intTypePromotion=1
ADSENSE

Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam

Chia sẻ: ViBandar2711 ViBandar2711 | Ngày: | Loại File: PDF | Số trang:9

30
lượt xem
0
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Avian Metapneumovirus (aMPV) là một trong những nguyên nhân gây hội chứng sưng phù đầu ở gà. Mục tiêu của nghiên cứu này nhằm khẳng định sự có mặt của aMPV tại một số tỉnh miền Bắc Việt Nam. Bằng kỹ thuật ELISA và RT-PCR đã phát hiện được kháng thể kháng aMPV và virus trong đàn gà.

Chủ đề:
Lưu

Nội dung Text: Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam

  1. Vietnam J. Agri. Sci. 2020, Vol. 18, No. 7: 520-528 Tạp chí Khoa học Nông nghiệp Việt Nam 2020, 18(7): 520-528 www.vnua.edu.vn NGHIÊN CỨU SỰ LƯU HÀNH CỦA AVIAN METAPNEUMOVIRUS (aMPV) Ở GÀ NUÔI TẠI MỘT SỐ TỈNH MIỀN BẮC VIỆT NAM Cao Thị Bích Phượng1*, Lê Bá Hiệp2, Huỳnh Thị Mỹ Lệ1, Nguyễn Văn Giáp1 1 Khoa Thú y, Học viện Nông nghiệp Việt Nam 2 Công ty Cổ phần Thú y Xanh - Greenvet * Tác giả liên hệ: phuong.caotb@gmail.com Ngày nhận bài: 18.05.2020 Ngày chấp nhận đăng: 24.06.2020 TÓM TẮT Avian Metapneumovirus (aMPV) là một trong những nguyên nhân gây hội chứng sưng phù đầu ở gà. Mục tiêu của nghiên cứu này nhằm khẳng định sự có mặt của aMPV tại một số tỉnh miền Bắc Việt Nam. Bằng kỹ thuật ELISA và RT-PCR đã phát hiện được kháng thể kháng aMPV và virus trong đàn gà. Kết quả kiểm tra 85 gà từ 5-12 tuần tuổi chưa tiêm phòng vacxin aMPV cho thấy có lưu hành kháng thể aMPV cao (25,88%). Kết quả RT-PCR chỉ phát hiện 3/85 mẫu dương tính với aMPV (3,53%). Các kết quả tìm hiểu về triệu chứng và bệnh tích cho thấy gà nhiễm aMPV có biểu hiện tập trung ở đường hô hấp trên. Biểu hiện sưng phù xung quanh mắt là thường gặp nhất. Kết quả của nghiên cứu là cơ sở cho công tác chẩn đoán bệnh, khuyến cáo người chăn nuôi sử dụng vacxin phòng bệnh phù hợp để hạn chế thiệt hại kinh tế do aMPV. Từ khóa: ELISA, RT-PCR, avian pneumovirus aMPV, Việt Nam. Prevalence of Avian Metapneumovirus (aMPV) in Chickens in some Northern Provinces of Vietnam ABSTRACT Avian Metapneumovirus (aMPV) is one of the etiological agents of the swollen head syndrome (SHS) in chickens. The aim of this study was to confirm the presence of aMPV in some northern provinces of Vietnam. By using ELISA and RT-PCR techniques, the study detected molecular and serology of aMPV in chickens. A result of testing 85 chickens aged from 5 to 12 weeks without aMPV vaccination showed that 22 chickens (25.88%) had aMPV antibody. In contrast, out of 85 swab samples tested only 3 (3.53%) were positive to aMPV by RT-PCR. Clinical signs and gross pathology indicate that chickens suspected to be infected with aMPV are concentrated in the upper respiratory tract. Swelling of the periorbital and infraorbital is the most common. The research result is providing a scientific basis for diagnosing and recommending to use proper vaccines to reduce the economic losses due to aMPV. Keywords: ELISA, RT-PCR, avian pneumovirus aMPV, Vietnam. truyền nhiễm (Infectious Laryngotracheitis - 1. ĐẶT VẤN ĐỀ ILT), viêm phế quân truyền nhiễm (Infectious Bệnh về đþąng hô hçp thþąng gây thiệt häi Bronchitis - IB), viêm đþąng hô hçp män tính kinh tế đáng kể cho ngành chën nuôi gà do làm (Chronic Respiratory Disease - CRD), giâm sĀc đề kháng, giâm sinh trþćng và nëng Ornithobacterium rhinotracheale (ORT), sổ müi suçt thðt trĀng, tëng tỷ lệ tā vong (Sid & cs., truyền nhiễm (Infectious Coryza - IC)… đã cò 2015; Furian & cs., 2018). Một số nguyên nhân nhiều nghiên cĀu đề cêp (Đào Thð Hâo, 2008; gây bệnh đþąng hô hçp ć gia cæm nhþ cúm gia Nguyễn Thð Lan & cs., 2016; Nguyễn Thð Loan cæm, Newcastle disease, viêm thanh khí quân & cs., 2016). 520
