MINISTRY OF EDUCATION AND TRAINING
CAN THO UNIVERSITY
NGUYEN THU DUNG
DETERMINATION OF CAUSATIVE BACTERIA
AGENT OF HEMORRHAGIC DISEASE
IN MUDSKIPPER
(Pseudapocryptes elongatus)
Major in Aquaculture
Identification code: 62620301
SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE
2015
This study was achieved at the College of Aquaculture and Fisheries, Can Tho University.
Scientific advisors: Assoc Prof. Dr. ĐANG THI HOANG OANH
Reviewer 1:…………………………………………………………... Reviewer 2:…………………………………………………………... Reviewer 3:…………………………………………………………... This dissertation was defended at the University Examination Committee
At………………………………………………………………... At ……hour….., on date………month……..year………………
The dissertation is available at: 1. Center for education materials of Can Tho University 2. National library
MINISTRY OF EDUCATION AND TRAINING
CAN THO UNIVERSITY
NGUYEN THU DUNG
DETERMINATION OF CAUSATIVE BACTERIA
AGENT OF HEMORRHAGIC DISEASE
IN MUDSKIPPER
(Pseudapocryptes elongatus)
Major in Aquaculture
Identification code: 62620301
SUMMARY OF DOCTORAL DISSERTATION IN AQUACULTURE
Scientific advisors:
Assoc Prof. Dr. ĐANG THI HOANG OANH
2015
Chapter 1. OVERVIEW OF THE DISSERTATION
1.1 Introduction Mudskipper (Pseudapocryptes elongatus) is a special species of high economic value, are consumed widely in domestic and export value. Mudskipper cultures in the provinces Mekong Delta region, however, in the recent times mudskipper were sick with pathological signs of hemorrhage in the body, at the fin and anal with a high mortality rate and widespread.
Most of determination of hemorrhagic disease are bacteria. Streptococcus agalactiae is typical as the causative agent of tilapia (Oreochromis sp.) (Pham Hong Quan et al., 2013), red tilapia (Oreochromis sp.) (Dang Thi Hoang Oanh and Nguyen Thanh Phuong, 2012). S. iniae on seabass (Latex calcarifer) (Tran Vi hich and Nguyen Huu Dung, 2011), Japanese flounder (Paralichthys olivaceus), red croaker (Sciaenops ocellates) (Eldar et al., 1999). In addition, fish diseases are caused by S. dysgalactiae in mullet (Liza alata, Liza haemotocheila) (Qi et al., 2013), sturgeon (Acipencer schrenckii) (Yang and Li, 2009), fish brown (Mugil cephalus) and cobia (Rachycentron canadum) (Abdelsalam et al., 2009).
Determination of hemorrhagic disease also is found from many different species as Aeromonas hydrophila bacteria (Loan et al., 2009), Vibrio parahaemolyticus and V. alginolyticus on grouper (juvenile and grow up) (Somkiat Kanchanakhan, 1996; Nguyen Thi Thanh Thuy et al., 2009 was quoted by Vo Van Nha, 2012).
Because of various agents causative diseases, so the prevention and treatment of dengue in aquatic animals are only effective when the agent and the cause is pinpointed. Currently, determination of hemorrhagic disease on mudskipper isn’t researching, to provide information for disease prevention and treatment hemorrhagic on mudskipper "Determination of causative bacteria agent of hemorrhagic disease in mudskipper (Pseudapocryptes elongatus) " is researched.
1.2 General objective of the study Survey and assessment of hemorrhage appear on a mudskipper farm in Bac Lieu province. Identifying characteristics of Pathology in fish pathogens which proposed solutions to prevent and treat the disease effectively.
1.3 Scientific significance and applicable ability of the dissertation Information from the results of an mudskipper condition and prevent disease process will contribute to limit the damage in the farming process
1
mudskipper effective on economic productivity and income generation for farmers.
1.4 New findings of the dissertation Identifying the causative agent of hemorrhagic disease in mudskipper
is S. dysagalactiae and the time the disease usually appear in mudskipper ponds. A polymerase chain reaction (PCR) was preformed and optimized for
detection of S. dysgalactiae bacteria to apply early diagnosis, rapid and specific the causative agent of hemorrhagic disease in mudskipper. Recommend some antibiotic treatment of hemorrhagic disease in mudskipper. Chapter 2. LITERATURE REVIEW
In the literature review, the thesis described and analyzed the issues related to the situation of indentured mudskipper as well as the study of certain types of pathogenic bacteria on the fish to the main contents:
- The situation of indentured mudskipper in the world and country. - The situation of the disease appears on mudskipper. - Overview of hemorrhagic disease in fish. - Overview of the characteristics of the bacteria on the fish. - Overview of the situation pathogens Streptococcus on brackish and sea fish. - Determination of the virulence of some strains of the bacteria that cause hemorrhagic disease.
- Diagnosis of hemorrhage. - Prevention and treatment of dengue in fish. Chapter 3. METHODS OF THE STUDY
3.1 3.1 Study periods and site Time to research: from September, 2011 to December, 2014 3.2 Study species: Mudskipper 3.3 Study methods 3.3.1 The interview 3.3.1.1 The secondary data Collected from the report of specialized agencies in Bac Lieu province. Secondary data include aquaculture situation and the situation of mudskipper farm in Bac Lieu.
3.3.1.2 The primary data Interview 90 farmers mudskipper commercial in Bac Lieu town, Hoa Binh District and Dong Hai District, Bac Lieu province. Primary data 2
include basic information, experience, culture techniques, information on fish diseases and how to treat the disease when mudskipper disease.
