Summary of doctoral thesis: Inducing of mutation tuberose (Polianthes tuberosa L.) lines by irradiating with 60Co gamma rays in vitro

Chia sẻ: Phong Tỉ | Ngày: | Loại File: PDF | Số trang:31

Thêm vào BST

Báo xấu

34
lượt xem 4
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

General objective: To get mutant flowering flowers that have more number of petals than the study samples, larger flowers and more aromatic. To evaluate growth culture technique to generate calli and shoots for irradiation of gamma ray;

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Summary of doctoral thesis: Inducing of mutation tuberose (Polianthes tuberosa L.) lines by irradiating with 60Co gamma rays in vitro

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY SUMMARY OF DOCTORAL THESIS Specialization: Biotechnology Code: 62 42 02 01 DAO THI TUYET THANH INDUCING OF MUTATION TUBEROSE (Polianthes tuberosa L.) LINES BY IRRADIATING WITH 60Co GAMMA RAYS IN VITRO Can Tho, 2018
THIS STUDY WAS COMPLETED AT CAN THO UNIVERSITY Scientific supervisor: Assoc. Prof. Doctor NGUYEN BAO TOAN The dissertation was defended at the university examination committee At.………………………………………., Can Tho University At……….. hour ….…, on date……..month…..…. year…… Referee 1: Referee 2: Referee 3: The dissertation is available at Libraries: 1. Central library of Can Tho University. 2. National library of Vietnam.
PUBLISHED PAPERS 1. Nguyen Bao Toan, Nguyen Quang Thuc and Dao Thi Tuyet Thanh, 2014. 60Co Gamma treatment at different irradiated doses on shoot clusters of two (Polianthes tuberosa) varieties in vitro. Can Tho University Journal of Science. (4): 41 - 46 (in Vietnamese). 2. Dao Thi Tuyet Thanh and Nguyen Bao Toan, 2016. Effects of 60 Co gamma doses on the growth and development of in vitro tuberose shoot clusters (Polianthes tuberosa L.), appearance of abnormal structures and LD50 determination. Can Tho University Journal of Science. Part B: Agriculture, Aquaculture and Biotechnology. 45: 25 - 32 (in Vietnamese). 3. Dao Thi Tuyet Thanh, Le Thi Ngoc Quy and Nguyen Bao Toan, 2017. Study on growth and flower diversity of single petal tuberose clones (Polianthes tuberosa L.) irradiated with 60Co gamma rays by tissue culture. Journal of Vietnam Agricultural Science and Technology. 2(75): 47 - 52 (in Vietnamese). 4. Dao Thi Tuyet Thanh and Nguyen Bao Toan, 2017. Study on genetic diversity of tissue cultured tuberose lines (Polianthes tuberosa L.) irradiating with Co60 by using ISSR marker. Journal of Vietnam Agricultural Science and Technology. 6(79): 20 - 24 (in Vietnamese). 5. Dao Thi Tuyet Thanh and Nguyen Bao Toan. Effects of gamma radiation doses on the growth, flowering and phenotypes of tuberose (Polianthes tuberosa L.) lines propagated by tissue culture. Journal of Biotechnology. (Accepted, in Vietnamese).