  2. Cao Thị Bích Phượng, Lê Bá Hiệp, Huỳnh Thị Mỹ Lệ, Nguyễn Văn Giáp Trong nhĂng nëm gæn đåy, vçn đề nổi cộm - Sinh phèm, hóa chçt dùng cho phân Āng trong nhóm bệnh hô hçp phĀc hợp ć gà là hội RT- PCR: (i) TRIzol™ Reagent (15596026, chĀng sþng phù đæu (Swollen Head Syndrome - Invitrogen); Chloroform (102445, Merck SHS) do avian metapneumovirus (aMPV) gây Millipore); 2-propanol (109634, Merck Millipore); ra. Bệnh còn có tên gọi khác là Turkey Ethanol 75%; nþĆc 3D (Deionized Double rhinotraccheitis (TRT), avian pneumovirus Distilled Water); (ii) Random hexamers (APV), avian rhinotracheitis (ART) (Jones & (N8080127, Invitrogen); kit M-MLV Reverse Rautenschlein, 2013). Đþợc phát hiện læn đæu Transcriptase (28025013, Invitrogen); (iii) Kit tiên vào nhĂng nëm 1970 ć Nam Phi (Buys & MaximeTM PCR PreMix (i-Taq) (25025, iNtRON cs., 1980) và nhĂng nëm gæn đåy, báo cáo về hội Biotechnology, Hàn Quốc); (iv) Dung dðch nhuộm chĀng sþng phù đæu gà tëng nhanh ć nhiều RedsafeTM Nucleic Acid Staining Solution (21141, quốc gia trên thế giĆi nhþ Hy Läp (Tucciarone & iNtRON Biotechnology, Hàn Quốc); cặp mồi đặc cs., 2017), Ethiopia (Hutton & cs., 2017), Ai Cêp hiệu gen G (kích thþĆc 448bp) cûa virus theo (Abdelmoez & cs., 2019)… nghiên cĀu đã công bố (Bayon-Auboyer & cs., aMPV là virus thuộc họ Paramyxoviridae, họ 2000) vĆi thông tin ć bâng 1. phý Pneumoviridae, giống Metapneumovirus. Đåy là virus có ARN sợi đĄn åm, không phån 2.2. Nội dung nghiên cứu đoän vĆi hệ gen dài khoâng 14kb, có vó bọc ngoài - Nghiên cĀu să lþu hành kháng thể kháng (Cook & cs., 1993). Virus gây nhiễm trùng đþąng aMPV ć gà nuôi täi một số tînh miền Bíc hô hçp trên ć diện rộng đối vĆi gà tây, gà và một Việt Nam. số loài chim khác. MĀc độ nghiêm trọng cûa các - Phát hiện aMPV trong méu bệnh phèm dçu hiệu lâm sàng bð ânh hþćng phæn lĆn bći să bìng phân Āng RT-PCR. kế phát cûa mæm bệnh thĀ cçp (Jones & cs., 1988; Cook & Cavanagh, 2002). Hội chĀng sþng - Nghiên cĀu triệu chĀng bệnh tích cûa gà phù đæu có thể xây ra ć gà mọi lĀa tuổi, đặc míc bệnh sþng phù đæu do aMPV gây ra. trþng bći hiện tþợng sþng các mô quanh hốc mít và xoang đæu mặt, trẹo cổ, mçt phþĄng hþĆng 2.3. Phương pháp nghiên cứu (Morley & Thomson, 1984). Bệnh không chî làm 2.3.1. Thu thập mẫu giâm nëng suçt ć gà thðt mà còn làm giâm sân Méu nghiên cĀu đþợc lçy ngéu nhiên tÿ lþợng và chçt lþợng trĀng ć gà đẻ (Cook & nhĂng đàn gà 5-12 tuæn tuổi, chþa đþợc sā dýng Cavanagh, 2002). vacxin phòng bệnh aMPV bao gồm huyết thanh; Theo hiểu biết cûa chúng tôi, cho đến thąi dðch swab đþąng hô hçp trên. VĆi nhĂng gà có điểm này, täi Việt Nam chþa cò báo cáo nào về triệu chĀng sþng phù đæu còn thu thêp thêm hội chĀng sþng phù đæu gà do aMPV gây ra. Vì méu xþĄng ống cuộn müi, khí quân, phổi. Méu vêy, nghiên cĀu này đþợc thăc hiện nhìm đþợc vên chuyển về phòng thí nghiệm để thăc khîng đðnh să hiện diện cûa aMPV ć đàn gà hiện các nghiên cĀu tiếp theo. nuôi täi một số tînh miền Bíc Việt Nam bìng kỹ PhþĄng pháp kiểm tra triệu chĀng lâm thuêt ELISA và RT-PCR. sàng và mổ khám quan sát bệnh tích đäi thể theo Tiêu chuèn Việt Nam mã số TCVN 2. PHƯƠNG PHÁP NGHIÊN CỨU 8402:2010. 2.1. Vật liệu 2.3.2. Kỹ thuật ELISA - Huyết thanh và bệnh phèm tÿ gà thu Qui trình đþợc thăc hiện theo hþĆng dén thêp tÿ nëm 2019 tĆi tháng 02 nëm 2020. cûa nhà sân xuçt, tóm tít gồm các bþĆc sau: (i) - Kit ELISA ID Screen avian pha loãng méu vĆi Dilution Buffer, thêm vào metapneumovirus Indirect 5P (IDVET_MPVS- đïa; (ii) û trong 30 phút ć nhiệt độ phòng, 5P, IDvet). rāa bìng Wash solution; (iii) thêm Conjugate 1X; 521