3.3.2 Fish sampling methods - Fish sample: mudskipper live, sample of 254 fish living in 34 pounds (11 ponds normal, 23 ponds have a mudskipper hemorrhagic disease). - Conditions for sampling: fish are 2-3 months old, weight 15-25 g/fish. Sampling time is 7-8 am.
3.3.3 Testing Method parasites The number of test samples of parasitic is 120 samples in 12 ponds, include 04 sampling sessions, each of 03 ponds, each pond 10 fish. Check the skin, gills and gut a fish.
The level of parasite infection: The rate of infection = (The number of infection samples/Total samples tested) x 100 The intensity of infection = (The number of parasite/Fish, organ, lame, microscope)
3.3.4 The method of sample analysis bacteria 3.3.4.1 Giemsa staining method To spread kidney samples up lame. Samples were fixed in methanol for 1 minute. Giemsa staining method according Humason, 1979 cited by Rowley, 1990. Read the results by a microscope at 100X with oil drop. 3.3.4.2 The method of isolation and identification of bacteria - Use a sterile scalpel incision in the kidney. Through kidney by implanting, twist to take samples and cultured on agar plate. Incubate plates in an incubator at a temperature of 28°C. After 24-48 hours, read the results.
- Check the net of bacteria, oxidase, catalase, O/F, capability development of bacteria in the environment TSB (+ 6.5% NaCl), the hemolytic ability of bacteria. d. The method of identification of bacteria by API 20 Strep kit (Biomérieux, Pháp) Random identifier 32 strains of bacteria collected is obtained sampling 06 times by API 20 Strep kit.
3.3.5 The identification of bacteria by sequencing method 3.3.5.1 The method of bacterial DNA extraction The process of DNA extraction from bacteria applied by the method of Bartie et al. (2006). Bacteria proliferate raised from 16-18 hours in 5 ml of NB (+ 1.5% NaCl) at a temperature of 28ºC, DNA extraction by 1.5 ml 3
of bacteria to the centrifuge tube with 100 mM Tris-HCL l 10, 1 mM EDTA, pH 8.0 (TE). The mixture was heated at 95ºC for 15 minutes, then cooled in ice and centrifuged for 2 minutes at the speed of 14,000 circle/min to separate the DNA solution and stored at -20ºC until use.
3.3.5.2 The method of sequencing 16S rRNA gene of bacteria 10 bacterial samples selected isolated from the results identified by the method of 16S rRNA gene sequencing include: B1-6T; B2-5G; B2- 3TT; B6-9TT; A1F1; A1F2; A1F4; A1F6; A1F9; A5F4. The PCR product samples were sent to laboratory NK-Biotek and R & D units of companies Nam Khoa. Sequencing products were run electrophoresis sequencing machine ABI 3130XL sequencer 16 capillar. The results sequencing of 16S rRNA gene were compared using the program Blast search on the database of NCBI gene bank.
3.3.6 The method histopathology The number of samples analyzed, including 127 fish. Sampling gill tissue, liver, kidney of healthy fish and fish disease. The samples were cut to a thickness of 5-7 mm, and then processed by automated handling machines through stages dehydrate, making the coated sample and paraffin. Casting blocks and cut with a thickness of 4-6 μm, to dye the samples by Haematocyline and Eosin (H & E). Read the results by the microscope and based on the document of Ferguson (2006) (cited by Dang Thi Hoang Oanh, 2011).
3.3.7 The method hematology 3.3.7.1 The method analyze blood samples of fish The number of samples analyzed blood samples is 102 fish. Blood was taken from the aorta at the tail of fish (Houston, 1990). To spread the blood sample on lame. The blood sample after being fixed by soaking in methanol for 1-2 minutes (Rowley, 1990).
3.3.7.2 The quantification of erythrocyte Red blood cells (RBC) are counted by the erythrocyte count chamber at 40X of the microscope. The formula for calculating the red blood cell:
R = C x 10 x 5 x 200 Notes: R: red blood cell (cells/mm3); C: total hemoglobin count on five areas; 10: spacing lamellae and counting chamber is 0.1 mm; 5: The area of each zone is 0,2 mm2; 200: red blood cell dilution.
3.3.7.3 Qualitative and quantitative leukocyte Staining pattern: sample dyeing method Wright's & Giemsa the (Humason, 1997 cited by Rowley, 1990). Observation under microscope at 100X (Supranee et al., 1991).
4
Total leukocytes (TBC) = (Leukemia in 1500 cells x the density of red blood on chamber RBC)/RBC in 1500 on a sample cell dye. The density of each type (cells/mm3) = The number of each type of leukocytes x density total leukocytes / 200.
3.3.8 The rapid diagnostic method hemorrhage 3.3.8.1 The method of bacterial DNA extraction: (same 3.3.5.1) 3.2.8.2 The method of the kidney tissue DNA extraction Based on the method Phenol chloroform extraction of Taggart et al. (1992) (to adjust by Dang Thi Hoang Oanh Dang and Dang Thuy Mai Thy, 2009) to extract DNA fish kidney.
3.3.8.3 The method of DNA amplification PCR amplified 16S rRNA gene was performed according to the process of Nunan et al. (2003). The molecular weight of the DNA fragments to detect S. dysgalactiae is 1500 bp. The primer is used in PCR amplification 16S rRNA gene designed by Zinniel et al., (2002)
Primer 1: p515FPL 5'-GTGCCAGCAGCCGCGGTAA- 3 ', Primer 2: p13B 5'AGGCCCGGGAACGTATTCAC-3 '. 3.3.8.4 The PCR detected S. dysgalactiae PCR using primers STRD-DYI/dys-16S-23S-2 according to Hassan et al. (2003): STRD-DYI: "5 'TGGAACACGTTAGGGTCG 3'"
16S-23S-dys-2: "5 'CTTAACTAGAAAAACTCTTGATTATTC 3'" PCR detects S. dysgalactiae bacteria based of Hassan et al. (2003), the positive control used in PCR detection of bacteria is S. dysgalactiae, that was identified by decoding 16S rRNA sequencing is B2-5G.