Chapter I: INTRODUCTION 1. Necessity of the dissertation Polianthes tuberosa L. is one of the most popular cut flowers in the tropics and subtropics. In Vietnam, it helps farmers get more income than rice and other crops do. Thus, it has been included in the crop restructuring program and considered a poverty reduction crop in the provinces: Tien Giang, Dong Thap, Can Tho and An Giang. Nowadays, there are only two varieties of tuberoses with 6 petals and 12 petals which are mainly cultivated in the Mekong Delta. However, the propagation of tuberose is mainly rooted through generations leading to serious degeneration, pest infestation and significant reduction in productivity. Therefore, the demand for new varieties is exigent. In addition, breeding of tuberose in the traditional way has encountered some limitations due to high incompatibility because the flowers have stigmas and stamens which are not ripe at the same time and this is the reason why their seeds are not created under natural conditions (Estrada-Basaldua et al., 2011). Moreover, only the single petal flowers can produce seeds, but it is difficul for the seeds to sprout. Perhaps, the mutation is the best way to breed a new tuberose variety. Among physical mutagenic agents, gamma rays are most widely used because of their effectiveness (Matsumara et al., 2010). This technique increases genetic variation in some type of flowers such as changes in color, shape, growth characteristics, etc (Xu et al., 2012). Furthermore, in vitro culture should be applied to increase the number of irradiated samples. Propagation of tuberose in vitro has been experimented (Huynh Thi Hue Trang et al., 2007; Hutchinson et al., 2004). Whereas, growth culture and irradiation are the effective methods to make plants uncontaminated, multiply rapidly and mutate. This combination is successfully applied on palms, apples, potatoes, sweet potatoes and 1
pineapples (Ulukapi and Nasircilar, 2015) and can be selected properly to produce tuberose varieties. On the other hand, petals play an important role in flowering, pollination and cross-fertilization… For ornamental plants, the number of petals is related to the flower pattern. When in vitro culture is combined with gamma ray treatment, changes to the number of rose and daisy petals have been reported (Usenbaevard and Imankulova, 1974; Kahrizi et al., 2012; Nagatomi, 2001). Thus, it is possible for tuberose to induce new source of variations in the characteristics of large numbers of petals by in vitro and gamma ray processing. Until now, in Vietnam, there have not been any new tuberose variety with many petals created by traditional methods as well as by other modern biotechnological techniques. For these reasons, it is necessary to carry out the study on "Inducing of mutation tuberose (Polianthes tuberosa L.) lines by irradiating with 60Co gamma rays in vitro" 2. Research objectives 2.1. General objective: To get mutant flowering flowers that have more number of petals than the study samples, larger flowers and more aromatic. 2.2. Specific objectives: (1) To evaluate growth culture technique to generate calli and shoots for irradiation of gamma ray; (2) To identify lethal dose of 50% (LD50) of gamma rays (60Co) on callus and rhizomes of tuberosa after 150 days; (3) To observe the phenotypic abnormalities of the domesticated stage; (4) To choose 1 to 2 mutant tuberose lines that increase the number of petals (more than 12 petals) with large size and fragrant odour by traditional breeding methods. 3. Research subjects and scope of the study - Two tuberose varieties including of the single and double petal flower are being cultivated in An Giang province. - Investigating mutant line characteristics in the field over 2 generations. 2
4. Location and duration This study was carried out from October 2013 to August 2017 at Can Tho University. Experiments of irradiation treatment were done at the Radiation Technology Department of Dalat Nuclear Research Institute, Lam Dong province. The single petal tuberose variety/lines were planted in Can Tho City and the double petal ones were cultivated in Tien Giang province. 