intTypePromotion=1
ADSENSE

Nhân dòng gen và vùng Promoter Ubiquitin từ cây ngô

Chia sẻ: NI NI | Ngày: | Loại File: PDF | Số trang:8

45
lượt xem
3
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Trong bài viết này, chúng tôi giới thiệu các kết quả về nhân dòng gen mã hóa cho protein Ubiquitin (gen Ubi) và promoter Ubiquitin từ dòng ngô H240 phục vụ cho nghiên cứu về công nghệ gen ở cây ngô.

Chủ đề:
Lưu

Nội dung Text: Nhân dòng gen và vùng Promoter Ubiquitin từ cây ngô

TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> NHÂN DÒNG GEN VÀ VÙNG PROMOTER UBIQUITIN<br /> TỪ CÂY NGÔ (ZEA MAYS L.)<br /> Nguyễn Đức Thành*, Lê Hoàng Đức<br /> Viện Công nghệ sinh học, Viện Hàn lâm KH & CN Việt Nam, *nguyenducthanh_pcg@ibt.ac.vn<br /> TÓM TẮT: Ubiquitin là một protein trong tế bào nhân thực và trình tự của nó có tính bảo thủ cao,<br /> ubiquitin tham gia vào nhiều quá trình của tế bào như: cân bằng giữa tổng hợp và thoái biến protein, cấu<br /> trúc chromatin, điều hành chu kỳ tế bào, sửa chữa DNA và phản ứng với sốc nhiệt và các stress khác. Gen<br /> mã hóa cho protein này (gen Ubiquitin) và promoter Ubiquitin đã được nhân dòng và nghiên cứu đánh giá<br /> khả năng hoạt động từ nhiều đối tượng như lúa, ngô, lay ơn. Promoter Ubiquitin có vai trò quan trọng<br /> trong thể hiện gen ở cây một lá mầm. Trong bài báo này, chúng tôi giới thiệu các kết quả về nhân dòng<br /> gen mã hóa cho protein Ubiquitin (gen Ubi) và promoter Ubiqitin từ dòng ngô H240 phục vụ cho nghiên<br /> cứu về công nghệ gen ở cây ngô. Các kết quả nhận được cho thấy các vùng như: vùng promoter, vùng<br /> phiên mã và hộp TATA của gen Ubi nhân dòng được từ dòng ngô H240 có độ tương đồng cao so với các<br /> chuỗi gen tương đồng cùng loài trong gemone thực vật. Gen Ubi đã được đăng ký trên Ngân hàng Gen<br /> quốc tế với mã số JX947345.1. Kết quả nhận được trong nghiên cứu này sẽ góp phần đáng kể trong việc<br /> nghiên cứu và sử dụng promoter Ubiquitin trong chuyển gen ở các cây một lá mầm nói chung và cây ngô<br /> nói riêng.<br /> Từ khóa: Cây ngô, gen Ubiquitin, hộp TATA, mức độ tương đồng, promoter, vùng phiên mã.<br /> MỞ ĐẦU<br /> <br /> Ubiquitin là một protein trong tế bào nhân<br /> thực và trình tự của nó có tính bảo thủ cao,<br /> ubiquitin tham gia vào nhiều quá trình của tế<br /> bào như: cân bằng giữa tổng hợp và thoái biến<br /> protein, cấu trúc chromatin, điều hành chu kỳ tế<br /> bào, sửa chữa DNA và phản ứng với sốc nhiệt<br /> và các stress khác. Promoter là vùng trình tự<br /> nucleotide trong genome nằm ngược dòng về<br /> phía đầu 5’ của vị trí khởi đầu phiên mã gen<br /> (transcription start site-TSS). Promoter là thành<br /> phần quan trọng trong cấu trúc của tất cả các<br /> gen, khởi