3.3.8.5 The method of electrophoresis Using 10 l PCR products were run electrophoresis on 1.5% agarose gel (ABgene, UK) in the buffer x 1 TAE (10 mM Tris, 5 mM acetate, 0.1 mM EDTA). 3.3.8.6 The method of determining the sensitivity of PCR detected S. dysgalactiae
0.5 g kidney tissue of fish mixed bacteria with density 25 ng, 50 ng, 100 ng, 200 ng, 400 ng, 800 ng, 1.600 ng and 3,200 ng used for PCR to detect S. dysgalactiae. 3.3.8.7 The method of determining the specificity of PCR detection S. dysgalactiae
Using PCR primers in detecting S. dysgalactiae to detect five different types of bacteria including Vibrio parahaemolyticus, Edwardsiella ictaluri, Aeromonas hydrophilla, Streptococcus agalactiae, Flavobacterium
5
columnare. The positive control used PCR detection S. dysgalactiae, it was identified by decoding 16S rRNA sequencing is B2-5G.
3.3.8.8 The applicability of PCR detection process S. dysgalactiae The ability to process applications in multiple strains of S. dysgalactiae and kidney of fish.
3.3.9 The method of antimicrobial susceptibility According to the method of Geert Huy, 2002. 3.3.9.1 The method of bacterial recovery Bacteria keeps at -80oC, recovered on TSA (+1.5% NaCl) and incubated at 30°C after 48 hours.
3.3.9.2 The method of antimicrobial susceptibility Using pipette 0,1 ml bacteria MHA (+1.5% NaCl) and spread, use pen takes antibiotic into a petri dish. Each petri dish paste four antibiotic discs. Place the plate in an incubator at 30°C. Read the results after 48 hours. 3.3.9.3 The methods for determination of minimum inhibitory concentration (MIC) of antibiotics The minimum inhibitory concentration (MIC) of antibiotics on bacteria is determined by the method of Geert Huys (2002).
3.3.10 The method of arrangement laboratory 3.3.10.1 The preparation of experiment Laboratory instruments such as plastic tanks 500 L, 60 L, aeration tubing, racket, pumice stone ... be cleaned with soap and 200 ppm chlorine, drying. Then water is about 2/3 tank, aeration. Water supply to 1/3 plastic bucket. Water resource use is water salinity 10 ‰.
3.3.10.2 The fish for laboratory Mudskipper are the same size, strong, flexible, light-skin, weight 15- 20 g/fish. The fish are fed in 500 L plastic tanks, aeration of about 1 week. Check the health of fish (randomly selected 5 fish) before the experiment.
3.3.10.3 The Preparation bacterial infect with fish Bacteria are stored on TSA (+1.5% NaCl) (TSA+), incubated at 28°C. Overgrowth, then, bacteria were centrifuged at a speed of 5,000 cycles/min at 4°C for 5 minutes. Counting bacterial density by colorimetric spectrophotometer at 610 nm. Bacterial solution is diluted 10 times (1 ml of 1 x 109 CFU/ml + 9 ml physiological saline) to be the density of 108, 107, 106, 105, 104, 103 CFU/ml.
3.3.10.4 The method arrange susceptibility experiment The experiment infection was random with 4 treatments of 4 strains B1-6T, B2-3TT, B2-5G, B6-9TT injection density is 108 CFU/fish and 6
physiological saline in the control treatment. Fish were injected 0.1 ml/fish at the fin. Each treatment repeated 3 times with a density of 10 fish/tank. After injection, the expression of fish is monitored continuously for 7 days. End of experiment, in each treatment shall collect tissue samples (3 fish/treatments) in the organs gills, liver and kidneys.
3.3.10.5 The method laboratory determined LD50 Experimentally determined LD50 is completely random using 02 strains B1-6T and B2-5G. Fish experiments were injected 0,1 ml/fish. Each treatment repeated 3 times with a density of 20 fish/tank. Treatment 1, 2, 3, 4, 5, 6, 7: The fish are injected with a density of 102, 103, 104, 105, 106, 107, 108 CFU/fish.
Treatment 8: control treatment: The fish are injected with saline. After injection, the expression of fish is monitored continuously for 14 days. The concentration of bacteria lethal to 50% of fish experiment (LD50) was determined according to Reed and Muench formula (1938): LD50 = 10 a – p.d
Notes: p.d = (L% - 50%) / (L% - H%) a: The powers at which the bacteria die lowest fish (over 50%) H%: Proportion of the highest mortality (below 50%); L%: Percentage of the lowest mortality (over 50%). 3.3.10.6 The method arrange the experiment treat hemorrhagic in the laboratory - The bacteria that cause infection are B1-6T, injection density is 104 CFU/fish. The experimental period was 21 days.
- Antibiotics: DO and FFC used in experiments are antibiotics of UV company: DO and FFC in the form, materials; DO with the trade name Rydoxyne and FFC with the trade name of the UV-Flo.
- The drug was mixed into fish food, drug content of 20 mg/kg weight of the fish. Feeding on demand. The experiment includes 7 treatments, each treatment was arranged 30 fish, repeated 3 times.
- Fish in treatments 1, 2, 3, 4 are infected the first day and the third day provides food mix with antibiotics. Feeding continuously for 5 days. Treatment 1 use DO material, treatment 2 uses DO product; treatment 3 use FFC material and treatment 4use FFC product. - Treatment 5: Control 1: Fish are infect the first day and food do not mix antibiotic. - Treatment 6: Control 2: Fish are injected saline and food do not mix antibiotic.
