Summary of PhD Thesis in Biology: Study on screening yeast strains for application to brandy production from pineapple Queen

MINISTRY OF EDUCATION AND TRAINING -   -

HOANG THI LE THUONG

STUDY ON SCREENING YEAST STRANS FOR APPLICATION TO BRANDY PRODUCTION FROM PINEAPPLE QUEEN

SUMMARY OF PhD THESIS IN BIOLOGY

Hanoi - 2020

The thesis was completed at Hanoi National University of Education

Supervisors: Nguyen Quang Hao, PhD.

Tran Thi Thuy, PhD.

Reviewer 1:...............................................

Reviewer 2:...............................................

Reviewer 3:...............................................

The thesis is defended at the doctoral thesis evaluation committee at

At ... :00 on ...., 2020

This PhD thesis can be found at:

Library of Hanoi National University of Education

INTRODUCTION Brandy is a very popular alcoholic beverage which is distilled from high quality

wine. Brandy has a stimulating effect on nerves, heart and digestive, so it should be used

in small amounts every day for good health. It suits the needs of many people especially

young people; therefore brandy consumption is increasing. However, most of the brandy used domestically now are imported: Imported volume of brandy is the 3rd ranking among spirits imported into Vietnam. The average annual growth of brandy market is

18.8% but the price is still high; so brandy has not yet been widely used in Vietnam.

Finding domestic sources of raw materials and appropriate technologies to produce

brandy proactively in Vietnam to meet consumer needs is necessary.

Pineapple is a popular fruit tree in Vietnam, it is distributed from the North to the

South. Total pineapple output is always ranked first in the fruit trees reaching 529,100

tons in 2007; 532,700 tons in 2011 and 579,982.3 tons in 2016. Pineapple fruit is rich in

nutritional composition. The acidity and high content of water, sugar, protein, vitamins

and minerals in the juice makes it suitable for production of quality wine to distill into

brandy with a specific flavor. So far, according to our documentation, researches on

pineapple in Vietnam are mainly on the process of preserving fresh fruits, drying, making

syrup and fermenting wine. Many companies, businesses and food research agencies have

conducted their researches and businesses to the process of producing brandy from lychee,

apple, plum, cashew fruit, etc... but there was only one project on pineapple brandy named

“Technology completing of producing fruit brandy (litchi, pineapple) on an industrial

scale" done by Eresson Beer Single Member Limited Company. In this project, yeasts

were collected from many domestic and foreign sources, and distillation process was done

in high-tech tower. Pineapple brandy produced from this project is on market exploration

in small quantities with high prices and has not yet popular. Therefore, researches in

processing pineapple traditionally into brandy shall provide scientific platform to organize

the production of brandy from pineapple in Vietnam; creates more opportunities to the

consumption of pineapple products; creates more jobs to farmers; contributes to economic

development of many pineapple planting localities.

Base on the requirements of production practices, in order to help farmers solving

pineapple consumption by processing methods, we conducted the project titled "Study on

screening yeast strains for application to brandy production from pineapple Queen”.

Target

Selecting a yeast strain having high activity of ethanol fermentation producing a

specific aroma of fermented pineapple Queen juice, suitable for the production of

comprehensive quality brandy from pineapple.

Objectives, scopes and delimitations

Objectives: Yeast strains isolated from the juice of pineapple Queen grown at Dong

Giao Farm - Tam Diep - Ninh Binh provice.

Research scopes and delimitations

- Microorganisms: Yeast trains for alcoholic fermentation were isolated from

pineapple juice.

- Source of pineapple: Dong Giao Farm - Tam Diep - Ninh Binh provice.

Research contents

(1) Screening a yeast strain having high capacity of ethanol fermentation and

producing specific aroma of fermented pineapple Queen juice in fermentation process

(2) Study on the biological characteristics of selected a yeast strain: Colony

morphology, cell morphology, ability to ferment sugars and utilize nitrate; identify the

taxonomy of the selected yeast strain; characterize the influence of different factors (such as

sugar content, nitrate, pH, and nitrogen source) on the growth and development of selected

yeast strain.

(3) Study on various factors affecting the ethanol fermentation of selected yeast strain

in pineapple juice: initial pH, temperature, content of organic acid and sugar, level of

dissolved oxygen, level of yeast inoculum; time course of wine fermentation in the juice of

pineapple Queen.

(4) Modify the yeast strain D8 by a random mutation technique.

(5) Study on the techniques of distillation, cleaning and aging pineapple brandy

New contributions

- This thesis contributes a systematic study on pineapple brandy production from

isolation and screening yeast strains, characterization of selected yeast strain, suitable

condition for seed cultivation and fermentation, suitable condition for distillation and

removal of impurities; suitable condition for brandy aging to some analysis of aroma

composition of pineapple brandy.

- Mutating selected yeast strain to produce high alcohol content of 15.1% (v / v) by

random mutation.

- Proposing the use of green bean sprouts extract instead of peptone in cultivation of

selected yeast strain for seed culture of pineapple wine before distillation to pineapple

brandy.

- Proposing a process to remove impurities in alkaline or acidic conditions and

combining chemical and physical methods.

Structure of the thesis

The thesis consists of 136 pages, including the following sections:

Introduction: 4 pages

Chapter 1. Overviews of research issues: 44 pages

Chapter 2. Materials and research methods: 23 pages

Chapter 3. Results and discussion: 63 pages

Conclusions and Recommendations: 2 pages

References: The thesis cited 45 Vietnamese references, 135 foreign language

references and 02 web pages.

CHAPTER 1: OVERVIEWS OF RESEARCH ISSUES

In this chapter, 03 issues related to the studies of this thesis were overviewed. These

are: (1.1) YEAST; (1.2) PINEAPPLE - RAW MATERIAL FOR BRANDY

PRODUCTION and (1.3) BRANDY PRODUCTION TECHNOLOGY.

In section “1.1. YEAST”, the history of research and use of yeast in the

production of alcohol (Section 1.1.1) around the world and in Vietnam were presented in

detail. Criteria of classification and selection of yeast strains (Section 1.1.3) were also

overviewed. Yeast species used in wine production belong to Saccharomyces genus

(including 286 species belonging to 17 genera). Biological characteristics of yeast

(Morphological and physiological characteristics: Section 1.1.2) and Effect of some

factors on the growth, development and fermentation of yeasts (temperature, pH,

dissolved oxygen concentration, sugar content, alcohol content, disinfectants, etc: Section

1.1.4) were presented in detail on page 15 to 20.