đầu cho sự phiên mã, đóng vai trò<br /> then chốt trong việc biểu hiện gen. Theo khả<br /> năng biểu hiện, promoter được chia làm hai loại<br /> chính: promoter không đặc hiệu hay còn gọi là<br /> promoter cơ định và promoter đặc hiệu bao gồm<br /> promoter đặc hiệu mô tế bào, đặc hiệu giai đoạn<br /> phát triển và promoter cảm ứng. Hiện nay, có<br /> rất nhiều promoter hiệu quả được sử dụng rộng<br /> rãi để điều khiển biểu hiện các gen ngoại lai<br /> trong cây trồng biến đổi gen như CaMV35S,<br /> CaMV19S, nopaline synthase (NOS) (promoter<br /> trên các cây hai lá mầm), hay Actin và<br /> Ubiquitin (promoter trên các cây một lá mầm).<br /> Promoter Ubiquitin đã được phân lập và<br /> nghiên cứu đánh giá khả năng hoạt động từ<br /> 114<br /> <br /> nhiều đối tượng như lúa, ngô, lay ơn [1, 3, 6].<br /> Các nghiên cứu đã cho thấy khả năng hoạt động<br /> của promoter này cao gấp mười lần hoạt động<br /> của promoter CaMV35S khi điều khiển biểu<br /> hiện gen ngoại lai trên cây một lá mầm. Hoạt<br /> tính của promoter Ubiquitin trong lúa chuyển<br /> gen bằng các phương pháp chuyển qua tế bào<br /> trần và mô sẹo thông qua đánh giá mức độ biểu<br /> hiện của các gen chỉ thị và chọn lọc cho thấy<br /> promoter này biểu hiện mạnh nhưng không phải<br /> ở tất cả các mô cũng như tất cả các giai đoạn<br /> phát triển của cây lúa [2]. Nhìn chung, promoter<br /> Ubiquitin có hoạt tính mạnh trong các mô non<br /> có hoạt động trao đổi chất mạnh và ở hạt phấn<br /> hoa [9].<br /> Trong bài báo này, chúng tôi giới thiệu các<br /> kết quả về nhân dòng gen mã hóa cho protein<br /> Ubiquitin (gen Ubi) và promoter Ubiquitin từ<br /> dòng ngô H240 phục vụ cho nghiên cứu về<br /> công nghệ gen ở cây ngô.<br /> VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU<br /> <br /> Vật liệu<br /> Vật liệu nghiên cứu được sử dụng là các<br /> mẫu lá của dòng ngô H240 do Viện Nghiên cứu<br /> ngô cung cấp. Vector tách dòng pBT do Phòng<br /> <br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> Công nghệ tế bào thực vật, Viện Công nghệ<br /> Sinh học cung cấp.<br /> Phương pháp<br /> Thiết kế cặp mồi nhân gen Ubiquitin (Ubi)<br /> và promoter: thông tin về trình tự gen và<br /> promoter Ubiquitin được khai thác trên ngân<br /> hàng gen quốc tế thông qua trang Web NCBI.<br /> Dựa trên thông tin về gen polyUbiquitin1<br /> (Ubi1) trên ngân hàng gen có mã số<br /> DQ141598.1 và sử dụng phần mềm Primer 3<br /> [10] để thiết kế cặp mồi đặc hiệu cho nhân gen<br /> Ubi. Xác định các vị trí cắt của enzyme giới<br /> hạn, vị trí bám của mồi và xác định các thông số<br /> kỹ thuật của mồi, như: nhiệt độ nóng chảy<br /> (Tm), tỷ lệ GC, chiều dài mồi bằng phần mềm<br /> NEBcutter V2.0 (New England Biolab INC).