7
- Treatment 7: Control 3: Fish are not infected bacteria, not saline,
feeding not mix antibiotic. - Subscribe
to daily mortality, recorded and photographed pathological signs outside and inside. End of an experiment conducted to collect bacteria samples, histology (3 fish/treatment). - The effectiveness of the treatment in the lab was evaluated by the relative survival rate (RPS%) according to the formula (Ellis, 1996): % mortality in medicine group 1- % mortality in control group x 100
RPS (%) = 4. Methods of data analysis Thesis data aggregated and processed using Microsoft Excel, SPSS statistical version 20. The result sequencing of 16S gene segments was compared using the program Blast search on the database of NCBI gene bank online. The thesis is presented in Microsoft Word.
Chapter 4. RESULTS AND DISCUSSIONS 4.1 The isolation and identification bacteria cause hemorrhagic disease in mudskipper
The experience (year) 1 2 3 4 5 6 7
Farmers 8 21 18 18 12 11 2
Rate (%) 8,9 23,3 20 20 13,3 12,2 2,3
4.1.1 The situation of culture and diseases in mudskipper 4.1.1.1 The experience of mudskipper farmers The households are surveyed, they have the experience concentrate 2 years (23.3%) and 3, 4 years (20%) (Table 4.1) Table 4.1 The experience of mudskipper farmers
4.1.1.2 Farming area Popular culture area from 1000-5000 m2 (34.5%). The number of farms with large area fairly high percentage shows farmers tends to expand farming area (Table 4.2). Table 4.2 Farming areas
Farming area (m2) ≤ 5.000 ≤ 10.000 ≤ 15.000 ≤ 20.000 > 20.000
Farmers 31 25 12 11 11
Rate (%) 34,5 27,8 13,3 12,2 12,2
8
The step of arrangement pond
Drying pond
Liming
Fertilizer
To kill other fish
Sterilize
Pure water
Yes No Yes No Yes No Yes No Yes No Yes No
Farmers 78 12 64 26 7 83 55 35 45 45 15 75
Rate (%) 86,67 23,33 71,11 28,89 7,78 92,22 61,11 38,89 50 50 16,67 83,33
4.1.1.3 Crop and time Crop started from June to February, March. 4.1.1.4 Fishing techniques a. The process of arrangement and improvement pond Most households improve pond by dried (86.7%), the remaining let some of the water in the pond and conduct liming (13.3%) (Table 4.3) Table 4.3 The step of improvement pond
b. The source of breeding and stocking density Mudskipper juvenile source depends on the wild resources. Stocking density of 50 - 200 fish/m2, the majority of households in stocking density from 100-150 fish/m2 (82.2%) (Table 4.4).
Farmers 5 74 11
Rate (%) 5,56 82,22 12,22
Table 4.4 Stocking density Stocking density (fish/m2) < 100 100 - 150 > 150
c. Food and feeding Frequency of feeding ranged from 2-5 times/day. There are 56.7% of surveyed households feeding 2 times/day in the morning and afternoon. The weight of food to feed depends on the needs of fish, households should have a continuous feeding of the day (each separated by 2 or 3 hours) (8.89%) (Figure 4.1)
Figure 4.1. Frequency of feeding d. Management of water quality in the pond
9
All (100%) mudskipper farmers interviewed do not use a settling pond system, farmers do not change the water, they just add water (96.7%), chemical processing and microbiology for improving environmental water in the pond.
e. Fish health management Using antibiotics to prevent disease of fish by mixing food and antibiotic to feed during the culture period, the most of the farms use amoxicillin (81.1%), the remaining use other antibiotics (Figure 4.2)
Figure 4.2. Using antibiotic in mudskipper farmer in BacLieu
4.1.1.5 The situation of the disease in mudskipper farmer Disease of fish concentrate in 2 months old and hemorrhagic disease (78.9%), ulceration (50%), liver hemorrhage (25,6%) (Figure 4.3)
Figure 4.2 Percentage of disease in the mudskipper culture
Farmers 25 35 17 12 1
Rate (%) 27,78 38,89 18,89 13,33 1,11
The average mortality rate is 18,04±12,17 (%) (Table 4.5). Table 4.5. The mortality rate The mortality rate (%) ≤ 10 10 – 20 20 – 30 ≥30 Unknown
The survey results showed that most of the fish die concentrate 10% - 20% (38.9%), but the mortality is over 30% also relatively high proportion, accounting for 13.33%. Antibiotics are mixed into fish feed periodically. There are 81.1% of surveyed households chose amoxicillin mixed into food (2-4 g/kg feed). When fish diseased, they increase the dose (3-5 g/kg feed) fed continuously for 3-5 days.
10
Skin
Gill
Parasites
The intensity (Parasites /lame) 8 8 2
The rate (%) 27,24 33,33 20
The intensity (Parasites /lame) 6 2
The rate (%) 33,81 20
Chilodonella Epistylis Trichodina Ergasilus There are 04 species of parasites were found with morphology, structure matching the description of Ky Ha and Bui Quang Te (2007) which is Chilodonella, Epistylis, Trichodina and Ergasilus. The parasite species in the fish with susceptibility intensity (2-8 parasites/lame) and very low infection rate (20% - 33.81%). With these results demonstrate the presence of parasites do not affect fish health.