In section “1.2. PINEAPPLE - RAW MATERIAL FOR BRANDY

PRODUCTION”, the overview of (1.2.1) The origin of pineapple plants; (1.2.2) Overview

of pineapple cultivation and processing in Vietnam; and (1.2.3) The biological

characteristics and nutritional composition of pineapples were presented on pages 21 to

26.

Section “1.3. BRANDY PRODUCTION TECHNOLOGY” presented (1.3.1)

History of researches and production of brandy around in the world and in Vietnam,

from page 27 to page 33; (1.3.2) Wine fermentation for distillation of brandy on pages

34 to 38; (1.3.3) Distilled wine for brandy; (1.3.4.) Aging brandy on page 38 to 44; and

(1.3.5) Criteria for evaluating brandy in Vietnam from pages 45 to 48.

In section 1.3.1 (History of researches and production of brandy around the world

and in Vietnam, some brandies from different countries (France, Spain, Italy, Germany,

USA and Latin America ...) together with their technological processes of brandy

production such as the process of producing Cognac were oveviewed. The present situation

of wine fermentation and brandy production in Vietnam was also mentioned in detail.

In section 1.3.2. (Wine fermentation for distillation of brandy), we overviewed: (1)

Mechanism of wine fermentation; (2) Process of wine fermentation from the preparation of

raw materials, preparation of fermentation medium and yeast inoculum; main and extra

stages of fermentation were well described.

In section 1.3.3. (Distilling wine for brandy) and section 1.3.4. (Aging brandy), we

described different techniques of distilleries (discontinuous distillation, refinement and

continuous distillation). Alcoholic purification and aging brandy were also mentioned in

detail.

In section 1.3.5. (Criteria for evaluating brandy in Vietnam), we overviewed

the standards for raw material, organoleptic, chemical composition; limits on heavy

metal components, food additives and specifications for packaging, labeling,

preservation and transportation of brandy were presented in detail.

CHAPTER II: MATERIALS AND METHODS

Materials, chemicals and equipments were presented in “section 2.1” included:

2.1.1. Raw materials, 2.1.2. Chemicals and media 2.1.3. Strains of microorganisms and

2.1.4 Research equipment.

Research Methods (2.2) was divided into 04 main following groups:

2.2.1. Microbiological methods include: Sample dilution for yeast isolating; Isolation of yeast on Hansen agar plates; Preparing slide of single staining from live specimen and

fixed yeast cells; Preservation of yeast strains; Activating yeast cells; Method of counting

yeast cells; Morphology study of yeast colonies and cells; Determination of alcoholic

fermentation activity; Screening and selection of mutant yeast producing high content of

ethanol; Yeast identification and classification.

2.2.2. Chemical physical methods include: Determination of the pH value; Determination of the dissolved oxygen content; Determination of the total sugar content,

Determination of vitamin C and total acid content; Determination of ethyl alcoholic

content; Distillation and purification of alcohol; Determination of furfural content (mg/l);

Determination of fermentation efficiency.

2.2.3. Sensory analysis of brandy

2.2.4. Methods of data analysis and processing

CHAPTER III: RESULTS AND DISCUSSION

3.1. Isolation and screening of yeast strains from fermented juice extract of

pineapple Queen

3.1.1. Isolation of yeast from fermented juice extract of pineapple Queen

From natural fermented juice of pineapple Queen, we isolated 8 strains of yeast,

denoted as D1, D2, D3, D4, D5, D6, D7 and D8, capable of growing and fermenting ethanol

in the medium of high content of sugar and acid. Such isolation orientation created

favorable conditions for the selection of yeast strains with strong growth and good ethanol

fermentation under conditions of natural fermentation of Queen Pineapple juice and also

limited the contamination of other microorganisms.

3.1.2. Selection of yeast strains

a) Evaluation of the growth of 8 yeast strains isolated showed that the strains D1, D4 and D5 were able to grow well in the Hansen medium, the cell density reached over 130 × 106 cells/ml. The strains D2, D3 and D8 grew worse, reaching 121 - 128 × 106 cells/ml. The growth ability of D6 and D7 strains were the lowest (reaching less than 120 × 106 cells/ml).

b) Determination of capability of alcoholic fermentation of 8 isolated yeast strains

Main criteria used to select yeast strains in this study were: strong ability of alcoholic

fermentation; tolerance to high sugar concentration and low pH; producing typical aroma. The

ability alcoholic fermentation of 8 yeast strains D1 - D8 were assessed through the amount of

CO2 emitted after 120 hours of fermentation at 28 °C (Table 3.1). In addition, we also compared

the ability to produce typical aroma among 04 selected having high capability of ethanol

fermentation (D3, D4, D5 and D8).

Fermentation capacity was calculated by the amount of CO 2 generated (g/100ml)

Fermentation Time (h)

4.44 ±

5.06 ±

4.88 ±

5.38 ±

5.79 ±

5.02 ±

4.63 ±

5.10 ±

0.02

0.03

0.02

5.08 ±

6.25 ±

6.02 ±

7.0 2 ±

8.70 ±

6.84 ±

5.55 ±

6.48 ±

0.02

0.03

0.01

0.02

0.03

0.02

0.01

7.32 ±

7.63 ±

7.96 ±

7.82 ±

Table 3.1. Ethanol fermentation and flavoring capacity of 8 isolated yeast strains

8.13 ±

8.29 ±

9.67 ±

9.85 ±

0.02

0.03

0.02

0.01

0.02

0.03

0.01

7.35 ±

7.70 ±

8.24 ±

8.32 ±

9.73 ±

7.85 ±

7.98 ±

9.89 ±

120

0.02

0.01

0.03

0.02

0.03

0.02

0.03

+++

Scent

Note: Ability to create fragrance: +++: Very fragrant; ++: Medium fragrant; +: slightly fragrant

The ability of alcoholic fermentation of 4 selected yeasts strains D3, D4, D5, D8 at low

pH was show in Table 3.2. D8 strain was the strongest fermentation capacity, yielding from

9.65 to 9.88 g of CO2/100 ml of fermentation borth at pH 3.5 - 4.5. Moreover, at pH 3, while

other strains D3, D4 and D5 showed weak capacity of alcoholic fermentation; D8 strain did

ferment quite well, producing 9.10 g of CO2 per 100 ml of fermentation broth. Differences in

ethanol fermentability of selected yeast strains at 4.0 and 4.5 were not much (P <0.5). Thus, the

D8 strain which not only showed high fermentation capacity at low pH but also had high

fermentation capacity in wide range of pH, capable of producing typical fragrance was selected

for further study on pineapple wine fermentation and brandy production.