5. New contributions of the dissertation - Using the meristem culture technique to initiate the materials for irradiating with the 60Co gamma ray; computing the lethal dose 50% (LD50) of the gamma rays on tuberose callus or shoot clusters of two tuberose varieties in vitro. - Observing the abnormal structures of leaf, stem and shoot of the two tuberose varieties after 150 day culturing at the in vitro stage and after 60 day cultivating at field. Besides, recording the growth, flowering parameters, the variations of petal numbers, the aroma of these flower types after 180 day on the field. - Selecting at least from 1 to 2 mutant tuberose lines which were increasing of the petal number (22 and 36 petals), of the size and fragrance over the 2nd flowering. - Assessing the genetic diversity by PCR - ISSR method to prove the differences of DNA among the two mutant tuberose lines and the two control varieties such as determining the appearance or the absence of DNA bands, sequencing the ITS1/4 regions to compare the DNA sequences and identify the mutant types as replacement, deleting and inserting one or more new nucleotides. - This study has constructed the procedure of mutant tuberose line selecting by 60Co gamma treatment in vitro. 6. Outline of the dissertation The dissertation includes 142 pages of introduction, literature review, materials and methods, results and discussion, conclusion and 3
recommendation, references and annexes, and also contains 35 tables, 35 figures and 277 references. Chapter III: MATERIALS AND METHODS 3.1. Plant material - The tuberose varieties are growing well in An Giang province (Figure 3.1). Figure 3.1: The two tuberose varieties. a: The single petal tuberose variety (HĐ ) with 6 petal flowers and fragrant odour, short length of flower spike, small leaves and b: The double petal one (HK ) with 12 petal flowers and fragrant odour, higher length of flower spike, bigger leaves. a b 3.2. Experimental methods 3.2.1. Research content 1: Inducing materials for irradiating with 60 Co gamma rays in vitro 3.2.1.1. Meristem culture of tuberose - Explant preparation, sterilization and using the MS basal medium for the initial medium (Murashige and Skoog, 1962) (Huynh Thi Hue Trang et al., 2007). * Experimental parameters: The survival rate of meristems after 30 day culturing (%). 3.2.1.2. Inducing tuberose clusters of calli and shoots - Transplanting the survival meristem of the tuberoses after every 30 day for 5 times (M5). The culture medium was the basal medium (BM) including MS medium supplemented with thiamine; pyridoxine; nicotinic acid; 1.0 mg/l riboflavin for each; agar (8 g/l); sucrose (30 g/l) (Huynh Thi Hue Trang et al., 2007). Then, this mixture was adjusted to pH 5.8 before being autoclaved at 121oC for 30 min and this medium was contained in nylon bags (Figure 3.2). 4
a b Figure 3.2: Culture Figure 3.3: Petri dishes had cultured samples medium in a nylon before irradiating by gamma rays bag Note: a: calli samples and b: clusters of shoots - Using BM medium and additives of plant growth regulators for callus and shoot initiation media containing 1.0 mg/l NAA and BA 4.0 mg/l (Huynh Thi Hue Trang et al., 2007). 3.2.2. Research content 2: Determining the effects of 60Co gamma doses of two tuberose varieties/lines using the 50% lethal dose (LD50) in vitro * Preparing clusters of calli/shoots dedrived from the single petal tuberose variety/double petal one - Clusters of calli with 1.0 cm2 in size were cultured in petri dishes which contained 20 ml BM medium, culturing 10 samples/dish and in total of 60 dishes (Figure 3.3a). - Clusters of shoots were cut off leaves and roots in the average height of 1.0 - 1.2 cm, each of them which had 1.0 cm diameter were cultured in petri dishes (Figure 3.3b). 3.2.2.1. Experiment 1: Effects of 60Co gamma ray doses on the growth and the development of single petal tuberose callus clusters The experiment was laid out in a completely randomized design (CRBD) with a factor, 10 treatment, 5 replications and included fifty explants per replication. The non-irradiated treatment was the control one. The 60Co gamma rays with the dose rate was 1.58 kGy/hour. The experiment was shown in Table 3.1. After irradiating, clusters of calli were cultured in BM medium supplemented with 1.0 mg/l NAA and 6.0 mg/l BA (Le Ly Vu Vi et al., 2014) for shoot regeneration and multiplication, then they were transplanted at every 30 day (culturing 1 cluster of callus/shoot/nylon bag). 5