4.1.2 The results parasites test on mudskipper The result parasites showed parasite species appear less, mostly parasites of ectoparasites (Table 4.6) Table 4.6 The intensity and rate of infection parasites on mudskipper
4.1.3 The isolation of bacteria on mudskipper hemorrhagic
Time
Total
1
2
3
4
5
6
Organs
13 15 6 34
13 17 12 42
27 23 36 86
26 30 6 62
11 0 0 11
6 5 6 17
Quantity 96 90 66 252
Rate (%) 38,1 35,7 26,2 100
disease 4.1.3.1 The result of isolated bacteria The results were obtained isolated is 252 colonies, the most of the colonies in the kidneys of fish with 38.1% (Table 4.7) Table 4.7 The number of bacteria
Kidney Liver Spleen Total 4.1.3.2 Morphology, physiology and biochemistry The bacteria are circling, white, size from 0,4 to 0,8 µm/colonies,
Gram (+), spherical, diplococcus and streptococcus (Figure 4.4).
Figure 4.4 Morphology of bacteria Gram (+) Streptococcus (100X)
In 252 strains have 249 strains that are spherical, Gram (+), no mobile, most oxidase negative (231/249 strains) and catalase negative 11
(174/249 strains). The results showed that 15/15 strains do not cause hemolysis, 15/15 strains do not grow in TSB (+ 6.5% NaCl) (Figure 4.5).
Figure 4.5 The results hemolytic and development in TSB (+6,5%NaCl)
A: The bacteria do not cause hemolysis on 5% sheep blood B: The bacteria do not grow in TSB (+6,5%NaCl) 4.1.3.3 The results identified by API 20 Strep kit The results showed that the strain identification 100% positive with Alkaline phosphatase, Leucine aminopeptidase, Ribose, Trehalose, mostly positive with Amygdalin (90.6%), Arginine Dihydrolase (93.7%), β- glucuronidase (93.7%). And negative with the remaining (Figure 4.6)
Table 4.8 The result compare the degree of sequence homology with the
strains of bacteria in the data bank of the NCBI
No
Notation
Code in the NCBI
The bacteria in the NCBI
1 2 3 4 5 6 7 8 9 10
B1-6T B2-5G B6-9TT B2-3TT A1F1 A1F2 A1F4 A1F6 A1F9 A5F4
S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae S. dysgalactiae
KM077497.1 KM077497.1 KM077497.1 KM077497.1 NR043661.1 NR043661.1 NR043661.1 HE858529.1 NR043661.1 NR043661.1
The degree of homology 99% 100% 99% 99% 99% 98% 99% 99% 99% 97%
Rate nucleotide homology 1003/1004 1005/1005 996/997 971/972 618/624 537/546 608/612 597/602 573/575 336/345
(http://blast.ncbi.nlm.nih.gov/Blast.cgi)
Figure 4.6 The result test API 20Strep with B1-6T and B2-5G bacteria 4.1.4 The results bacterial identification by sequencing method Bacteria after decoding conducted comparisons with the data of the NCBI, based on the degree of sequence homology 16S rRNA gene fragment showed that all 10 strains of bacteria are coincident with bacteria strains identified as S. dysgalactiae. (Table 4.8)
4.2 Determination of causative agent of hemorrhagic disease in mudskipper 4.2.1 Pathological hemorrhage on mudskipper
12
4.2.1.1 Pathological Muskipper was hemorrhagic disease, they have signs of abnormality as lethargic swimming, pouring edge, not eating, not react or react very slowly. Pathological of hemorrhage fish as pale color, bleeding in the body, in fine, tumors in the body, opaque and bulging eyes. (Figure 4.7).
(A) Mudskipper swim lethargically; (B) & (C): Mudskipper hemorrhagic on the fins and body
Figure 4.7. Pathological on the body of mudskipper hemorrhagic disease
Viscera of fish wounded, hemorrhage or pale liver, spleen swelled or shrunk and bled, kidney hemorrhage and mushy (Figure 4.8).
Figure 4.8. Pathological viscera of mudskipper hemorrhagic disease (A) Fish health. (B) Spleen swelling and hemorrhage. (C) Liver swelling and hemorrhage. (D) Liver hemorrhage, spleen swelling, kidney mushy.
4.2.1.2 The results of fresh sample template kidney It was observed that the bacteria attack broke the erythrocyte membrane, concentrated around the wall of red blood cells (Figure 4.9).
Figure 4.9. The sample template fresh kidney (Wright & Giemsa, 100X) (A): Kidney of fish health. (B): bacteria clustered; (C): Macrophage. (D): bacteria attack broke the erythrocyte membrane On the fish health have few or no bacteria when observes sample kidney on a microscope.
4.2.2 Histopathological hemorrhage on mudskipper 4.2.2.1 Gill The results showed that 127/127 gill samples of
the fish hemorrhagic disease have swelled and adhered fiber fill. Gill bled, the fibers adhered and lost the structure of gill, fiber shorten or degenerated, arterial bleed and infected bacteria. (Figure 4.10)
13
Figure 4.10 Histopathological gills of mudskipper (H&E, 40X) (A) Gill of fish health: Fiber gills (), lamella gills (); (B) The swell of lamella gills (), the artery infected bacteria (); (C) the fibers adhered and lost the structure of the gill (), the cell increase size (). (D) Gills lost the structure 4.2.2.2 Kidney It was observed that mainly hemorrhage, congestive at capillaries and veins, tubular intraluminal fibrosis and dilated, glomerular enlarged, structural changes, and necrosis. The phenomenon of congestion in kidney of fish was recorded in most of the samples, phenomena hemorrhage and necrosis or liquefaction necrosis are also found in samples of the kidney fish disease (Figure 4.11).
Hình 4.11 Histopathological kidneys of mudskipper (H&E, 40X) (A): the kidney of fish health, tubule (); (B) congested (), macrophage (); (C): Necrosis (); (D): infected bacteria (); (E): glomerular enlarged and structural changes () (100X); (F): congested (), glomerular enlarged and structural changes ()
4.2.2.3 Liver The results showed that liver infected bacteria (Figure 4.12E), hepatic, venous congestion (Figure 4.12C), lipid vacuoles enlarged, liver change structure (Figure 4.12E & F). Necrosis liver nearly liquefied, congested areas change into inflamed (Figure 4.12B & D).
