcium ND-96 solution (see below). Between 2 and 24 h
after defolliculation, oocytes were injected with 50 nL of 1–
100 ngÆlL
)1
cRNA. The oocytes were then incubated in
ND-96 solution at 18 °C for 1–4 days. The animals were
handled in conformity with the ‘Guide for the Care and Use
of Laboratory Animals’, published by the US National
Institutes of Health (NIH Publication No. 85-23, revised
1996).
Electrophysiology. Whole-cell currents from oocytes were
recorded using the two-microelectrode voltage clamp
technique. Voltage and current electrodes (0.4–2 mega-
ohms) were filled with 3
M
KCl. Current records were
sampled at 0.5-ms intervals after low pass filtering at
0.1 kHz. Off-line analysis was performed on a Pentium(r)
III processor computer. Linear components of capacity and
leak currents were not subtracted. All experiments were
performed at room temperature (19–23 °C). Fitted K
d
values were obtained after calculating the fraction current
left over after application of several toxin concentrations in
different oocyte experiments (mean ± SD, n).
Solutions. The ND-96 solution (pH 7.5) contained 96 m
M
NaCl, 2 m
M
KCl, 1.8 m
M
CaCl
2
,1m
M
MgCl
2
,5m
M
Hepes, supplemented with 50 mgÆL
)1
gentamycin sulphate
(only for incubation).
Modeling
A model was generated by an automated homology
modelling server (Expert Protein Analysis System proteo-
mics server using SWISS-MODEL-ProModII) running at
the Swiss Institute of Bioinformatics (Geneva). Target
(PBTx3) and template (hongotoxin 2) sequences were
automatically aligned by Multiple Sequence Alignment
Software (
CLUSTALW
), which subsequently generated
the coordinates of both models. Energy minimization
(
GROMOS
96) and simulated annealing cycles were run.
SWISS
-
MODEL
computes a confidence factor for each atom
ÓFEBS 2002 Novel K
+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1857
in the model structure, taking into account the deviation of
the model from the template structure and the distance trap
value used for framework building.
RESULTS
Kv1 K
+
channels were expressed in X. laevis oocytes and
studied using a two-microelectrode voltage clamp. Crude
venom of P. transvaalicus (340 lg) produces a reversible
inhibition of the Kv1.1 K
+
current elicited by depolariza-
tion up to 0 mV (data not shown). In our quest to find novel
short-chain scorpion toxins in the venom of P. transvaali-
cus, acting on voltage-dependent K
+
channels, we fraction-
ated the crude venom of this scorpion as detailed in
Materials and methods (Fig. 1). As described by Debont
et al. [22], gel filtration shows three typical groups of
components (Fig. 1A), the largest of which (group I) was
shown to block Kv1.1 channels. Based on a constructed
calibration curve (see Debont et al. 1998), the active fraction
corresponded to a molecular mass between 3 and 6 kDa,
which probably represents the family of short-chain scor-
pion toxins. After HPLC purification of this active fraction
(Fig. 1C), that representing native PBTx3 (85 l
M
)caused
an inhibition of Kv1.1 channels of 50%, whereas 550 n
M
native PBTx3 produces 54% and 51% block of the Kv1.2
and Kv1.3 channels, respectively (Fig. 4A–C). We have
undertaken the recombinant synthesis of this toxin in order
to facilitate the characterization of its biological properties.