Table 3.1: Arranging gamma ray doses and treatments in the single petal tuberose variety Variety Gamma ray dose (Gy) Control 5 10 15 20 25 30 40 50 60 HĐ T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 * Experimental parameters: - The percentage of clusters of calli regenerated into shoots after 30 day culturing (%). Visual observation clusters of shoots after 150 day irradiating by gamma rays. - Death rate (%) = (Total of death shoots/Total of shoots) x 100. The clusters of calli were regarded as death when they could not induce any shoot or new shoot and get lost chlorohyll. - Calculating LD50 followed Randhawa’s description (2009). - Shoot length (cm), number of shoots/cluter, number of leaves/clusters of shoots. - Abnormal clusters of shoots which recorded at leaves, roots, shoots, stunt shoots types... 3.2.2.2. Experiment 2: Effects of 60Co gamma ray doses on the growth and development of the double petal tuberose shoot clusters This was laid out similarly to the experiment 1 (Table 3.2). Table 3.2: Arranging gamma ray doses and treatments in the double petal tuberose variety Variety Gamma ray dose (Gy) Control 5 10 15 20 25 30 40 50 60 HK T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 After irradiating, clusters of shoots were transfered to shoot multiplied medium as in Experiment 1 (culturing 1 cluster of shoot/nylon bag). * Experimental parameters: - Death rate (%), calculating LD50, shoot length (cm), number of shoots, number of leaves and types of abnormal shoots after 150 day 6
culturing were indicated as Experiment 1. The death clusters of shoots were recorded as having no chlorohyll or inducing no new shoot. 3.2.2.3. Mass multiplication and root formation - Using BM for the shoot multiplication medium, supplemented with 1.0 mg/l NAA and 6.0 mg/l BA (Le Ly Vu Vi et al., 2014); subculturing three times in every 30 days, but culturing 10 clusters of shoots/nylon bags. - When the number of shoots were about 500, then transfering all of them into the root formation medium which was BM medium plus 4.0 ml/l atonik (Le Ly Vu Vi et al., 2014) in 60 days, subculturing in every 30 days and 10 shoots/nylon bag until the appearance of root. 3.2.3. Research content 3: Determination of plantlet phenotype diversities at the acclimatization stage - Acclimatization of the tuberose plantlets was performed as the same as Nguyen Minh Kien (2011). * Experimental parameters: The frequency of abnormal plantlets (%): striped or curl leaves… after 30 day growing. 3.2.4. Research content 4: Screening several tuberose lines having an increase of the number of petals, the flower size and fragrance by the traditional propagation method 3.2.4.1. Experiment 3: Evaluating of the growth and development of single petal tuberose variety/lines after irradiating by 60Co gamma ray on the field a. The first times of growing (VĐM1) - This experiment was conducted in a factorial randomized completely block design in three replications in 500 m2 plots size with 8 treatments. The treatments included the bulb control (plants dedrived from bulbs), the in vitro control (plants dedrived from non-irradiated in vitro culture) and gamma ray doses from 5; 10; 15; 20; 25 and 30 Gy. Every replications grew 50 plants. The bulb control had bulb with diameter of 1.0 - 1.2 cm whereas the in vitro control or irradiated plantlets had 3.0 - 6.0 leaves, 6.0 - 10.0 cm 7
height and 1.0 - 2.0 shoots. Every treatment was marked 5 points with 3 plants for the average data in statistics. - The experiment diagram was shown in Figure 3.4a. The cultivation process was done as Le Ly Vu Vi et al. (2014). * Experimental parameters: - The death rate of plantlets after 60 day growing. - The growth parameters at 180 day planting: number of shoots, number of leaves on the flowering time; number of bulbs and bulb diameter (cm). - The flowering parameters: Days to flowering when 25% plants induced inflorescence (days); inflorescence length (cm); floret number; flowering diameter (cm). Recording the abnormal types in leaves, bulbs, flowers and the fragrance (when 75% plants had inflorescences). - Carrying to choose mutant lines by individual selection method, then naming them: tuberose line + petal numbers + irradiated dosage. - Evaluation the fragrance by sensory (smelling method). Aromatic level was assessed by the average of 10 persons which was established as a convention: 0 mark: no fragrance; 1 mark: normal fragrance và 2 marks: more fragrance. The bulb control treatment was the control. Each group of plants was estimated for 3 spikes when the lowest floret pair had completely opened. b. The second times of growing (VĐM2) If there were some mutant tuberose lines having an increase of the petal number (more than 12 petals), flower size and fragrance, they would have grown the second times. In contrast, they would have continuously stored for other purposes. * Experimental parameters when 100% plants had inflorescence: The growth and flowering parameters, abnormal petal number types and the level of aroma were assessed likely to Part 3.2.4.1.a. 8