  3. Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam Bâng 1. Mồi đặc hiệu để phát hiện aMPV Tên mồi Trình tự 5’- 3’ Vị trí nucleotide Ga CCGGGACAAGTATCTCTATGG 2-19 Gy TCTCGCTGACAAATTGGTCCTGA 449-427 (iv) û 30 phút ć nhiệt độ phòng, rāa; (v) thêm chĀng dþĄng là vacxin Nemovac. Thành phæn Substrate Solution; (vi) û 15 phút ć nhiệt độ phân Āng PCR (20µl) đþợc phối trộn theo phòng, chú ý tránh ánh sáng; (vii) thêm Stop hþĆng dén cûa nhà sân xuçt, trong đò: 17µl solution để dÿng phân Āng. Kết quâ đþợc đọc ć nþĆc 3D + 1µl mồi Ga + 1µl mồi Gy + 1µl cDNA bþĆc sóng 450nm. Să có mặt cûa kháng thể méu tách chiết. kháng aMPV trong các méu huyết thanh đþợc Chu trình nhiệt cho phân Āng PCR đþợc xác đðnh bìng độ mêt quang (OD- optical tóm tít nhþ sau: (i) 94C trong 2 phút; (ii) 35 density) trên cĄ sć tính toán tỷ số dþĄng tính chu kì (94C trong 20 giây, 50C trong 30 giây, (S/P). Nếu S/P ≤0,20 đþợc xem là méu âm tính, 72C trong 30 giây); (iii) 72C trong 5 phút. S/P >0,20 đþợc xem là méu dþĄng tính. Sân phèm PCR đþợc phân tích bìng 2.3.3. Phương pháp RT-PCR phþĄng pháp điện di trong thäch agarose 1,5%, có bổ sung dung dðch nhuộm RedsafeTM. a. Tách ARN tổng số ARN đþợc tách chiết bìng TRIzol™ 2.3.4. Phân tích trình tự gen Reagent (theo hþĆng dén cûa nhà sân xuçt) vĆi Sân phèm PCR tinh säch đþợc giâi trình tă các bþĆc chính nhþ sau (i) Giâi phóng ARN theo hai chiều (xuôi và ngþợc) bìng phþĄng bìng cách bổ sung 750µl dung dðch Trizol vào pháp Sanger (thăc hiện täi Công ty 1st BASE, 250µl huyễn dðch méu 10%, đồng nhçt bìng Malaysia). Trình tă nucleotide đþợc phân tích cách vortex; (ii) Tách pha ARN bìng 200µl bìng chþĄng trình BioEdit v7.1.3.0 (Hall, 1999) Chloroform, vortex để đồng nhçt; (iii) tûa ARN trên cĄ sć đối chiếu so sánh (i) GiĂa trình tă thu đþợc ć bþĆc (ii) Bìng 500µl 2-propanol, giĂ nucleotide đþợc giâi trình tă theo chiều xuôi và ć -20C/10 phút; (iv) rāa tûa ARN bìng 1ml chiều ngþợc và (ii) VĆi trình tă gen mã hóa ethanol 75%. Các bþĆc tÿ (ii) đến (iv) đþợc ly protein G tham chiếu. tâm ć điều kiện 12.000 vòng/phút trong 10 phút 2.3.5. Xử lý số liệu ć 4C. Hòa tan tûa ARN bìng 30µl nþĆc 3D và bâo quân ć -70C. Số liệu đþợc tính toán và xā lý qua phæn mềm Microsoft Excel 2016. So sánh các tỷ lệ b. Phương pháp tổng hợp cDNA bìng phþĄng pháp Chi square test (2) sā dýng cDNA đþợc tổng hợp sā dýng bộ Kit M- phæn mềm Minitab 16. MLV Reverse Transcriptase sā dýng mồi Random hexamer theo quy trình cûa nhà sân 2.4. Địa điểm nghiên cứu xuçt nhþ sau: Bộ môn Vi sinh vêt - Truyền nhiễm, Khoa Trộn 10µl ARN vĆi 2µl mồi Random Thú y, Học viện Nông nghiệp Việt Nam. hexamer, ly tâm nhẹ và để trong máy PCR vĆi chu trình nhiệt 70C trong vñng 5 phút, sau đò lçy ra thêm vào 4µl 5X First Strand buffer, 2µl 3. KẾT QUẢ VÀ THẢO LUẬN DDT, 1µl dNTP, 1µl M-MLV RT đồng nhçt méu 3.1. Tỷ lệ lưu hành kháng thể kháng aMPV ở và để trong máy PCR vĆi chu trình nhiệt 37C - gà nuôi tại một số tỉnh miền Bắc Việt Nam 1 gią và 70C - 15 phút. Để phát hiện kháng thể kháng aMPV, nghiên c. Phương pháp PCR cĀu đã khâo sát 85 gà thuộc 7 trang träi täi Gia Phân Āng PCR vĆi cặp mồi Ga/Gy đã đþợc Bình (Bíc Ninh), Läc Thûy (Hña Bình) và Đông tối þu nồng độ mồi và nhiệt độ mồi, sā dýng đối Triều (Quâng Ninh) thu đþợc kết quâ ć bâng 2. 522