<br /> Tách chiết DNA genome: DNA genome<br /> được tách từ các mẫu lá ngô theo phương pháp<br /> CTAB của Saghai Maroof et al. (1994) [12].<br /> Nhân bản gen Ubi và promoter: Gen Ubi và<br /> promoter Ubiquitin được nhân bản từ DNA<br /> genome tách từ lá ngô bằng phản ứng PCR với<br /> cặp mồi đặc hiệu được thiết kế. Thành phần<br /> phản ứng bao gồm: đệm 10 x PCR: 2,5 µl;<br /> MgCl2 (25 mM): 1,5 µl; dNTP (1 mM): 1 µl;<br /> mồi xuôi (50 ng/µl): 1 µl; mồi ngược (50<br /> ng/µl): 1 µl, ; Taq DNA polymerase (5 U/µl): 1<br /> µl ; DNA (50 ng/ µl): 1 µl và nước cất vô trùng:<br /> 12 µl. Phản ứng PCR được thực hiện trên máy<br /> luôn nhiệt PTC-100 (MJ Research, Inc) với 35<br /> chu kỳ: 94oC: 1 phút; 58oC: 1 phút, 72oC: 2<br /> phút; kết thúc phản ứng ở 72oC trong 8 phút.<br /> Sản phẩm PCR được kiểm tra bằng điện di trên<br /> gel agarose 1%.<br /> Nhân dòng gen Ubi, propotor Ubiquitin và<br /> đọc trình tự: phân đoạn DNA nhân được sau<br /> phản ứng PCR có kích thước tương ứng với<br /> kích thước lý thuyết của Ubi1 được tinh sạch<br /> bằng bộ kit AccuPrep® Gel Purification<br /> (Bioneer) theo hướng dẫn của nhà sản xuất. Sau<br /> khi tinh sạch phân đoạn này được gắn vào<br /> vector nhân dòng pBT để tạo vector tái tổ hợp.<br /> Các quá trình tạo vector tái tổ hợp được thực<br /> hiện theo như mô tả của Sambrook et al. (1989)<br /> [11]. Vector tái tổ hợp chứa gen Ubi sau đó<br /> được biến nạp vào chủng vi khuẩn E. coli chủng<br /> DH5α bằng phương pháp sốc nhiệt. Kết quả<br /> <br /> biến nạp vào E. coli của vector tái tổ hợp có gắn<br /> gen Ubi với vector pBT được kiểm tra bằng<br /> phản ứng colony PCR sử dụng cặp mồi đặc hiệu<br /> nhân bản Ubi. Đồng thời, các khuẩn lạc làm<br /> khuôn cho phản ứng colony-PCR sẽ được nuôi<br /> lắc qua đêm ở 37oC trong 4 ml môi trường LB<br /> lỏng bổ sung 100 µg/ml kháng sinh Ampicillin<br /> hoặc 50 µg/ml kháng sinh Kanamycin để tách<br /> plasmid. Tách DNA plasmid và kiểm tra sự có<br /> mặt của gen Ubi bằng cắt bởi enzyme giới hạn<br /> BamHI được tiến hành theo như Sambrook et al.<br /> (1989) [11]. Trình tự nucleotide của gen Ubi<br /> được xác định bằng máy giải trình tự ABI<br /> PRISM® 3100 Avant Genetic Analyzer, sử dụng<br /> bộ kit BigDye® Terminator V3.1 Cycle<br /> Sequencing tại Phòng Thí nghiệm Trọng điểm<br /> về công nghệ gen, Viện Công nghệ sinh học.<br /> Thành phần phản ứng PCR đọc trình tự gồm<br /> mồi, DNA plasmid đã được tinh sạch, BigDye,<br /> đệm tương ứng trong tổng thể tích 15 µl. Chu<br /> trình nhiệt trên máy luân nhiệt GenAmp® PCR<br /> System 9700 gồm 25 chu kỳ: 96oC: 1 phút,<br /> 96oC: 10 giây, 50oC: 5 giây, 60oC: 4 phút. Sau<br /> đó, sản phẩm PCR được tinh sạch và điện di<br /> trong ống vi mao quản để đọc trình tự. Trình tự<br /> nucleotide nhận được của gen Ubi được so sánh<br /> với trình tự của Ubi1 (DQ141598.1) và một số<br /> trình tự đã công bố trên Ngân hàng Gen quốc tế<br /> bằng phần công cụ BLAST của NCBI.