14
Hình 4.11 Histopathological livers of mudskipper (H&E, 40X) (A): the liver of fish health, hepatic veins (), lipid vacuoles lipid (); (B) inflammation fluid (); (C): venous liver congestion (); (D) liver cells congested (); (E): liver infected bacteria (), lipid vacuoles enlarged (),change structure (); (F): Liver cells change structure ()
4.2.3 Hematological hemorrhage on mudskipper 4.2.3.1 Morphological cell Red blood cells (RBC) of mudskipper are oval or elliptical and the nucleus in the middle. Four types of leukemia have been found including lymphocytes, monocytes, neutrocytes and platelets (Figure 4.13)
Figure 4.13 The shape blood cells of mudskipper (100X) (A): RBC (); (B): platelet (); (C): monocyte (), platelet (), neutrocyte (), lymphocyte (); (D): monocyte () The sample of blood, fish appears clusters of bacteria and change shape (Figure 4.14).
Figure 4.14 The blood of mudskipper disease (100X) (A): Bacteria attact RBC (), (B): Bacteria attact membrane cells ()create space in the cytoplasm ()
15
The bacteria attack red blood cells are broken, the cytoplasmic appear more vacuoles or no cytoplasm. Besides, all kinds of leukocytes change shape and find four types of leukocytes.
4.2.3.2 Red blood cell The number of red blood cells are from 6.8 x 106 CFU/ml to 28.6 x 106 CFU/ml, there is a difference between healthy and hemorrhage fish, erythrocyte of fish disease decreased than fish health, difference statistically significant (P <0.05) (Table 4.9). Table 4.9 Compare hemoglobin density in healthy and diseased fish
Pond
Hemoglobin density (cell x 106/ml)
Fish health
Fish disease
Pond 4 Pond 5 Pond 8 Pond 1 Pond 2 Pond 3 Pond 6 Pond 7 Pond 9 Pond 10 Pond 11
21,45 ± 2,79b 19,49 ± 0,56b 19,80 ± 0,37b 17,06 ± 4,49ab 14,89 ± 1,57a 16,99 ± 3,04ab 14,42 ± 1,74a 12,73 ± 3,21a 13,16 ± 2,93a 14,23 ± 1,92a 16,23 ± 3,61a
With each column, values followed by different superscript letters are significantly different (P<0,05)
4.2.3.3 Leukocytes It has four types of leukocytes include lymphocytes, monocytes, neutrocytes and platelets (Figure 4.15)
Figure 4.15 Leukocytes (A): platelets (); (B): neutrocytes (); (C): monocytes (), lymphocytes ()
a. The total of leukocytes The number of leukocytes in the blood of fish is from 290000- 990000 cells/ml. For healthy fish with total leukocytes average 34.2 x 104 cells/ml lower than total leukocyte of fish hemorrhagic disease average 81.8 x 104 cells/ml. The number of leukocytes of fish hemorrhagic disease compared with fish health different statistical significant (P <0.05) (Table 4.10).
16
Table 4.10 Leukocytes density in blood of healthy and diseased fish
Pond
Fish health
Fish disease
Pond 4 Pond 5 Pond 8 Pond 1 Pond 2 Pond 3 Pond 6 Pond 7 Pond 9 Pond 10 Pond 11
Leukocytes density (cell x 104/ml) 45,8 ± 8,97c 50,25 ± 6,27c 34,28 ± 5,05d 82,5 ± 7,25ae 73,4 ± 11,64b 76,7 ± 9,09ab 82,9 ± 5,93ae 84,9 ± 6,33e 85,42 ± 5,74e 84,4 ± 6,39e 85,5 ± 7,42e
With each column, values followed by different superscript letters are significantly different (P<0,05)
Pond
Neutrocytes
Lymphocytes
Fish health
Fish disease
Leukocytes density (cell x 104/ml) Platelets 15,98 ± 3,47b 14,61 ± 2,32b 11,25 ± 1,21ab 17,32 ± 7,94ab 12,85 ± 4,13ab 13,50 ± 6,73ab 16,62 ± 4,52b 9,81 ± 1,65a 11,04 ± 1,12a 11,09 ± 4,08ab 14,50 ± 5,96ab
Monocytes 6,18 ± 2,66cd 8,21 ± 4,61abcd 3,16 ± 1,07d 13,25 ± 4,53a 8,94 ± 6,35abcd 9,84 ± 7,05abcd 15,29 ± 5,26a 12,06 ± 2,75a 10,79 ± 2,97ac 8,80 ± 2,98ac 10,43 ± 3,92ac
12,40 ± 8,51a 19,61 ± 7,06ac 16,58 ± 2,43a 15,66 ± 6,90a 23,88 ± 14,87ab 34,28 ± 10,91bc 23,23 ± 7,58ad 32,47 ± 5,37bd 40,44 ± 5,75b 39,60 ± 6,46b 36,15 ± 6,46b
4 5 8 1 2 3 6 7 9 10 11
11,23 ± 6,11bc 7,80 ± 4,38b 3,28 ± 2,31b 36,27 ± 5,22a 27,7 ± 13,35acd 19,07 ± 11,88bd 27,74 ± 7,12ad 30,54 ± 6,43ad 23,14 ± 6,34cd 24,89 ± 6,53d 24,39 ± 11,86d With each column, values followed by different superscript letters are significantly different (P<0,05)
b. Monocyte The quantitative results showed that monocytes of mudskippers are from 10.800-211.500 cells/ml. The number of monocytes of fish disease compared with fish health difference statistical significance (P <0.05) (Table 4.11). Table 4.11 The results compare leukocytes between fish health and fish hemorrhage disease.
c. Neutrocyte The results of the analysis, neutrophil density of mudskippers are 0,61 x 104 cells/ml to 54 x 104 cells/ml. The number of neutrocytes in the healthy fish pond compared with the fish hemorrhagic disease pond difference statistically significant (P <0.05) (Table 4.11).
d. Lymphocyte Lymphocytes density is from, 2 x 104 to 47,5 x 104 cells/ml. Lymphocytes of the healthy fish pond compared with the fish hemorrhagic disease difference statistically significant (P <0.05) (Table 4.11).