  4. Cao Thị Bích Phượng, Lê Bá Hiệp, Huỳnh Thị Mỹ Lệ, Nguyễn Văn Giáp Bâng 2. Lưu hành huyết thanh học của kháng thể kháng aMPV ở một số địa phương Địa phương Tổng số mẫu Số mẫu dương Tỷ lệ (%) Số trại Số trại dương tính Tỷ lệ (%) Đông Triều 36 4 11,11 3 2 66,67 Gia Bình 19 6 31,58 2 2 100,00 Lạc Thủy 30 12 40,00 2 2 100,00 Tổng 85 22 25,88 7 6 85,71 Bâng 2 cho thçy đã phát hiện kháng thể cò kích thþĆc 448bp, đúng vĆi kích thþĆc kháng aMPV trong 22/85 méu huyết thanh gà đã đþợc công bố trþĆc đåy cûa (Mayahi & thu thêp, chiếm 25,88%. Tçt câ các gà khâo sát cs., 2017). đều trên 5 tuæn tuổi và không đþợc tiêm vacxin Vì chþa cò công bố nào về să có mặt cûa phòng bệnh do aMPV gåy ra do đò să có mặt cûa aMPV täi Việt Nam, để khîng đðnh tính đặc kháng thể đặc hiệu ć nhĂng gà này là kết quâ hiệu cûa phân Āng, sân phèm PCR đþợc giâi cûa việc phĄi nhiễm virus trong tă nhiên. Să lþu trình tă gen (Hình 1B). Kết quâ giâi trình tă hành huyết thanh học cûa aMPV cüng đþợc báo gen sân phèm RT- PCR cho các đînh tín hiệu rõ cáo ć nhiều quốc gia trên thế giĆi. Ở ràng. Phân tích trình tă nucleotide thu đþợc kết Bangladesh, tỷ lệ dþĄng tính huyết thanh học quâ tþĄng đồng ~96% vĆi các chûng aMPV trong vĆi kháng thể kháng aMPV trong các đàn gà là ngân hàng gen (Hình 2). Nhþ vêy, phân Āng 53,29% (Ali & cs., 2019), cao hĄn hîn so vĆi báo RT-PCR là đặc hiệu, cò độ tin cêy cao, và có giá cáo cûa nghiên cĀu này. Tuy nhiên, tỷ lệ thu trð chèn đoán. đþợc khá tþĄng đồng vĆi các ghi nhên täi VĆi 85 méu kiểm tra chî có 3 méu dþĄng Jordan (Gharaibeh & Algharaibeh, 2007) và Ai tính vĆi aMPV, chiếm tỷ lệ 3,53%. Kết quâ này Cêp (Nagy & cs., 2018) là 21,7%. phù hợp vĆi công bố cûa Abdelmoez & cs. (2019) Trong khâo sát này đã xác đðnh 6/7 trang cüng chî phát hiện đþợc aMPV trong 12,5% méu träi thu thêp có ít nhçt một méu huyết thanh swab bệnh phèm gà täi Ai Cêp. dþĄng tính (giá trð S/P ≥0,2) vĆi kháng thể Kết quâ RT-PCR có thể giâi thích là do đặc kháng aMPV, tþĄng đþĄng 85,71%. Đặc biệt, ć Gia Bình, Läc Thûy, 2/2 trang träi (100%) điểm bài thâi virus chî xây ra trong thąi gian dþĄng tính huyết thanh học vĆi aMPV trong đò tþĄng đối ngín (3-4 ngày) ć gà nhiễm aMPV tỷ lệ dþĄng tính cá thể khá cao tÿ 31,58-40%. (Cook & cs., 1993; Naylor & cs., 1997; Catelli & Tuy nhiên, hän chế cûa nghiên cĀu này là số cs., 1998). Kết quâ này cüng đã đþợc chĀng lþợng méu thu thêp chþa đû lĆn nên mĀc độ minh bìng gây nhiễm thăc nghiệm aMPV ć gà dþĄng tính huyết thanh học không phân ánh cûa một số tác giâ, chî phát hiện đþợc virus chính xác tỷ lệ lþu hành kháng thể kháng tối đa sau 5 ngày gây nhiễm (Majo & cs., aMPV thăc täi các đða phþĄng. 1995; Htut Aung & cs., 2008; Gharaibeh & Shamoun, 2012). 3.2. Xác định sự có mặt của aMPV ở mẫu bệnh phẩm 3.3. Xác định sự lưu hành của aMPV bằng phân ứng RT-PCR và ELISA Kết quâ huyết thanh học nhþ đã trình bày ć trên chĀng tó có să lþu hành cûa aMPV trong VĆi mỗi gà nghiên cĀu, máu và dðch swab đàn gà. Tuy nhiên, để khîng đðnh chíc chín să hæu họng (hoặc bệnh phèm đþąng hô hçp trên) có mặt cûa virus này, chúng tôi đã sā dýng đồng thąi đþợc lçy để kiểm tra să lþu hành phân Āng RT-PCR. Hình 1A cho thçy có méu kháng thể và să có mặt cûa virus. Kết quâ tổng dþĄng tính vĆi aMPV, sân phèm PCR thu đþợc hợp đþợc trình bày ć hình 3 và bâng 4. 523