Table 3.2. The fermentation ability of 4 types selected yeast strains D3, D4, D5, D8 at low

Fermentation capacity was calculated by the amount of CO 2 emitted (g/100ml)

pH of the environment

2.5

2.79 ± 0.03

3.32 ± 0.02

3.07 ± 0.01

2.49 ± 0.2

3.0

8.88 ± 0.02

8.79 ± 0.03

6.92 ± 0.02

pH environments

9.10 ± 0.02

3.5

9.41 ± 0.01

9.44 ± 0.02

8.01 ± 0.02

9.65 ± 0.02

4.0

9.52 ± 0.01

9.62 ± 0.02

8.93 ± 0.02

9.88 ± 0.02

4.5

9.53 ± 0.02

9.63 ± 0.01

8.96 ± 0.03

9.97 ± 0.03

3.2. Biological characteristics of the selected yeast strain D8

3.2.1. Colony and cell morphology of yeast strain D8

Strain D8 was cultured on Hansen agar medium at 28 °C for 96 h, the colonies appeared to

be round, white, smooth border and the diameter of colonies was 0.43 - 0.66 cm (Figure 3.1).

Figure 3.1. Colony of D8 strain on Hansen agar medium at 28 °C after 96 h of cultivation

Cells of strain D8 are oval or ovoid in shape, about (3,2 - 4,2) × (4,5 - 5,4) μm in diameter,

budding unevenly at both poles and around mother cells, buds are about (2.5 - 3.0) × (4.3 - 5.3)

μm in diameter. The surface of many cells have budding scar; some cells have large and deep

concave scar up to about 1000 nm in diameter.

Figure 3.2. Cell of D8 strain under S4800-NHE electron microscope A - Mother cell, B - Bud, C – Deep concave scar on cell surface, D - Scar (splitting location of buds)

3.2.2. Biochemical - physiological characteristics of yeast strains D8

The physiological - biochemical characteristics and sugar metabolism of yeast strains

D8 were compared to the control yeast strains S. cerevisiae TCCY using API C 20 AUX kit

were shown in Table 3.3 and by using API ID32 C kit were shown in table 3.4.

Yeast strains

Triplet

Type of

Strains D8

Strains S. cerevisiae TCCY

Negative control

number

sugar

Result

Total

API

Result

Total

API

Result

Total

API

Point

reaction

point

identifier

reaction

point

identifier

reaction

point

identifier

3041130

7040130

0000000

GLU

GLY

2KG

ARA

XYL

III

ADO

XLT

GAL

INO

SOR

MDG

NAG

CEL

LAC

MAC

SAC

TRE

VII

MLZ

RAF

H / pH +

Note: +/-: Positive / Negative reaction; O: no sugar; GLU: D-glucose; GLY: glycerol; 2KG: calcium-2; keto-

gluconate; ARA: L-arabinose; XYL: D-xylose; ADO: adonitol (ribitol); XLT: xylitol; GAL: D-galactose; INO:

inositol; SOR: D-sorbitol; MDG: Methyl-αD-glucopyranoside; NAG: N-acetyl-glucosamine; CEL: cellobiose; LAC:

D-lactose; MAL: D-maltose; SAC: D-saccharose; TRE: D-trehalose; MLZ: D-melezitose; RAF: D-raffinose.

Table 3.4. The ability of sugar metabolism of D8 and TCCY strains determined by API C 20 AUX kit

Blank template

Triplet number

Type of sugar

Point

Strains D8 Total point 5

Total point 5

Total point 0

API identifier 5040000 031

Strains of yeast Strains S. cerevisiae TCCY API identifier 5040010 031

API identifier 000000 0000

III

VII

ĨX

0 0

GAL ACT SAC NAG LAT ARA CEL RAF MAL TRE 2 KG MDG SOR SYL RIB GLY RHA PLE ERY MEL GRT VIII MLZ GNT LVT MAN LAC INO GLU SBE GLN ESC

Result reaction + - + - - - - - + - - - - - - - - - - - - - - - + + - + - - -

1 0 4 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0

Result reaction + - + - - - - - + - - - - - - - - - - - - - - - + + - + - - -

1 0 4 0 0 0 0 0 4 0 0 0 0 0 0 + 0 0 0 0 0 0 0 0 1 2 0 1 0 0 0

Result reaction - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Note: +/-: Positive / Negative reaction; O: no sugar; GAL: D-galactose; ACT: cycloheximide (actidione); SAC: D- saccharose; NAG: N-acetyl-glucosamine; LAT: lactic acid; ARA: L-arabinose; CEL: cellobiose; RAF: D-raffinose; MAL: D-maltose; TRE: D-trehalose; 2KG: potassium-2; keto-gluconate; MDG: Methyl-αD-glucopyranoside; SOR: D-sorbitol; XYL: D-xylose; RIB: D-ribose; GLY: glycerol; RHA: L-rhamnose; PLE: palatinose; ERY: erythritol; MEL: D-melibiose; GRT: sodium glucuronate; MLZ: D-melezitose; GNT: potassium gluconate; LVT: levulinic acid (levulinate); MAN: D-manitol; LAC: D-lactose; INO: inositol; GLU: D-glucose; SBE: L-sorbose; GLN: glucosamine; ESC: esculin ferric citrate .

Table 3.5. The ability of sugar metabolism of D8 and TCCY strains using API ID 32kit C

The results of fermentation of sugar metabolism and some physiological and

biochemical characteristics of D8 strain using API C20 AUX and API ID 32 kit showed that

D8 strain belong to as Saccharomyces cerevisiae with probability of more than 98%.