17
e. Platelet Pond 4 and 5 compare with pond 7 and 9, it is difference statistically significant (P <0.05) (Table 4.11). In the pond has fish health, lymphocytes density lower than the pond has fish disease.
4.3 Diagnosis hemorrhagic disease in mudskipper by PCR 4.3.1 DNA extracted directly from the kidney of mudskipper The results extracting and measuring DNA from 16 samples of kidney showed that the purity of DNA is 1,57 to 1,78 and the content of the DNA of kidney about 1.675-3.385 ng/µl.
4.3.2 DNA bacteria The DNA bacteria is 2.765 - 4.855 ng/µl and purity is 1,7 - 2 ng/µl. 4.3.3 The primer for PCR detection of Streptococcus dysgalactiae When using the primer STRD-DyI/dys-16S–23S-2, PCR product is positive with a size of 259 bp (Figure 4.16).
Figure 4.16 PCR detect S. dysgalactiae using primers STRD-DyI/dys-16S–23S-2
(M): DNA ladder; 1: B1-6T; (+): positive control (B2-5G); (-): negative control 4.3.4 The specificity and sensitivity of PCR detect S. dysgalactiae 4.3.4.1 The specificity of PCR detect S. dysgalactiae PCR products of S. dysgalactiae with a size of 259 bp, no reaction of
the other bacteria (Figure 4.17)
Figure 4.17 The specificity of PCR detect S. dysgalactiae (M): DNA ladder, (1): Vibrio parahaemolyticus; (2): Streptococcus dysgalactiae; (3): Edwardsiella ictaluri; (4): Aeromonas hydrophilla; (5): Streptococcus agalactiae; (6): Flavobacterium columnare
4.3.4. The sensitivity of PCR detects S. dysgalactiae PCR detects S. dysgalactiae when the sample PCR has 50 ng DNA S. dysgalactiae/0.5g DNA of kidney of mudskipper (Figure 4.18)
18
Figure 4.18 The sensitivity of PCR detect S. dysgalactiae (M): DNA ladder, (1): 25 ng; (2): 50 ng, (3): 100 ng, (4): 200 ng, (5): 400 ng, (6): 800 ng, (7): 1.600 ng, (8): 3.200 ng
4.3.5 The applicability of PCR detect S. dysgalactiae 4.3.5.1 The applicability of PCR detect S. dysgalactiae from the bacteria isolated from mudskipper disease The result showed that 10/10 samples (100%) sensitive with primers STRD-DyI/ dys-16S–23S-2 with a size of 259 bp (Figure 4.19).
Hình 4.19 PCR products with 10 sample bacteria M: DNA ladder; (+): positive control (B2-5G); (1): A1F1-T; (2): A2F3-G; (3): B3K1F2-T; (4): B1K2F1-G; (5): B3F2-T; (6): F7-T; (7): B1-10TT; (8): B5-8T; (9): B4-6G; (10): B5-3T; (-): negative control. 4.3.5.2 The applicability of PCR detect S. dysgalactiae from mudskipper kidney disease The amplification products specific for S. dysgalactiae with a size 259 bp does not appear in the sample DNA of kidney fish (Figure 4.20).
Figure 4.20 PCR product with 10 sample kidney mudskipper M: DNA ladder; (-): negative control; (1, 2, 3, 4, 5, 6, 7, 8, 9, 10): kidney mudskipper; (+): positive control
PCR diagnostic can not to detect directly S. dysgalactiae from kidney mudskipper. In some results of research of Nomoto et al. (2004), Nomoto et al. (2008) and Abdelsalam et al. (2009) use to directly bacterial DNA isolated, no research has been detected S. dysgalactiae direct from kidney of fish.
19
4.4 The result of the experiment treat hemorrhagic in the laboratory
4.4.1 The antimicrobial susceptibility and determine the minimum inhibitory concentration (MIC) of antibiotics on bacteria cause hemorrhagic disease in mudskipper
4.4.1.1 The result of the antimicrobial susceptibility The results showed that 8/12 antibiotics were susceptible with four strains bacteria was surveyed. Four antibiotics have high sensitivity include FFC, DO, TE and SXT with the rate of 75%. However FFC, TE and SXT were resisted with the rate was 25%, DO does not have resistant with four strains survey.