  5. Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam Ghi chú: (A) sân phẩm RT- PCR với mẫu bệnh phẩm, đối chứng (+) và đối chứng âm (-), M: Marker (100bp); (B) giân đồ kết quâ giâi trình tự sân phẩm PCR. Hình 1. Kết quâ RT- PCR với mẫu thực địa Ghi chú: Trình tự nucleotide được phân tích bằng phần mềm BLAST, truy cập täi địa chỉ https://blast.ncbi. nlm.nih.gov/Blast.cgi. Hình 2. Kết quâ phân tích tương đồng trình tự nucleotide sân phẩm PCR Bâng 3. Kết quâ tổng hợp phát hiện aMPV bằng phân ứng RT-PCR Địa phương Tổng số mẫu Số mẫu dương tính Tỷ lệ (%) Số trại Số trại dương tính Tỷ lệ (%) Đông Triều 36 2 5,56 3 2 66,67 Gia Bình 19 0 0,00 2 0 0,00 Lạc Thủy 30 1 3,33 2 1 50,00 Tổng 85 3 3,53 7 3 42,86 Bâng 4. Kết quâ tổng hợp phân ứng RT-PCR và ELISA Tình trạng bệnh Số mẫu PCR dương tính Tỷ lệ (%) ELISA dương tính Tỷ lệ (%) Gà có triệu chứng 42 1 2,38 17 40,48 Không có triệu chứng 43 2 4,65 5 11,63 Tổng 85 3 3,53 22 25,88 524
  6. Cao Thị Bích Phượng, Lê Bá Hiệp, Huỳnh Thị Mỹ Lệ, Nguyễn Văn Giáp Hình 3. Tỷ lệ phát hiện mẫu dương tính với aMPV bằng phân ứng ELISA và RT-PCR Nghiên cĀu này khâo sát 85 gà nhþng và âm tính vĆi các mæm bệnh khác (kết quâ không cò gà nào đồng thąi vÿa có mặt virus vÿa không đþợc trình bày) có thể thçy gà thþąng có lþu hành kháng thể kháng aMPV trong cĄ thể. triệu chĀng hô hçp, hít hĄi, há mồm thć (Hình Trong 42 gà có triệu chĀng đþąng hô hçp cüng 4.A.1), hiện tþợng sþng đæu, sþng mít, chây nþĆc chî phát hiện 1 méu dþĄng tính aMPV (3,53%) mít, dính mí mít (Hình 4.A.2-A.6). Chính vì vêy, và tỷ lệ lþu hành huyết thanh học ć nhóm gà làm gà hän chế să đi läi, giâm ën, gà không quá này là 40,48%. Tuy nhiên, 2/3 méu dþĄng tính gæy, trong chuồng thþąng đĀng im một góc, û rü, vĆi virus aMPV đþợc phát hiện ć nhóm gà mệt mói. Theo nghiên cĀu gây bệnh thăc nghiệm không có triệu chĀng lâm sàng. Kết quâ này aMPV ć gà cûa Majo & cs. (1995), nhĂng biểu tþĄng tă vĆi một số báo cáo trên thế giĆi. Hutton hiện hô hçp đþợc quan sát tÿ 3-6 ngày sau gây & cs. (2017) cüng báo cáo să lþu hành huyết nhiễm, xuçt hiện dðch nhæy ć müi, gà thć hổn thanh học aMPV là 21,9% nhþng tçt câ các méu hển, há miệng để thć. Aung (2007) cüng quan sát swab âm tính khi kiểm tra bìng RT-PCR. thçy triệu chĀng hô hçp tÿ ngày thĀ 4 sau gây TþĄng tă Atterby (2012) cüng chî phát hiện 1/66 nhiễm, gà bít đæu û rü, ho, chây nþĆc müi trong. méu có mặt virus trong khi tỷ lệ lþu hành Ngày thĀ 6, đa số gà gây nhiễm đều có biểu hiện kháng thể kháng aMPV trên 85%. sþng xoang hốc mít và ngày 8-9 là sþng căc đäi. Nghiên cĀu cûa Jones & cs. (1988) khîng Ngoài ra không có biểu hiện nþĆc müi đýc. Một đðnh kháng thể đáp Āng sau nhiễm virus kéo số nghiên cĀu khác cüng ghi nhên triệu chĀng dài hĄn và nhĂng gà đã míc bệnh sẽ cho kết đæu tiên cûa hội chĀng sþng phù đæu gà là hít quâ dþĄng tính vĆi ELISA nhþng åm tính vĆi hĄi, sung huyết kết mäc mít, tuyến lệ, sau đò là RT-PCR. HĄn nĂa, khi bệnh đã tiến triển nặng, phù dþĆi da quanh mít (Morley & Thomson, bệnh phèm đã chĀa một lþợng lĆn vi khuèn kế 1984; Kuhne, 2009; Homayounfar & cs., 2015; phát, virus đã bài thâi, không còn tồn täi nĂa. Abdelmoez & cs., 2019). Do vêy, việc phát hiện aMPV bìng phân Āng Tiến hành mổ khám các ca bệnh míc aMPV RT-PCR phý thuộc rçt nhiều vào thąi điểm lçy có thể nhên thçy vùng đæu thþąng có hiện tþợng méu, đặc biệt ć gà có triệu chĀng sþng phù đæu phù, viêm các tổ chĀc xung quanh vùng mít, có trong giai đoän hình thành bã đêu là khò khën dðch rî viêm, bã đêu ć xoang dþĆi mít (Hình (Catelli & cs., 1998). 5.B.2), một số trþąng hợp tích dðch phù câ vùng dþĆi hàm (Hình 5.B.3). Khí quân có dðch nhæy, 3.4. Triệu chứng, bệnh tích của gà mắc aMPV bã đêu lçp kín đþąng hô hçp trên hay phổi Khi quan sát các nhĂng gà dþĄng tính RT- viêm, tích nþĆc cüng quan sát đþợc trong một số PCR hoặc cò lþu hành kháng thể kháng aMPV ca bệnh (Hình 5.B.4- 5.B.5). Sung huyết mí mít 525