3.3.2. Identification and classification of D8 strain

Based on morphological characteristics of colony and cell (3.2.1), biological

characteristics of D8 yeast strains (3.2.2), we identifile D8 strain belong to species of

Saccharomyces cerevisiae, genus of Saccharomyces, class of Ascomycota (according to

Looder classification key, 1971). Strains D8 had anabolic capacity of using (NH4)2SO4

belonging to the subclass of Hemiascomycetidae. D8 strain had ability of metabolising D-

glucose, D-galactose, inositol, D-maltose, D-saccharose, D-manitol and D-lactose did not

have the ability of metabolising glycerol, L-arabinose, D-xytose, D-sorbitol, xilitol, D-

cellobiose, D-trehalose, D / L-rafinose and L-sorbose. Therefore, according to the traditional

classification key of Looder, strain D8 had many characteristics of S. cerevisiae.

In order to reconfirm the identification results molecular biology

method was used to identify D8 strain. Gene segment coding for D1 / D2 sequence in 28S r-

RNA gene of D8 strain was multiplied by PCR reaction to compare with the similar gene

sequence of yeast strains of S. cerevisiae deposited in the gene bank of NCBI

(https://www.ncbi.nlm.nih.gov).

> D1/D2 sequence of D8 strain

ACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCACAGGCTATAATACTTACC

GAGGCAAGCTACATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTGGCCCA

GTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGGCACAAAACACCATGT

CTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAA

AGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATT

TAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACT

CTTCGAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCT

CTATGACGTCCTGTTCCAAGGAACATAGACAAGGAACGGCCCCAAAGTTGCCCTC

TCCAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCC

GCTTCACTCGCCGTTACTAAGGCAATCCCGGT

Saccharomyces cerevisiae

Sequence ID: gb|KF646229.1|

Identities: 531/531(100%)

D1 / D2 sequence of D8 yeast strain showed 99-100% similar to that of S. cerevisiae

ATCC 18824 KC881066.1, S. cerevisiae SR127 CP011558.1, S. cerevisiae NCIM3186

CP011821.1 and S . bayanus CHFY0321EU719073.

The results of D8 strain identification by cell and colony morphology, biochemical

method and molecular biology method all confirmed the D8 strain belong to species of S.

cerevisiae, family of Saccharomycetaceae, oder of Saccharomycetales. This strain was

classified, named as S. cerevisiae D8 for further study on wine fermentation and brandy

production from pineapple Queen. These results were presented in research article 3.

3.2.3. Factors affecting the growth and development of S. cerevisiae D8

We have conducted research on the factors affecting the growth and development of S.

cerevisiae D8 yeast to determine suitable culture medium and condition. Main factors

affecting the growth and development of S. cerevisiae D8 include initial pH, initial sugar

concentration, culture temperature, nitrogen source were presented from pages 79 to 90 in

the full text of this doctoral thesis. In particular, bean sprouts extract could replace pepton

for culture of in S. cerevisiae D8; this modified medium also bring higher cell growth than it

did in conventional medium using pepton. Bean sprouts provide not only nitrogen but also

vitamins and minerals which substances may be lack of in pepton for the growth of yeast.

Bean sprouts are quite cheap, easy to make, or purchase; it also give fermentation broth a

natural aroma and color. From these studies, a suitable medium and culture condition for S.

cerevisiae D8 growth were Hansen medium containing of 70g/l sucrose and 100 g/l of bean sprouts/l extract, pH 4.0, and cultivation temperature of 28oC. In this culture condition, the maximum density of yeast cells reached 342.8 × 106 living cells/ml and the rate of budding

cells was 88%.

3.3. Factors affecting pineapple wine fermentation

3.3.1. Material

Our analysis showed the juice extract of pineapple Queen had an average sugar

content of 126 g/l, a vitamin C content of 41 mg/l, an acid total of 3.6 g/l, and pH 3.4. This

result is higher than the nutrition value of pineapple published on the USDA nutrition

database. According to this database, the sugar content in of pineapple juice is 9.26 g/l,

vitamin C is 36.2 mg/l. These differences may be explained by the nutritional composition

depends on pineapple varieties, the different soil, care regime, season and harvest time. For

brandy production, chemical composition of pineapple juice analyzed was perfectly suitable

for alcoholic fermentation and brandy distillation.

3.3.2. Factors affecting pineapple wine fermentation

Influence of temperature, initial pH, initial sugar concentration, dissolved oxygen content, percentage of yeast inoculum to the fermentation volume were presented from Table 3.7 to 3.11 in the full text of this thesis (pages 92 – 98) and in the research article No. 2.

Table 3.7. Effect of temperature on alcoholic fermentation of pineapple juice

Alcohol content (% V/V)

Criteria Fermentation temperature ( ᴼC) 28 24 32 20

Residual sugar (g/l)

5.82 ± 0.03

5.69 ± 0.05 5.48 ± 0.02 4.97 ± 0.03 4.63 ± 0.07

Acid (g/l)

5.71 ± 0.02

5.93 ± 0.05 6.09 ± 0.02 6.14 ± 0.02 6.22 ± 0.03

Fermentation efficiency (%)

83.35 ± 0.31 84.13 ± 0.15 85.11 ± 0.08 85.01 ± 0.15 83.25 ± 0.23

The fragrance of fermentation broth

+++

Note: Ability to create fragrance: +++: Good fragrant; ++: Medium fragrant; +: Less fragrant

36 10.82 ± 0.04 10.91 ± 0.02 11.04 ± 0.01 11.01 ± 0.02 10.82 ± 0.03

Table 3.8. Effect of initial pH on alcoholic fermentation of pineapple juice

Initial pH of the fermentation medium

3.5

4.5

11.03 ± 0.01

11.08 ± 0.03

11.16 ± 0.06

11.01 ± 0.02

10.84 ± 0.02

194.43 ± 0.07

194.97 ± 0.09 195.52 ± 0.03 195.36 ± 0.05 195.20 ± 0.04

5.44 ± 0.03

5.62 ± 0.03

5.68 ± 0.01

5.89 ± 0.04

6.04 ± 0.05

85.01 ± 0.08

85.40 ± 0.23

86.28 ± 0.46

85.01 ± 0.15

83.64 ± 0.15

+++

Alcohol content (%V/V) Amount of sugar consumed (g/l) Acid (g/l) Fermentation efficiency (%) The fragrance of fermentation broth