Figure 3.4: The field experiment diagrams 3.2.4.2. Experiment 4: Evaluating the growth and the development of the double petal tuberose variety/lines after irradiating with 60Co gamma ray on the field a. The first times of growing (VKM1) This was laid out similarly to Experiment 3 but every replication grew 30 plants. The plantlets had 3.0 - 5.0 leaves, 5.0 - 10.0 cm height and 1.0 - 2.0 shoots. Every treatment was marked 3 points with 3 plants for collecting the data. - The experiment diagram was shown in Figure 3.4b and the cultivation process was conducted similarly to Experiment 3. * Experimental parameters: These were performed as the same as in Experiment 3, Part 3.2.4.1a. b. The second times of growing (VKM2): This was carried out similarly to Part 3.2.4.1b. 9
* Experimental parameters when 100% plants had spikes: These were done as in Part 3.2.4.1b. 3.2.4.3. DNA divergence analysis among tuberose varieties and mutants tuberose lines a. Genetic diversity evaluation by using ISSR - PCR technique Using 14 ISSR primers (Mengli et al., 2012; Khandagale et al., 2014) (Table 3.3). Table 3.3: List of ISSR primers used for research Primer Base sequence (5’- 3’) Primer Base sequence (5’- 3’) 3A01 (GA)8TC 808 (AG)8C 3A07 (AG)7CTT 836 (AG)8YA 3A21 (TG)7ACC 840 (AG)8YT 3A39 (CA)7GTA 842 (AG)8YG 3A42 (GACA)4C 855 (AC)8YT 3A62 (TG)7ACT 857 (AC)8YG UBC873 GACAGACAGACAGACA P23SR1 GGCTGCTTCTAAGCCAAC - The polymorphic DNA amplification products were visualized and determined the positions of new or absent DNA bands in the two mutant lines comparing with the control bands (the double petal type variety) (bp). Cluster analysis was performed on molecular similarity matrices using the Unweighted Pair Group Method using Arithmetic Means (UPGMA) algorithm, from which dendrograms depicting similarity among genotypes were drawn using NTSYS-pc. 2.1 Software (Rohlf, 2000). b. Sequencing ITS region: Using the pairs of bacteria primers (White et al., 1990): ITS1: 5’ - TCCGTAGGTGAACCTGCGG - 3’ ITS4: 5’ - TCCTCCGCTTATTGATATGC - 3’ - Testing the ITS by BLAST (Basic Local Alignmet Search Tool) on NCBI (National Center for Biotechnology Information) database to be sure that these sequences were Polianthes spp. Aligning these to determine the positions and types of DNA mutants. 10
Chapter IV: RESULTS AND DISCUSSIONS 4.1. Research content 1 4.1.1. The meristem survival rates of two tuberose varieties The survival rates of single petal tuberose variety were about 40% whereas the survival rates of double petal one had reached to 60% after 30 day culturing. 4.1.2. Callus and shoot clusters multiplication The alive meristems had been transfered into the shoot multiplication medium during 180 day period so that there were enough the samples for gamma radiation experiments. There were appearances of calli and shoots for both of the varieties at the same time. 4.2. Research content 2 4.2.1. Effects of 60Co gamma ray doses on the growth and the development of single petal tuberose callus clusters 4.2.1.1. Shoot regenerated rate At the 60 Gy dose, there was no any shoot initiated from calli. The 50 Gy tuberose plants gave the lowest rate of the shoot regeneration (about 6.0%). On the contrary, the highest average numbers of shoots were induced at the in vitro control treatment (90%). 4.2.1.2. The death rate of callus/shoot cluster There were 22% death rates of the calli/shoot clusters at the lowest irradiation dose (5 Gy). The death rates were about 50% when there was an increase of the radiation doses from 15 Gy to 50 Gy and at the 60 Gy, all of them died. 4.2.1.3. 50% lethal dose (LD50): The LD50 value of single petal tuberose variety had the counting value of 10.96 ± 2.96 Gy (Figure 4.1). 11
Probit Figure 4.1: The graph of percentage death (in probits) against log dose was plotted and the dose corresponding to probit of single petal tuberose variety at Linear regression 150 day culturing Note: Log-dose 4.2.1.4. Shoot number, shoot height and leaf number The application of 5 and 10 Gy of doses gave the best shoot number, shoot height and leaf length of tuberose. However, the treatments of 30 and 40 Gy showed less numbers of growth parameters. When plants were irradiated with 50 and 60 Gy, there was no increase of shoot number (Table 4.1). Gamma ray Shoot Shoot height Leaf Table 4.1: Shoot number, dose (Gy) number (cm) number shoot height and leaf 0 3.2b 6.4a 14.7b 5 4.2 a 6.2 ab 18.3a number of single petal b ab 10 3.5 5.9 17.5a tuberose