  7. Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam dþĆi (Hình 5.B.1) thþąng thçy ć các ca bệnh khi nên khó có thể nhên biết đþợc gà bệnh khi quan gà chþa cò hiện tþợng sþng phù mặt có thể suy sát, đến khi gà có hiện tþợng sþng phù mặt thì ra đåy là giai đoän bít đæu cûa quá trình viêm, bệnh đã trć nên nặng. Ghi chú: A.1. Gà có triệu chứng hô hấp, há mồm thở; A.2. Sưng đầu, dính mí mắt ở gà con; A.3. Dính mí mắt ở gà trưởng thành; A.4-A.6. Mắt sưng, hóa mủ. Hình 4. Triệu chứng gà nhiễm aMPV Ghi chú: B.1. Mí mắt dưới sung huyết; B.2. Gà bị phù vùng mí mắt, bã đậu ở xoang dưới mắt; B.3. Tích dịch phù vùng dưới hàm; B.4. Khí quân chứa bã đậu; B.5. Phổi viêm, tích dịch; B.6. Nội täng phủ fibrin. Hình 5. Bệnh tích của gà mắc aMPV 526
  8. Cao Thị Bích Phượng, Lê Bá Hiệp, Huỳnh Thị Mỹ Lệ, Nguyễn Văn Giáp Abdelmoez & cs. (2019) quan sát bệnh tích kï thuêt sinh học phân tā và phân Āng huyết gà bệnh thçy thþąng có dðch vàng hoặc mû dþĆi thanh học để chèn đoán chính xác và kðp thąi. da đæu, xoang đæu mặt và viêm khí quân. Một số ca bệnh thçy viêm màng ngoài tim, viêm TÀI LIỆU THAM KHẢO phổi, túi khí. Đåy cüng là kết luên cûa một số nghiên cĀu về đặc điểm bệnh do aMPV gây ra Abdelmoez N.S., Shawky M., Abdelhady H.A., Lebdah M. & Salama S.S. (2019). Isolation and (Nunoya & cs., 1991; Jirjis & cs., 2002). Mặc dù identification of some possible causative agents of nhĂng đặc điểm này không hoàn toàn đặc trþng Swollen Head Syndrome (SHS) in broiler chickens cho aMPV nhþng hội chĀng sþng phù đæu là kết in Egypt. quâ cûa việc nhiễm aMPV. Báo cáo cûa Jones & Ali M.Z., Park J.E. & Shin H.J. (2019). Serological Rautenschlein (2013) cüng nhên thçy bệnh thăc survey of avian Metapneumovirus infection in chickens in Bangladesh. The Journal of Applied tế phý thuộc phæn lĆn vào să nhiễm trùng thĀ Poultry Research. 28(4): 1330-1334. phát. Nhiều tác giâ đã báo cáo tình träng nhiễm Atterby C. (2012). A minor study on avian vi khuèn phĀc hợp làm biến chĀng nhiễm aMPV metapneumovirus. Swedish University of ć gà thðt. Mcdougall & Cook (1986) đã phån lêp Agricultural Sciences. đþợc E. coli, Pseudomonas spp., Moraxella spp. Aung Y.H. (2007). Comparison of the pathogenesis and tÿ các trþąng hợp gà sþng phù đæu. Ngoài ra, immune responses following avian Metapneumovirus subtype A and B infection in Goodwin & Waltman (1994) đã phån lêp đþợc P. broiler-type chickens. aeruginosa, E. coli, P. mirabilis và Bayon-Auboyer M., Arnauld C., Toquin D. & Staphylococcus spp. ć nhĂng gà bð SHS nëm Eterradossi N. (2000). Nucleotide sequences of the 1992. HĄn nĂa, Tanaka & cs., (1995) phân lêp F, L and G protein genes of two non-A/non-B đþợc aMPV cùng vĆi E. coli và P. mirabilis tÿ avian pneumoviruses (APV) reveal a novel APV subgroup. Journal of General Virology. một đàn gà thðt vĆi khĆp thæn kinh bð sþng ć 81(11): 2723-2733. Nhêt Bân. Có thể thçy các ca bð nhiễm vi khuèn Buys S., Preez J. H. d. & H.J.Els (1980). A preliminary kế phát, E. coli rçt phổ biến vĆi đặc trþng là report on the isolation of a virus causing sinusitis fibrin phû lên nội täng (Pattison & cs., 2007; in turkeys in South Africa and attempts to attenuate Jones & Rautenschlein, 2013). the virus. Turkeys. 