Criteria

Table 3.9. Effect of sugar content on alcoholic fermentation of pineapple juice

Initial sugar content of fermentation medium (g/l)

126

150

170

200

220

250

6.92 ± 0.03 8.58 ± 0.02 9.54 ± 0.02 11.22 ± 0.02 11.24 ± 0.02

Alcohol content (% V/V)

11.21 ± 0.03

194.46

211.22 ± 0.02

240.14 ± 0.02

Amount of sugar consumed (g/l)

115.88 ± 0.01

144.99 ± 0.02

164.92 ± 0.02

± 0.03

Acid (g/l)

6.64 ± 0.02 6.22 ± 0.02 5.83 ± 0.01 5.56 ± 0.02

5.28 ± 0.01 5.21 ± 0.02

86.67 ± 0.15 82.88 ± 0.14

72.51 ± 0.18

Fermentation efficiency (%)

89.02 ± 0.21

88.43 ± 0.17

86.78 ± 0.18

+++

The fragrance of fermentation

Criteria

Table 3.10. Effect of dissolved oxygen on alcoholic fermentation of pineapple juice

Dissolved oxygen content in fermentation broth (mg/l)

Criteria

Alcohol content (% V/V) 11.29 ± 0.02 11.81 ± 0.02 12.37 ± 0.02 11.88 ± 0.02 11.36 ± 0.02

2.52 ± 0.02

2.43 ± 0.02 1.25 ± 0.02

2.61 ± 0.02

2.72 ± 0.02

Residual sugar (g/l)

5.13 ± 0.02

5.21 ± 0.02 5.28 ± 0.02

5.34 ± 0.02

5.39 ± 0.02

Acid (g/l)

Fermentation efficiency

87.07 ± 0.02 91.17 ± 0.02 95.18 ± 0.02 91.66 ± 0.02 86.58 ± 0.02

(%)

The fragrance of

+++

fermentation broth

Table 3.11. Effects of the yeast inoculum on alcoholic fermentation of pineapple juice

Rate of yeast innoculume (%)

Criteria

Alcohol content (% V /V)

12.35 ± 0.01 12.37 ± 0.02 12.37 ± 0.02 12.34 ± 0.01

Residual sugar (g/l)

1.84 ± 0.020

1.25 ± 0.03

1.52 ± 0.01

1.69 ± 0.03

Acid (g/l)

4.52 ± 0.02

4.67 ± 0.01

4.81 ± 0.01

4.83 ± 0.02

Fermentation efficiency (%)

95.09 ± 0.08 95.28 ± 0.15 95.28 ± 0.15 94.99 ± 0.08

End time of primary fermentation end time (days)

The fragrance of fermentation broth

+++

From the above results, suitable conditions for alcoholic fermentation of pineapple

juice for brandy production were: Pineapple juice pH 4, sugar content of 220 g/l, amount of dissolved oxygen 7 mg/l, yeast inoculum 17,1 × 106 cells/ml fermentation temperature at

28°C. After 14 days of main and extra fermentation time, standard pineapple wine was

gained with suitable quality for pineapple brandy production.

3.3.3. Pineapple wine fermentation from pineapple juice (20 L/batch)

Inoculum preparation: Inoculum of S. cerevisiae D8 was prepared from test tube to different volumes (1st, 2rd and 3rd inoculum which was described in detail on page 53 in the

full text of the thesis. Yeast inoculum should quickly checked at each stage by observing morphology and determining the density of living yeast cells to ensure the 3rd inoculum must reach a minimum of 340 × 106 living cells/ml and the percentage of budding cells reached

approximately 88%.

Alcoholic fermentation of pineapple juice

Number of yeast cells, sugar consumption, alcohol content and acid content of the

fermentation broth were monitored every 4 hours for the first 24 h of the fermentation

(Table 3.12).

In the first day of the fermentation, the number of yeast cells increased rapidly, sugar

consumption was slow (about 38.5 g/l after 24 hours of the fermentation). Theoretically, it would

produce 5.9 g/100ml , which was equivalent to 7, 47% V/V; however, the actual alcohol

production was only 2.24% V/V which was much lower than that of theoretically account. This

may be explained by the amount of sugar consumed mainly for growth and development of

yeast cells in the first 24 hours of the fermentation. After 24 h, the number of cells in the fermentation broth reached 342.8 × 106 cells/ml; the consumption sugar then be consumed

mainly for making ethanol.

Table 3.13. Dynamics of alcoholic fermentation of pineapple juice during the first 24 hours

Criteria

Time (h)

Alcohol content of finished wine (% v/v)

Amount of sugar consumed g/l)

Number of yeast cells (x 10 6 cells/ml)

Total acidity (g/l)

3.6 ± 0.01

of the fermentation

17.3 ± 0.2

24.5 ± 0.3

0.16 ± 0.02

3.6 ± 0.01

2.8 ± 0.1

41.2 ± 0.5

0.34 ± 0.03

3.6 ± 0.01

5.9 ± 0.3

88.4 ± 0.6

0.72 ± 0.1

3.7 ± 0.02

12.6 ± 0.3

216.7 ± 0.8

1.09 ± 0.1

3.8 ± 0.02

18.7 ± 0.5

296.5 ± 3

1.63 ± 0.2

3.8 ± 0.02

26.1 ± 0.5

3.9 ± 0.02

38.5 ± 0.4

342.8 ± 5

2.24 ± 0.3

Changes of fermentation broth of the following days were every 24 hours (Figure 3.9).

Figure 3.9. Dynamics of alcoholic fermentation of pineapple juice in 30 days

The composition of the fermentation broth changed very fast during the first 10 days

of the fermentation. Number of cell, sugar content and alcohol content were closely related. On the first day, the number of viable cells reached a maximum of 342.8 × 106 cells/ml, the

amount of sugar consumed mainly for growth and development of yeast cells; there for the

amount of alcohol produced was not proportional to the amount of sugar consumed.

On the second day, the number of living cells did not increase, yeast cells were in

stationary phase since the number of cells increased was equivalent to the number of death

cells. The amount of alcohol increases rapidly corresponding to the sugar consumed for the

fermentation process to produce ethanol.