The yields of affinity-purified proteins were 40–60 mgÆL
)1
culture, estimated by absorbance at 280 nm, which after
cleavage resulted in the production of 2–4 mg of recombin-
ant toxin per litre culture. The recombinant synthesis
resulted in the production of a recombinant toxin with an
expected molecular mass of 4118 Da, with respect to the
three disulfide bridges present in the secondary structure of
the PBTx3 homologue. The mass of rAgTx2 (ÔcontrolÕtoxin
for comparison) was also consistent with the theoretical
mass. Functional effects of recombinant toxins on Kv.1
channels were investigated by electrophysiological experi-
ments. No block was obtained when MBP-rPBTx3 was
applied to expressed K
+
channels in Xenopus oocytes
(n¼3) (data not shown). Recombinant PBTx3 inhibits
both Kv1.2 and Kv1.3 channels with weak affinities and
similar potencies, whereas it is a very weak inhibitor of
Kv1.1 channels: application of 550 n
M
rPBTx3 produced
no blocking effect on Kv1.1 channels (Fig. 4D), whereas the
Kv1.2 and Kv1.3 currents were reversibly blocked to 52%
and 49%, respectively (Fig. 4E,F). As part of a control,
rAgTx2 was applied to the same oocytes expressing Kv1.1
channels. Addition of 1 n
M
rAgTx2 blocked the K
+
current
almost completely (Fig. 4G) and this effect was reversible
upon washout. After equilibration of the channels and
application of the same concentration of commercially
available rAgTx2, quantitatively the same effect was
observed as with our laboratory prepared rAgTx2. This
observation, together with the fact that co-injection of
equimolar amounts of both AgTx2 on reverse-phase HPLC
resulted in a single peak (data not shown), demonstrates
that our rAgTx2 behaved similarly to the commercially
available recombinant toxin.
Blockage of the Kv1 channels induced by rAgTx2 or
rPBTx3 (tested at different concentrations) was shown not
to be voltage-dependent, as the degree of block was not
different in the range of test potentials from )30 to
+20 mV. Recombinant PBTx3 (500 n
M
) blocked the
Kv1.2 and Kv1.3 peak currents by 54% and 53% at
)30 mV (n¼3), and by 53% and 54% (n¼3) at
20 mV. In the presence of 70 l
M
rPBTx3, the Kv1.1 peak
current was blocked by 45% (n¼3) at )30 mV and by
42% at 20 mV (n¼3).
Blocking of the Kv1 channels by rPBTx3 is reversible and
has no influence on the gating characteristics of the
channels. Therefore, the time constants for relaxation to
equilibrium block of the different Kv1 channels in the
presence of the toxin reflect only the progress of the binding
reaction. To determine the time constants s
on
and s
off
for
blockade and recovery, current traces were repeated every
2 s before, during and after rPBTx3 application. The time-
courses of blockade and recovery were fitted to mono-
exponential curves, in agreement with the results obtained
for other scorpion toxins [23]. In the presence of 10 l
M
rPBTx3 on Kv1.1 and 3.3 l
M
rPBTx3onKv1.2andKv1.3
channels, blockade occurred with a mean time constant s
on
of 8.3 ms, 2.1 ms and 1.7 ms, respectively, for Kv1.1, Kv1.2
and Kv1.3 channels. The recovery from blockade
Fig. 4. Effects of native (A–C) and recombinant (D–F) PBTx3 on
Kv1.1, Kv1.2 and Kv1.3 channels. Whole-cell K
+
currents through
Kv1.1, Kv1.2 and Kv1.3 channels, respectively, expressed in Xenopus
oocytes, are evoked by depolarizing the oocyte from a holding
potential of )90 mV to 0 mV. The oocytes were clamped back to
)90 mV (A), or to )50 mV (B–G). Application of 85 l
M
native PBTx3
(active fraction in Fig. 1C indicated by *) on Kv1.1 channels or 550 n
M
on Kv1.2 and Kv1.3 channels, produced 50%, 54% and 51% inhibi-
tion, respectively, of the Kv1.1, Kv1.2 and Kv1.3 currents. (D–F)
Current through Kv1.1, Kv1.2 and Kv1.3 channels, respectively, in
control conditions (s) and in the presence (d)of550n
M
rPBTx3.(G)
Inhibition of Kv1.1 current, produced by 1 n
M
of rAgTx2.
1858 I. Huys et al. (Eur. J. Biochem. 269)ÓFEBS 2002