28: 36. Catelli E., Cook J., Chesher J., Orbell S., Woods M., Baxendale W. & Huggins M. (1998). The use of 4. KẾT LUẬN virus isolation, histopathology and immunoperoxidase techniques to study the Nghiên cĀu này là nghiên cĀu đæu tiên dissemination of a chicken isolate of avian khîng đðnh có să lþu hành cûa aMPV ć đàn gà pneumovirus in chickens. Avian pathology. nuôi täi một số tînh miền Bíc Việt Nam. Vì thąi 27(6): 632-640. gian bài thâi virus nhanh (không quá 6 ngày) Cook J., Kinloch S. & Ellis M. (1993). In vitro and in nên khi gà đã cò biểu hiện điển hình thì khâ vivo studies in chickens and turkeys on strains of nëng phát hiện virus trong méu bệnh phèm là turkey rhinotracheitis virus isolated from the two species. Avian pathology. 22(1): 157-170. rçt thçp, khi này nếu kiểm tra máu sẽ thçy có Cook J.K. & Cavanagh D. (2002). Detection and mặt kháng thể kháng aMPV. Các kết quâ tìm differentiation of avian pneumoviruses hiểu về triệu chĀng và bệnh tích cho thçy gà (metapneumoviruses). Avian pathology. nhiễm aMPV có biểu hiện têp trung ć đþąng hô 31(2): 117-132. hçp trên. Trong đò, biểu hiện sþng phù xung Đào Thị Hảo (2008). Phân lập, xác định một số đặc quanh mít (một bên/ hai bên) là thþąng gặp tính sinh học của Mycoplasma gallisepticum và chế kháng nguyên, huyết thanh chẩn đoán. Luận án nhçt. Bệnh tích ć phổi thþąng không điển hình. Tiến sĩ Nông nghiệp (Viện Thú y). Tuy nhiên, bệnh thþąng dễ nhæm lén vĆi một số Furian T.Q., Borges K.A., de Moraes H.L.S. & Salle bệnh trên đþąng hô hçp khác nhþ ND, IB, ORT, C.T.P. (2018). Respiratory Diseases in Poultry: A CRD, IC… Việc chèn đoán låm sàng không chính Constant Challenge. xác dén đến điều trð không kðp thąi làm cho Gharaibeh S. & Algharaibeh G. (2007). Serological and bệnh trć nên træm trọng hĄn. Do đò, nên kết hợp molecular detection of avian pneumovirus in 527
  9. Nghiên cứu sự lưu hành của Avian Metapneumovirus (aMPV) ở gà nuôi tại một số tỉnh miền Bắc Việt Nam chickens with respiratory disease in Jordan. metapneumovirus from turkeys in Iran. Veterinary Poultry science. 86(8): 1677-1681. Research Forum. Faculty of Veterinary Medicine, Gharaibeh S. & Shamoun M. (2012). Avian Urmia University, Urmia, Iran. p. 105. metapneumovirus subtype B experimental McDougall J. & Cook J. (1986). Turkey rhinotracheitis: infection and tissue distribution in chickens, preliminary investigations. Veterinary record. sparrows, and pigeons. Veterinary Pathology. 118(8): 206-207. 49(4): 704-709. Morley A. & Thomson D. (1984). Swollen-head Goodwin M.A. & Waltman W.D. (1994). Clinical and syndrome in broiler chickens. Avian diseases. pathological findings in young Georgia broiler pp. 238-243. chickens with oculofacial respiratory disease (“so- Nagy A., Abdallah F., Sweed K., Salama A. & Omar called swollen heads”). Avian diseases. pp. 376-378. M. (2018). Seroprevelance of avian Hall T.A. (1999). BioEdit: A user-friendly biological Metapneumovirus in Egyptian chicken and duck sequence alignment editor and analysis program flocks with a reference on economic impact. J for Windows 95/98/NT. Nucleic acids symposium Virol Sci. 4(4): 8-14. series. [London]: Information Retrieval Ltd., Naylor C., Shaw K., Britton P. & Cavanagh D. (1997). c1979-c2000. pp. 95-98. Appearance of type B avian pneumovirus in Great Homayounfar N., Shoushtari H., Charkhkar S. & Britain. Avian pathology. 