<br /> Phân tích promoter: xác định vùng<br /> promoter, vùng phiên mã của gen Ubi nhận<br /> được bằng phần mềm TSSP/ Prediction of<br /> PLANT Promoters, Softberry, Inc. So sánh các<br /> vị trí của promotor, vùng phiên mã gen Ubi từ<br /> dòng ngô H240 và gen Ubi1 đã công bố<br /> (DQ141598.1) với dữ liệu các chuỗi gen tương<br /> đồng cùng loài trong gemone thực vật bằng<br /> chương trình PromH(W) (Promoter prediction<br /> using<br /> orthologous<br /> sequences<br /> (http://linux1.softberry.com/berry.phtml); xác<br /> định vùng kết thúc phiên mã bằng chương trình<br /> ARNold-Program<br /> Finding<br /> terminator<br /> (Gautheret and Lambert, 2001) [4].<br /> KẾT QUẢ VÀ THẢO LUẬN<br /> <br /> Kết quả thiết kế mồi đặc hiệu<br /> Dựa trên trình tự gen Ubi1 trên Ngân hàng<br /> Gen NCBI với mã số DQ141598.1, bằng phần<br /> 115<br /> <br /> TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> mềm Primer 3 [10], trình tự của cặp mồi đặc<br /> hiệu cho nhân bản gen Ubi được thiết kế. Mồi<br /> xuôi UbiF có trình tự là<br /> 5’TAGTGCAGCGTGACCCG - 3’ và mồi ngược<br /> UbiR có trình tự là 5’-TATGCAGAAGTAACA<br /> CCAAACAA-3’. Để thuận tiện cho việc nhân<br /> dòng trong vector pBT mồi xuôi và mồi ngược<br /> được gắn thêm trình tự các điểm cắt tương ứng<br /> của các enzyme giới hạn BamHI (GGATCC)<br /> và PstI (CTGCAG). Kết quả mồi xuôi (UbiF2)<br /> và mồi ngược (UbiR2) để nhân bản gen Ubi có<br /> <br /> trình tự tương ứng là: UbiF2: 5’-TACTGC<br /> AGGTGCAGCGT GACCCG-3’ và 5’-TAGG<br /> ATCCTGCAGAAGTAACACCAAACAA-3’<br /> (bảng 1). Mồi xuôi có chiều dài 23 nucletide<br /> nhiệt độ nóng chảy (Tm) là 65,8 oC và tỷ lệ GC<br /> là 65.2%, còn mồi ngược có chiều dài 29<br /> nucletide nhiệt độ nóng chảy (Tm) là 59,6 oC và<br /> tỷ lệ GC là 41,3%. Cặp mồi sẽ nhân được chuỗi<br /> nucleotide có chiều dài theo lý thuyết khoảng 2<br /> kb tương đương với chiều dài của gen<br /> Ubiquitin.<br /> <br /> Bảng 1. Trình tự mồi dùng cho nhân bản promoter Ubiquitin<br /> Tên<br /> UbiF2<br /> UbiR2<br /> <br /> Trình tự mồi thiết kế nhân bản gen Ubiquitin<br /> 5’ - TACTGCAGGTGCAGCGTGACCCG - 3’<br /> 5’- TAGGATCCTGCAGAAGTAACACCAAA<br /> CAA-3’<br /> <br /> Kết quả nhân bản gen Ubi và promoter<br /> Ubiquitin<br /> Với cặp mồi đặc hiệu được thiết kế, gen Ubi<br /> và promoter Ubiquitin đã được nhân bản từ<br /> DNA genome dòng ngô H240 (hình 1). Kết quả<br /> điện di trên hình 1 cho thấy, sản phẩm PCR chỉ<br /> có một băng duy nhất có kích thước khoảng 2<br /> kb, tương đương với kích thước của gen<br /> Ubiquitin và promoter theo lý thuyết.