From day 3 onwards, the number of living cells decreases rapidly, which could be

explained by the rapid decreased in dissolved oxygen which had been used for the growth

and development of yeast cells on the first day and second day. Amount of alcohol produced

was also a factor inhibiting the growth and development of yeast cells. The more of alcohol

formed, the more of CO2 released during the respiration and fermentation of yeast cells created anaerobic environment in the fermentation vessel. At this time, the yeast changes

from the growth stage to the main stage of fermentation, converting sugar into alcohol.

Especially, the alcohol content increases the fastest on the 3rd, 4th and 5th days. From the

6th day onwards, the fermentation took place slowly, fermentation parameters do not

change significantly, the amount of sugar - the main substrate of alcohol fermentation

decreased to 50 g/l.

By the 10th day of fermentation, the amount of alcohol generated was 11.3% V/V and hardly increase anymore. On the 25th day, the end of the fermentation process, the alcohol

content reached 11.6% V/V. These results were presented in paper No. 1.

3.3.4. Production of pineapple brandy on a laboratory scale (100 L/batch)

At the scale of 100 liters, after 10 days, the pineapple wine fermentation has basically

ended, the young wine had an alcohol content of 12.4% V/V. This result was higher than

that of Nadya Hajar, et al. published in 2012 (8.6% V/V), asymptotic the fermentation

results of Ibegbulem et al (2014) (12.7% V/V). At this stage, residual sugar was 1.25 g/l,

total acid was 5.67 g/l and the fermentation efficiency reached 95.3%, meeting the standard

wine for distillation brandy. After 25 days, the fermentation process is completely finished,

the amount of alcohol was kept at 12.4% V/V, the remaining sugar was 0.93 g / l, and the

total acidity was 5.78 g/l. There was a great difference in the fermentation component after

10 days. Sensory results showed that if distilled after 10 days of fermentation, brandy had a

good taste and if the secondary fermentation period lasts up to 25 days before distillation,

the brandy was less fragrant. This difference has been seen in the production of brandy from

grapes. Extended fermentation from grape juice fermentation would give brandy more

aromatic when distilled. However, extended the time of secondary fermentation made

pineapple brandy lost much flavor. Therefore, we chose the day 10 as the ending time of

fermentation for distillation of brandy.

From the above results, we could confirm that the suitable environment for fermenting

pineapple wine to produce brandy were: Pineapple juice which was adjusted to pH 4, the

sugar content was 220 g/l, the amount of dissolved oxygen was 7mg/l, the additional

17 inoculum was 17.3 × 104 cells/ml of fermented broth, fermentation temperature was 28 °C,

fermentation was stopped at day 10 for distillation of brandy.

3.4. Modification of yeast strains S. cerevisiae D8 by random mutation technique

3.4.1. The lethal dose of NTG chemicals, UV ultraviolet rays and the combination of

NTG and UV to S. cerevisiae D8 yeast cells

Strains of S. cerevisiae D8 were mutated by 3 methods: (1) Using NTG, (2) Using

ultraviolet light (UV, 50W, 260nm) and (3) combining NTG (N-methyl-N-nitro-N-

nitrosoguanidine) with UV light for 20 - 140 minutes. The lethal dose of each mutation factor

on S. cerevisiae D8 yeast cells was shown in Figure 3.10.

Figure 3.10. The lethal dose of NTG chemicals, ultraviolet rays and combination of NTG

and UV light to S. cerevisiae D8 yeast cells

The mortality time of 99% of S. cerevisiae D8 yeast cells in 3 × 106 living cells/ml when

treated with UV light, NTG and combination of UV light and NTG was 120 minutes, 100

minutes and 80 minutes, respectively. A higher rate of death cells and a shortening of the

lethality time when treating yeast with combination of NTG and UV light has been reposted by

Liu et al. (2011) and Sridhar et al. (2002) compared single treating yeast cells with NTG or UV.

The lethal effect of yeast cells treating by the combination of NTG and UV was higher than that

treated by the combination of electric force and NTG which has been published by Kim and

Lee (1998).

3.4.2. Capability of ethanol fermentation of mutants

Random mutation by a combination of NTG and UV treatments increased the mortality of

yeast cells compared to that of treatment separately with NTG or UV. From these surviving

colonies at survival rate lower than 10.57%, mutants which were resistant to high sugar and

alcohol content, had been screened. Results were shown in research article 4 and pages 105 to

106 of the full text of this thesis.

Table 3.14. Capability of ethanol fermentation of yeast mutants by NTG

No.

Yeast strain / mutant yeast strain after treatment with NTG

Ethyl alcohol concentration obtained (% v/v)

Yield of ethanol fermentation capacity (%) compared to S. cerevisiae D8 strain

100

113 112

109

107

S. cerevisiae D8 N140.6 N100.18 N80.14 N120.5 N100.7 N80.9 N.80.2 N120.4

12.37 ± 0.02 14.02 ± 0.02 13.88 ± 0.03 13.51 ± 0.01 13.48 ± 0.03 13.25 ± 0.03 11.05 ± 0.01 10.42 ± 0.01 10.21 ± 0.03

S. cerevisiae D8 cell lines survived after NTG treatment were screened in fermentation

medium containing content 220 g/l of sucrose and 5 cells lines with higher alcoholic

fermentation activity than that of strain S. cerevisiae D8 were screened. Especially, mutant

140.6 showed the fermentation activity of 14.02% V/V, 13% higher than that of the original

strain S. cerevisiae D8. This mutant was selected for further study on UV light treatment.

Ethanol fermentation activities of the accumulation mutants could be classified into 3

groups with significant differences (there were no significance among mutants in a group).

Group 1 included the accumulated mutants NU140.12, NU80.17, and NU100.8 which had

ethanol fermentation capacity 20% higher than S. cerevisiae D8 strain. Group 2 included the

accumulated mutants NU60.11, NU120.9, NU140.4, NU100.16, and NU80.24 which had

ethanol fermentation capacity 16-20% higher than that of S. cerevisiae D8 strain. Group 3

included the mutants NU60.18, NU120.6, NU60.5, and NU80.8 which had fermentation

capacity 10% higher than that of S. cerevisiae D8 strains. Accumulation mutant NU120.4

showed the highest ethanol fermentation capacity (reaching ethanol content of 15.1% V/V after

10 days of fermentation), an increase of 22% of ethanol accumulation compared to that of strain

S. cerevisiae D8 and an increase of 8% of ethanol accumulation compared to that of the original

mutant N140.6. Ability of high ethanol production of the accumulated mutant NU 120.4 was

significant different compared to the remaining 12 accumulation mutants (P = 0.05). This result

was higher than what previously reported by Kim and Lee (1998) on mutagenicity of S.

cerevisiae by other methods (reaching an ethanol content of 13.3% in selected mutant).