The result of MIC (ppm)
Bacteria
MIC interpretive criteria CLSI, 2012 (M100-S22)
B1.6T B6.9TT B2.5G B2.3TT
Antibiotics AML FFC DO
256 4 4
256 4 8
128 4 4
128 4 4
S ≤ 8 ≤ 2 ≤ 4
R ≥ 32 ≥ 8 ≥ 16
4.4.1.2 The result of MIC The results showed that two strains B1-6T and B6-9TT resist AML (256 ppm), B1-6T resist FFC (4 ppm), DO with concentrations is 4 ppm inhibited bacteria (Table 4.12). Table 4.12 The result of MIC
Notes: S: susceptibility; I: inhibility; R: resistibility 4.4.2 The result of the experiment infection The highest mortality of the strain B2-5G was 86.7%; the mortality of strain B1-6T was 76.7%; both of strain B2-3TT and B6-9TT were 73.3%; (Table 4.13 and Figure 4:21). Table 4.13: The mortality rate of 4 strains had been infected with S. dysgalactiae
No 1 2 3 4 5
Symbol bacteria B1-6T B2-3TT B2-5G B6-9TT Control
Mortality rate (%) 76,7 73,3 86,7 73,3 13,3
Figure 4.21 The result of the experiment infection 20
Bacteria
B1-6T
Death rate (%) B2-5G
Control
Bacterial density (CFU/ml)
11,67
38,3 48,3 50 73,3 78,3 81,7 90 4,25 x 104
48,3 58,3 63,3 71,7 75 81,7 88,3 3,5 x 103,17
102 103 104 105 106 107 108 LD50
4.4.3 The result of determining LD50 The bacteria have been signed B1-6T caused the lowest death rate (38.3%) with bacterial density was 4.25 x 102 CFU/ml and caused the highest death rate (88.3%) with bacterial density 4.25 x 108 CFU/ml. Similarly, the bacteria have been signed B2-5G, the lowest death rate in bacterial density of 3.5 x 102 CFU/ml was 48.3% and 3.5 x 108 CFU/ml was 90% (Table 4.14 and Figure 4.22). Table 4.14 The result of determining death rates of B1-6T và B2-5G
The result of determining LD50 of the bacteria has been signed B1-6T was LD50 = 4,25 x 104 CFU/ml and B2-5G = 3,5 x 103,71CFU/ml.
Figure 4.22 The result of determined LD50 4.4.4 The result of the experiment treat hemorrhagic in the laboratory
The results showed that fish started dying from day 3rd after was infected, to 13th day mudskippers stopped dead and survival rates of the treatments respectively 65,56%; 71,11%; 67,78% and 70%. Meanwhile, in the control treatment 6 and 7 had survival rate was 96,67% and 97,78% (Figure 4.23). Value RPS (%) is defined respectively 45,27%, 61,16%; 56,72% and 59,7%.
21
Figure 4.23: The survival rate in experiment treat hemorrhagic in laboratory NT1: DO material; NT2: DO; NT3: FFC material; NT4: FFC; NT5: control 1, muskipper was injected S. dysgalactiae, no use antibiotics; NT6: Control 2, muskipper was injected saline and no use antibiotics; NT7: Control 3: fish health, no inject and no use antibiotics. When compare the survival rate of fish in all treatments showed that differences statistically treatments (Table 4.15). Table 4.15: Survival rate (%) in the experiment treats hemorrhagic
No 1 2 3 4 5 6 7
The experiment NT1 NT2 NT3 NT4 NT5 NT6 NT7
Survival rate (%) 65,56 ± 1,93a 71,11 ± 1,93b 67,78 ± 1,93ab 70 ± 3,33b 25,55 ± 3,85c 96,67 ± 0,00d 97,78 ± 1,93d
With each column, values followed by different superscript letters are significantly different (P<0,05)
The results in Table 4.15 showed that, for mudskipper are causing the infection, the survival rate of fish in fish treatments did not use antibiotics difference statistical significance (P <0,05) with fish was fed antibiotics, confirm that the effect of antibiotics in the treatment of hemorrhagic disease in mudskipper. In laboratory conditions, FFC and DO treated success hemorrhage disease in mudskipper.
Chapter 5. CONCLUSIONS AND RECOMMENDATIONS 5.1 Conclusions - Mudskipper was a disease when the fish reached 2 months of age. Some disease in mudskipper is hemorrhage (78.89%), ulcer (50%), abdominal distension (50%), liver disease (25.56%). Amoxicillin was the most popular used antibiotic for disease prevention and treatment.
- Streptococcus dysgalactiae is agent that cause hemorrhagic disease in mudskipper. Characteristic pathological is bleeding fish on the body fin; liver, kidneys and spleen swelling and bleeding.
22
- Histology of liver, gill and kidney of fish disease change structure, congestion and necrosis.
- Red blood cells in fish disease decrease when compared to fish health. However, all types of leukocytes in the fish disease increase when compare to fish health. - Using primers STRD-DyI/dys-16S-23S-2 detected has Streptococcus dysgalactiae, it causes hemorrhagic disease in mudskipper. - The result LD50 of B1-6T and B2-5G with value is 4,25 x 104 CFU/ml and 3,5 x 103,17 CFU/ml.
- S. dysgalactiae is susceptible with FFC, DO and resistance with AML and AMP. The minimum inhibitory concentration (MIC) of the AML is 128 ppm - 256 ppm and FFC is 4 ppm.
- The results of the experiment treat hemorrhagic in the laboratory use DO and FFC has a high survival rate, survival rate from 65,56% to 71,11%. Value RPS (%) is from 45.27% to 61.16%.
5.2 Recommendations - Research standardized diagnostics detect Streptococcus dysgalactiae directly on fish samples. - Continue research on treatment mudskipper in the pond.
23
PUBLISHED PAPERS OF THE AUTHOR 1. Nguyen Thu Dung và Đang Thi Hoang Oanh, 2013. The situation of disease management in midskipper (Pseudapocryptes lanceolatus) in Bac Lieu province. Journal of Science, Can Tho University, No 27: 169-177 (in Vietnamese).
2. Nguyen Thu Dung và Đang Thi Hoang Oanh, 2015. Determination of the causative agent of hemorrhagic disease in mudskipper (Pseudapocryptes elongatus) cultured in the Mekong Delta. Viet Nam Journal of Agriculture and Rural Development, No 16: 109-116 (in Vietnamese).