<br /> <br /> Hình 1. Kết quả điện di sản phẩm PCR nhân<br /> bản gen Ubi<br /> M. DNA marker 1 kb (Biolabs); 1. Đối chứng âm<br /> (phản ứng PCR không có DNA của H240); 2. sản<br /> phẩm PCR nhân bản gen Ubiquitin từ DNA genome<br /> dòng ngô H240 với cặp mồi UbiF2 và UbiR2 được<br /> thiết kế.<br /> <br /> 116<br /> <br /> Tm (oC)<br /> 65,8<br /> 59,6<br /> <br /> Tỷ lệ GC<br /> (%)<br /> 65,2<br /> 41,3<br /> <br /> Chiều<br /> dài<br /> 23<br /> 29<br /> <br /> Kết quả nhân dòng gen Ubi và promoter<br /> Sau khi nhân bản, băng có kích thước tương<br /> tự độ dài của gen Ubiquitin được tinh sạch và<br /> được gắn vào plasmid pBT và biến nạp vào<br /> chủng E. coli DH5α. Kết quả điện di sản phẩm<br /> PCR khuẩn lạc với cặp mồi đặc hiệu UbiF2 và<br /> UbiR2 được trình bầy trên hình 2.<br /> <br /> Hình 2. Kết quả điện di sản phẩm PCR nhân<br /> gen Ubi từ plasmid trong các khuẩn lạc 2, 3<br /> và 4; M. DNA marker 1 kb (Biolabs); 1. Đối<br /> chứng âm (phản ứng PCR không có khuẩn lạc);<br /> 2, 3, 4. tương ứng với plasmid từ các dòng<br /> khuẩn lạc 2, 3 và 4.<br /> <br /> Nguyen Duc Thanh, Le Hoang Duc<br /> <br /> Hình 3. Kết quả cắt kiểm tra phân đoạn gen Ubi<br /> từ dòng ngô H240 trong plasmid pBT. M: DNA<br /> marker 1 kb (Biolabs); 2 , 3, 4: tương ứng với<br /> plasmid từ các dòng khuẩn lạc 2, 3, và 4 được<br /> cắt bằng enzyme BamHI<br /> Như vậy là phân đoạn gen Ubi đã được gắn<br /> <br /> vào plasmid pBT và nhân dòng trong E. coli<br /> DH5α. Kết quả này cũng được khẳng định bằng<br /> kết quả cắt plasmid pBT có chứa phân đoạn gen<br /> Ubi bằng enzyme BamHI. Sau khi cắt bằng<br /> enzyme này và phân lập các đoạn cắt trên gel<br /> agorose 1%, trên ảnh điện di có thể nhìn rõ hai<br /> băng : băng 3 kb tương ứng với độ dài của<br /> plasmid pBT và băng 2 kb tương ứng với độ dài<br /> của gen Ubi (hình 3).<br /> Kết quả so sánh trình tự và phân tích<br /> promoter Ubiquitin<br /> Kết quả so sánh trình tự phân đoạn đoạn gen<br /> Ubi mang promoter Ubiquitin từ dòng ngô<br /> H240 với trình tự gen trên Ngân hàng Gen<br /> NCBI và trình tự Ubi1 có mã số DQ141598.1<br /> (Zea mays cultivar Nongda 105 polyUbiquitin-1<br /> (Ubi-1) gene, promoter region and 5' UTR)<br /> được trình bày ở bảng 2.<br /> <br /> Bảng 2. Kết quả so sánh mức độ tương đồng trình tự gen Ubi mang promoter Ubiquitin tách từ<br /> dòng ngô H240 và gen Ubi1 với vùng promoter đã công bố với mã số DQ141598.1<br /> Mã số Ngân<br /> hàng gen<br /> DQ141598.1<br /> <br /> Tên gen<br /> Gen polyUbiquitin-1 (Ubi-1) từ<br /> dòng ngô Nongda 105 Zea<br /> mays, vùng promoter và không<br /> phiên mã đầu 5'<br /> <br /> Mức độ so<br /> sánh<br /> 99%<br /> <br /> Giá trị<br /> E<br /> 0,0<br /> <br /> Mức độ tương<br /> đồng<br /> 94%<br /> <br /> Bảng 3. Kết quả so sánh trình tự gen Ubi mang promoter Ubiquitin từ dòng ngô H240 với một số<br /> trình tự trên Ngân hàng Gen quốc tế khác<br /> Mã số<br /> <br /> Tên gen, vector<br /> <br /> AB201314.1<br /> <br /> Cloning vector pSB4U DNA,<br /> complete sequence<br /> Cre-lox Univector acceptor vector<br /> pCR701 complete sequence<br /> Reporter vector pUbiGUSPlus;<br /> pUbiSXR, complete sequence<br /> polyUbiquitin [maize, Genomic, 3841<br /> nt]<br /> Zea mays clone MubG1 Ubiquitin<br /> gene, complete cds<br /> Zea diploperennis polyUbiquitin-1<br /> (Ubi-1) gene, promoter region and 5'<br /> UTR<br /> <br /> FJ750577.1<br /> AY452753.1<br /> S94464.1<br /> U29159.1<br /> AY342393.1<br /> <br /> Mức<br /> độ so<br /> sánh<br /> 99%<br /> <br /> Giá<br /> trị<br /> E<br /> 0.0<br /> <br /> 99%<br /> <br /> 0.0<br /> <br /> 99%<br /> <br /> 0.0<br /> <br /> 99%<br /> <br /> 0.0<br /> <br /> 99%<br /> <br /> 0.0<br /> <br /> 98%<br /> <br /> 0.0<br /> <br /> Mức độ<br /> tương<br /> Tác giả<br /> đồng<br /> 93%<br /> Kuraya et al.<br /> (2004) [7]<br /> 93%<br /> Jia et al.<br /> (2009) [5]<br /> 93%<br /> Vickers et al.<br /> (2003) [15]<br /> 93%<br /> Christensen et<br /> al. (1992) [1]<br /> 93%<br /> Liu et al.<br /> (1995) [8]<br /> 94%<br /> Streatfield et<br /> al.<br /> (2003)<br /> [13]<br /> <br /> 117<br /> <br /> TẠP CHÍ SINH HỌC 2013, 35(3se): 114-121<br /> <br /> Kết quả trên bảng 2 cho thấy, mức độ<br /> nucleotide tương đồng giữa gen Ubi tách<br /> từ dòng ngô H240 nhân dòng được với trình tự<br /> gen polyUbiquitin-1 (Ubi-1) từ dòng ngô<br /> Nongda 105 Zea mays, vùng promoter và vùng<br /> không phiên mã đầu 5' (DQ141598.1) là 94%.<br /> Ngoài ra, chúng tôi còn tiến hành so sánh với<br /> các trình tự nucleotide khác trên Ngân hàng Gen<br /> quốc tế và thu được các kết quả thể hiện trong<br /> bảng 3.<br /> <br /> Qua bảng 3 có thể thấy, trình tự của gen<br /> Ubi nhân dòng được có độ tương đồng cao với<br /> trình tự một số gen và vector mang promoter<br /> Ubiquitin đã công bố, đặc biệt là trình tự gen<br /> Ubiquitin trong các dòng ngô chuyển gen. Như<br /> vậy, có thể khẳng định gen Ubi nhân dòng được<br /> có độ tin cậy cao. Gen Ubi từ dòng ngô H240 đã<br /> được đăng ký trên Ngân hang Gen quốc tế<br /> NCBI với mã số JX947345.1 (Zea mays<br /> ubiquitin 1 (Ubi) gene, promoter region).