The accumulated mutant NU 120.4 showed a ethanol fermentation capacity (reaching an

alcohol content of 15.1% V/V, an increase of 22% compared to S. cerevisiae D8 strain of yeast)

in fermentation medium containing 250 g / l of sugar and mutant yeast cells grows well in the

medium containing 6 - 10 % ethanol. Therefore, this potential mutant was for further study

before its application in the production of high alcohol from pineapple Queen.

3.5. Distillation, purification and aging pineapple brandy

3.5.1. Distillation and purification

The actions of yeast cells in the alcoholic fermentation process are often accompanied

by many unwanted by-products such as acid, methanol, aldehydes, furfurol (Shown in

section Composition of impurities in raw pineapple brandy, on page 111 of the full text of

this thesis). Therefore, a research to look for a suitable method to remove effectively

impurities in pineapple brandy is very necessary. In this study, three different methods were

carried out: fractional distillation (pages 112 - 114 of the full text of this thesis), chemical

methods (pages 114 - 119 of the full text of this thesis) and combining chemical and

fractional distillation method (pages 119 - 121 of the full text of this thesis).

mg/l; g/l; point

700.0 614.0 ± 0.4

600.0

500.0

400.0 Impurities Brandy

332.0 ± 3

273.0 ± 0.2

300.0 220.0 ± 0.3

Brandy was purified by combining method

200.0 125.0 ± 3

100.0 65.0 ± 0.2 36.0 ± 0.2

16 ± 0.04

0.6 ± 0.05

0.9 ± 0.05

12 ± 0.04

12.0 ± 0.3

0.2 ± 0.03

0.0 Estee (mg/l)

Criteria

Aldehyde (mg/l)

High alcohol (mg/l)

Methanol (mg/l)

Fucfurol ( mg/l)

Acid (axetic aide) (g/l))

Sensory evaluation (point)

Figure 3.16. Impurities in pineapple brandy were cleaned by combining method

The combining method had significantly reduced the content of impurity in pineapple

brandy: the amount of aldehydes decreases by 94.5% to 12 mg/l; high alcohol reduced by

45.9% to 332.0 mg/l; ester decreased by 54.2% to 125.0 mg/l; methanol decreased by 44.6%

to 36 mg/l; acid reduced by 62.7% to 0.2 g/l; furfurol was not detected in purified brandy;

sensory score reached 16/20. Pineapple brandy cleaned by a combination method met the

standards QCVN6-3: 2010 / BYT of Vietnames alcolhol .

The combination method was the best compared to the fractional distillation and the

chemical method when performed separately. Most impurities were removed from raw

pineapple brandy without losing fragrance; the quality of purified pineapple brandy met

standards of Vietnamese alcohol.

3.5.2. Aging Pineapple brandy

Oak bar and commercial oak pulp imported from France were used to study the role of

oak in pineapple brandy production. Using commercial oak pulp in aging pineapple brandy

requires less weight (4 g/l) than when using oak bar (10 g/l) but still achieves color, flavor

and taste better than that of using oak bars. Results were reported in Table 3.21 from pages

123 - 124 of the full text of this thesis and in research article 5).

Table 3.21. Some main aroma components of white pineapple brandy (aging for 24 month

without oak)

No.

Compound name

Content (%)

General characteristics of flavor

The taste of fermented fruit

Retention time (minutes) 23.63 24.76

1 2

Metyl caprate Geranic acid

4.22 3.91

Formula of compound C 11 H 22 O 2 C 10 H 16 O 2 Woody, greasy sweetness

25.78

Copaene

1.82

C 15 H 24

Aroma of wood , honey sweet , slightly spicy

25.96 28.99 29.70

4 5 6

Ethyl decanoate Muurolene Muurolene

1.53 0.94 2.80

C 12 H 24 O 2 Wax, fruit, sweet apple C 15 H 24 C 15 H 24

30.02

Methyl laurate

0.84

C 13 H 26 O 2

30.38 30.45 31.10 33.61

8 9 10 11

0.56 2.10 0.34 3.76

Herbal incense Aroma of herbs Wax, cream, fat with soap, coconut shades Herbal incense Floral scent, weak spicy The aroma of turpentine Herbal incense, green tea, spicy

C 15 H 24 C 15 H 22 C 10 H 16 C 15 H 26 O

34.01

4.12

Taste of honey, herbal plants

C 15 H 26 O

34.10

2.19

Lavender fragrance

C 15 H 26 O

34.38 34.97

14 15

Cadinene Calamene Calacorene Cubenol <1-epi> Muurolol (= T- Muurolol) Cadinol (= Tau -Mururolol) Cadinol Cadalene

0.98 1.02

C 15 H 18

42.65

Ethyl Palmitate

3.71

C 18 H 36 O 2

Total

34.88

Fruity, creamy and fermented, vanilla, balsamic shades)

Table 3.22. The aromatic component of pineapple brandy (aging for 24 months with

commercial oak pulp (4g/l).

General characteristics of flavor

No.