26(2): 327-338. Bozorgmehrifard M. (2015). Detection by reverse Nguyễn Thị Lan, Chu Đức Thắng, Nguyễn Bá Hiên, transcriptase-polymerase chain reaction and Phạm Hồng Ngân, Lê Văn Hùng & Nguyễn Thị molecular characterization of avian Yến (2016). Đặc điểm của vi khuẩn metapneumovirus in chicken flocks in Iran. Ornithobacterium Rhinotracheale (ORT) phân lập WALIA Journal. 31(S3): 170-174. từ đàn gà nuôi tại một số tỉnh phía Bắc Việt Nam. Htut Aung Y., Liman M., Neumann U. & Tạp chí Khoa học Nông nghiệp Việt Nam. Rautenschlein S. (2008). Reproducibility of 11: 1734. swollen sinuses in broilers by experimental infection with avian metapneumovirus subtypes A Nguyễn Thị Loan, Lê Đình Quyền, Dương Hồng Quân, and B of turkey origin and their comparative Lê Huỳnh Thanh Phương, Nguyễn Bá Hiên & Lê pathogenesis. Avian pathology. 37(1): 65-74. Văn Phan (2016). Ứng dụng kỹ thuật RT-PCR để chẩn đoán bệnh viêm phế quản truyền nhiễm Hutton S., Bettridge J., Christley R., Habte T. & (Infectious Bronchitis) ở gà đẻ trứng tại một số Ganapathy K. (2017). Detection of infectious tỉnh phía Bắc Việt Nam. Tạp chí Khoa học Nông bronchitis virus 793B, avian metapneumovirus, nghiệp Việt Nam. 9: 1387. Mycoplasma gallisepticum and Mycoplasma synoviae in poultry in Ethiopia. Tropical animal Nunoya T., Tajima M., Izuchi T., Takahashi K., Otaki health and production. 49(2): 317-322. Y., Nagasawa Y. & Hakogi E. (1991). Pathology Jirjis F.F., Noll S., Halvorson D.A., Nagaraja K.V. & of a broiler disease characterized by the swollen Shaw D. (2002). Pathogenesis of avian head. Journal of Veterinary Medical Science. pneumovirus infection in turkeys. Veterinary 53(2): 347-349. Pathology. 39(3): 300-310. Pattison M., McMullin P., Bradbury J.M. & Alexander Jones R. & Rautenschlein S. (2013). Avian D. (2007). Poultry diseases. Elsevier metapneumovirus. Diseases of poultry. pp.112-138. Health Sciences. Jones R., Williams R., Baxter‐Jones C., Savage C. & Sid H., Benachour K. & Rautenschlein S. (2015). Co- Wilding G. (1988). Experimental infection of infection with multiple respiratory pathogens laying turkeys with rhinotracheitis virus: contributes to increased mortality rates in Algerian distribution of virus in the tissues and serological poultry flocks. Avian diseases. 59(3): 440-446. response. Avian pathology. 17(4): 841-850. Tanaka M., Takuma H., Kokumai N., Oishi E., Obi T., Kuhne P. (2009). Ways to control avian meta Hiramatsu K. & Shimizu Y. (1995). Turkey pneumovirus. Challenge. 80(60): 40. rhinotracheitis virus isolated from broiler chicken Majo N., Allan G., O'loan C., Pages A. & Ramis A. with swollen head syndrome in Japan. Journal of (1995). A sequential histopathologic and Veterinary Medical Science. 57(5): 939-941. immunocytochemical study of chickens, turkey Tucciarone C. M., Andreopoulou M., Franzo G., poults, and broiler breeders experimentally Prentza Z., Chaligiannis I. & Cecchinato M. infected with turkey rhinotracheitis virus. Avian (2017). First identification and molecular diseases. pp. 887-896. characterization of Avian metapneumovirus Mayahi M., Momtaz H., Jafari R.A. & Zamani P. subtype B from chickens in Greece. Avian (2017). Detection and subtyping avian diseases. 61(3): 409-413. 528
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2