<br /> <br /> >gi_410109644_gb_JX947345.1_ Zea mays ubiquitin 1 _Ubi_ gene, promoter<br /> region<br /> TACTGCAGGTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGCTCTAGAGTAGAGCATTG<br /> CATGTCTAAGTTATAAAAAATTACCACATATTTTTTTTGTACACTTGTGTTTGAAGTGCA<br /> GTTTATCTATCTCTATACATATATTTAAACTTCACTATATGAATAATATAGTCTATAGTA<br /> TTAAAATAATATCAATGTTTTAGATGATTATATAACTGAGCTGCTAGACATGGTCTAAAG<br /> GACAACCGAGTATTTTGACAACATGACTCTACAGTTTTATCTTTTTAGTGTGCGTGTGTT<br /> CTTTTTACTTTTGCAAATAGCTTCACCTATATAATACTTCATCCATTTTATTAGTACATC<br /> CATTTACTAAATTTTTAGTACATCTATTTTATTCTATTTTAGCCTCTAAATTAAGAAAAC<br /> TTAAACTCTATTTTAGTTTTTTATTTAATAATTTAGATATAAAATAGAATAAAATAAAGT<br /> GACTAAAAAATAACTAAATACCTTTTTAAGAAATAAAAAAACTAAGGAACCATTTTTCTT<br /> GTTCCGAGTAGATAATGACAGCCTGTTCAACGCCGTCGACGAGTCTAACCGGAACACCCC<br /> ATCAGCGAACCCAGGCAGCGTCGCGTCCGGTTCAAGCGAAGCAGAACGCCACGGGCATCT<br /> TCTGTAGCTGCCCTTTCTGGACCCCCTCTCTCCGAGAGAAGGTTTCCGCTCCCACCGTTG<br /> GACTTGCTCCCGCTGTTCGGCATCCCAGAAAATTGCGTGGGCGGGAGCGGCAGACGTGAG<br /> CCGGCACGGGCAGGCGGCCTTCCTTCTCACGGCACCGGCAGCTACGGGGGATTCCCTTTC<br /> CCACCGCTCCTTTCGCTTTTCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCCCTCCC<br /> <br /> 60<br /> 120<br /> 180<br /> 240<br /> 300<br /> 360<br /> 420<br /> 480<br /> 540<br /> 600<br /> 660<br /> 720<br /> 780<br /> 840<br /> 900<br /> <br /> Hộp TATA<br /> ACACCCTCTTTCCCCCAACCTCGTGTTGTTCGGAGCGCACACACACACAACCAGATCTCC<br /> CCCCAAACCCACCCGTCGGCACCTCCCGCTTCAAGGTACGCCGCTCGTCCTCCCCCCCCC<br /> CCCCTCTCTCTACCTTCTCTAGATCGGCGTTCCGGTCCATGGTTAGGGCCCCGGTAGTTC<br /> TACTTCTGTTCATGTTTGTGTTAGATCCGTGTTTGTGTTAGATCCGTGCTGCTAGCGTTC<br /> GTACACGGATGCGACCTGTACGTCAGACACGTTCTGATTGCTAACTTGCCAGTGTTTCTC<br /> TTTGGGGAATCCTGGGATGGCTCTAGCCGTTCCGCAGACGGGATCGATTTCATGATTTTT<br /> TTTGTTTCGTTGCATAGGGTTTGGTTTGCCCTTTTCCTTTATTTCAATATATGCCGTGCA<br /> <br /> 960<br /> 1020<br /> 1080<br /> 1140<br /> 1200<br /> 1260<br /> 1320<br /> <br /> Chuỗi kết thúc<br /> CTTGTTTGTCGGGTCATCTTTTCATGCTTTTTTTTGTCTTGGTTGTGATGATGTGGTCTG<br /> GTTGGGCGGTCGTTCTAGATCGGAGTAGAATTCTGTTTCAAACTACCTGGTGGATTTATT<br /> AATTTTGGATCTGTATGTGTGTGCCATACATATTCATAGTTACGAATTGAAGATGATGGA<br /> TGGAAATATCGATCTAGGATAGGTATACATGTTGATGCGGGTTTTACTGGTGCATATACA<br /> GAGATGCTTTTTGTTCGCTTGGTTGTGATGATGTGGTGTGGTTGGGCGGTCGTTCATTCG<br /> TTCTAGATCGGAGTAGAATACTGTTTCAAACTACCTGGTGTATTTATTAATTTTGGAACT<br /> GTATGTGTGTGTCATACATCTTCATAGTTACGAGTTTAAGATGGATGGAAATATCGATCT<br /> AGGATAGGTATACATGTTGATGTGGGTTTTACTGATGCATATACATGATGGCATATGCAG<br /> CATCTATTCATATGCTCTAACCTTGAGTACCTATCTATTATAATAAACAAGTATGTTTTA<br /> TAATTATTTTGATCTTGATATACTTGGATGATGGCATATGCAGCAGCTATATGTGGATTT<br /> TTTTAGCCCTGCCTTCATACGCTATTTATTTGCTTGGTACTGTTTCTTTGTCCGATGCTC<br /> ATCCTGTTGTTTGGTGTTACTTCTGCAGGATCCTA<br /> <br /> 1380<br /> 1440<br /> 1500<br /> 1560<br /> 1620<br /> 1680<br /> 1740<br /> 1800<br /> 1860<br /> 1920<br /> 1980<br /> 2040<br /> <br /> Hình 4. Vị trí promoter, hộp TATA và chuỗi kết thúc của gen Ubi từ dòng ngô H240<br /> <br /> 118<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2