Compound name

Content (%)

Formula of compound

Retention time (minutes) 5.54

Pinene

0.17

C 10 H 16

Scent of green pine Aromas of wood, cool, mint, like in

5.91

Camphene

0.13

C 10 H 16

green “Lim” leaves, lemon zest, citrus

Fruit flavor: Sweet, greasy, almond,

6.22

Benzadehyde

0.42

C 7 H 6 O

cherry, wood

8.52

Salicyaldehyde

0.12

Bitter almond flavor

C 7 H 6 O 2

The woody notes of linden, acacia,

pods and leaves of some other trees

12.30

Benzenpropanal 0.70

C 9 H 12 O

such as guava, strawberry, rum, wine,

mushrooms and malt

Borneol (=

12.43

0.17

The smell of camphor

C 10 H 18 O

Endo-Borneol)

Cinnamaldehyde

14.19

0.97

Cinnamon

C 9 H 8 O

Cinnamaldehyd

16.15

74.22

Cinnamon aroma

C 9 H 8 O

Cinamaldehyde

C 11 H 14 O 2

20.12

18.97

The smell of fresh cinnamon

dimethyl acetal

C 9 H 6 O 2

21.25

Coumarin

1.54

Sweet scent

Cinanamic acid

Fruity and aromatic cinnamon with

C 11 H 12 O 2

21.33

0.19

amber

Cinamyl acetate

21.47

1.23

C 11 H 12 O 2 Aroma of cinnamon flower and honey

Fruit scent, citrus scent, aroma of

C 15 H 24

23.38

Bisabolene (b-)

0.12

opoponax resin

Methoxycinnam

Sweet fragrance of strawberries and

24.08

aldehyde <(E) -

0.36

C 10 H 10 O 2

cherries

0->

99.31

Total

Oak plays an important role in flavor taste and color characteristics of pineapple

brandy. The composition and aroma content in brandy aging in oak wood completely

different from white pineapple brandy, which leads to different colors, flavors and senses.

Initially, brandy pineapple was colorless and transparent; brandy became amber color when

stock with oak powder. The composition of aromatic, volatile compounds (16 analyses) in

white pineapple brandy were mainly obtained after 20 minutes of GC-MS chromatography,

accounting for 34.88% of the aromatic components in white pineapple brandy. The

composition, aromatic, volatile compounds in pineapple brandy stored with oak pulp mainly

obtained in about 15 - 20 minutes of GC-MS chromatography, including 14 new substances

which were including 3 types of terpene, 1 derivatives of terpene, 2 aromatic compounds; 5

types of aldehyde, 1 acid, 1 ester.

In conclusion, oak wood played an important role in storing, flavor, taste flavoring and

color characteristics for pineapple brandy. Using commercial oak (4g/l for 24 months,

longer may be better) to store pineapple brandy in a storage tank with 6% V/V of air at 25 °

and 80% humidity) would obtain final pineapple brandy with the best color, flavor and

taste; the highest sensory scored of 18.5/20 points.

3.5.3. Technological process to produce brandy from pineapple

Technological process to produce brandy from pineapple

From a small-scale (20 liters) in the laboratory to pilot production scale (100 liters),

we proposed a technological process of brandy production from pineapple Queen

(Fig.3.18).

An explanation of the above technological process for producing pineapple brandy was

presented on pages 132 and 133 of the full text of this thesis. The process consists of 8 main

stages: (1) Preparing yeast inoculum; (2) Preparing raw material of pineapple; (3) Preparing

fermentation medium; (4) Primary fermentation, (5) Secondary fermentation; (6) Purification;

(7) Aging brandy; (8) Bottling, labeling and packaging

Strains S. cecerevisiae D8

Pineapple

- Peel and drain

1st Inoculum

- Grinding with water

2rd Inoculum

Preparation of raw materials

- Adjust pH to 4, sugar content to 220 g/l - Sulfitization 6 - 10 h

3rd Inoculum

Preparation of fermentation medium

5% volume of fermentation tank

t = 28oC, 6 days

Primary fermentation

Secondary fermentation

- Distillation

Distilation to colect raw brandy clean

- Oxidation of impurities by KMnO4 and neutralization by NaOH - Fractional distillation

Purification pineapple brandy

4 g/l oak powder

Aging brandy

24 month

Decant, dilute, adjust indicators

Bottling, labeling, packaging

Final product of pineapple brandy

Figure 3.18. Diagram of pineapple brandy production process

CONCLUSIONS AND RECOMMENDATIONS

CONCLUSIONS

1. From natural fermented pineapple juice, 8 yeast strains have been isolated, strain D8

was selected based on its high ethanol fermentation capacity, producing ethanol of 12.4 % V/V

in fermentation medium containing 220 g/l of sucrose, the fermentation efficiency reached

95.3%.

2. Identification of the strain D8 based on morphological, biochemical and molecular

biology characteristics classified this strain as Saccharomyces cerevisiae D8. Mutant NU

120.4 producing alcoholic content of 15.07% V/V (an increase of 22% compared to the

original S. strain cerevisiae D8) was screened after random mutation technique of using

NTG combined with UV light.

3. Appropriate growth medium and condition for S. cerevisiae D8 were: Sucrose 70g/l, (NH4)2SO4 2 g/l and extraction of 100 g bean sprouts/l, pH 4.0 at 28°C. Under such conditions, the maximum number of living yeast cells reached 342 × 106 cells/ml, the rate of

budding cells reached 88%.

4. Suitable medium for wine fermentation from pineapple Queen to produce brandy

were: Pineapple juice pH = 4, 220 g/l of sugar, 7 mg/l of dissolved oxygen, yeast inoculum of 17.1 × 106 cells/ml and fermentation at 28oC.

5. The raw pineapple brandy was purified by a combination of chemical and physical

method to obtain white brandy with rich aroma composition (16 substances, accounting for

34.88% of the total volatile matter contained in white pineapple brandy, were identified)

including 4 types of alcohol, 2 types of acid; 3 types of esters and 7 types of poly

saccharides (terpene); sensory score 16.0 / 20 points. A suitable content of oak powder for

aging and flavoring pineapple brandy was 4 g/l. Pineapple brandy aged for 24 months has a good sensory point of 18.5/20. Technological process to produce pineapple brandy including 8 main steps was built: (1) Prepare yeast inoculum; (2) Preparing raw material of

pineapple; (3) Preparing fermentation medium; (4) Primary fermentation, (5) Secondary

fermentation; (6) Purification; (7) Aging brandy; (8) Bottling, labeling and packaging.

RECOMMENDATIONS

1. There are needs to coordinate with the production company to transfer, authorize

technology to bring pineapple brandy product to the market.

2. Continuing a research to identify mutant genes and mutant locus of mutant NU

120.4 and a study on safety of this mutant before applying it to the production.

LIST OF PUBLICATION

1. Hoang Thi Le Thuong, Nguyen Quang Hao (2014), Fermenting pineapple wine to

produce Brandy by Saccharomyces cerevisiae D8, Natural Science and Technology, 30

(6S): p. 587-591.

2. Hoang Thi Le Thuong, Tran Thi Thuy, Nguyen Quang Hao (2016), Study on the effect of