after irradiating 15 2.5c 5.4b 11.0c 20 1.9d 3.9c 7.9d with gamma rays at 150 cd c e 25 2.0 3.8 3.7 day culturing 30 0.9e 3.7c 2.3ef Note: Values within column 40 0.5e 0.7d 1.2fi followed by different letters 50 0.0f 0.1d 0.07i are significantly different at 60 0.0f 0.0d 0.0i 5% probability level. F * * * CV (%) 22.9 21.4 26.0 4.2.1.5. Effects of 60Co gamma ray doses on the single petal tuberose abnormal structures There were 4 abnormal structures of single petal tuberose variety due to the impact of irradiating by different 60Co gamma doses. The in vitro control treatment had a normal shoot type; shoots with leaves sticking together and scrolling at some doses such as 5; 10; 15 and 20 Gy, and at the 12
doses 25; 30 and 40 Gy, shoots had twitch and scrolling leaves. The albino shoot type appeared only at the doses of 40 and 50 Gy. 4.2.2. Effects of 60Co gamma ray doses on the growth and development of the double petal tuberose shoot clusters 4.2.2.1. The death rate of shoot cluster At the lower dose of 40 Gy, the death rate of shoot clusters was less than 50%. This increased dramatically at 50 Gy dose and reached to 100% at 60 Gy. 4.2.2.2 50% lethal dose: The LD50 value of double petal tuberose variety had the counting value of 22.91 Gy ± 4.01 Gy (Figure 4.2). Probits Figure 4.2: The graph of percentage death (in probits) against log dose was plotted and the dose corresponding to Linear regression probit of double petal tuberose variety at 150 day culturing Note: Log-dose 4.2.2.3 Shoot number, shoot height and leaf number The shoot numbers had multiplied at doses of 5; 15 and 25 Gy during the culture time. Besides, the shoot height gained maximum values at 5 and 15 Gy treatments. Data regarding number of leaves showed the maximum values (about 21 leaves) in case of 52 Gy dose. The obtained results also indicated that the number of leaves still increased althought there was no increase of shoots and of their height at 60 Gy dose in 150 day culturing (Table 4.2). 13
Table 4.2: Shoot number, shoot height and leaf number of the double petal tuberose after irradiating by gamma rays at 150 day culturing Day Gamma 0 150 ray Shoot Shoot dose Shoot Leaf Shoot Leaf height height (Gy) number number number number (cm) (cm) 0 3.4 1.1 2.2 7.3a 5.4b 18.0b ab a 5 3.4 1.1 2.2 6.9 7.0 18.6ab bc b 10 3.4 1.0 2.2 6.3 6.0 20.1ab abc a 15 3.5 1.1 2.3 6.7 6.6 21.7a c c 20 3.3 1.1 2.3 6.1 6.2 10.5c c b 25 3.5 1.1 2.2 6.1 5.6 21.1a d d 30 3.4 1.1 2.2 4.8 2.7 4.6d de d 40 3.5 1.1 2.2 4.2 2.4 9.9c ef e 50 3.4 1.1 2.1 3.6 1.1 4.7d f e 60 3.4 1.1 2.1 3.4 1.2 3.2d F ns ns ns * * * CV (%) 6.4 3.6 8.6 10.6 13.3 21.8 Note: Values within the columns followed by different letters are significantly different at 5% probability level. 4.2.2.4. Effects of 60Co gamma ray doses on double petal tuberose abnormal structures The in vitro control and 5 Gy treatments had no mutation in leaves or shoots. There were the total of 6 abnormal phenotypes including shoots with twitch leaves (10 Gy); getting lost the chlorophyll and the earlier root information at 15 Gy shoots; the stunt shoots with saw-edged leaves at 20 Gy dose. There were the phenotypes with similar shoots, but those with scrolling leaves at the doses ranging of 25; 30; 40 and 50 Gy. Only at 60 Gy dose, all the shoot clusters turned brown. 4.2.3. Mass multiplication and root formation In the media for the single petal tuberose shoot multiplication, the total number of shoots produced per an explant was shown large, and they were green and vigor. The average number of induced shoots was 4.5 from 14
the first shoot after 30 days of this stage, except for the 25 and 30 Gy treatments. For the double petal tuberose variety/lines, the number of shoots produced per explant was larger (the average of 6.5 shoots) in the same medium at the in vitro control, 5 and 10 Gy treatment. The others gave the smaller shoot numbers (about 2.5 - 3.5 shoots). Both of 40 and 50 Gy doses of tuberose varieties had weaken shoots and died before root information. The rate of rooting about 95% for the single petal tuberose varieties/lines whereas about 97% for the double petal ones recorded in all of the treatments after 60 day culturing. 4.3. Research content 3 4.3.1. The death rate of single petal tuberose variety/lines The bulb control treatment had the lowest death rate of the plantlet numbers (3 plantlets). The in vitro control treatment had the highest rate about 10% (30 plantlets) the opposite. 4.3.2. The death rate of the double petal tuberose variety/lines In the double petal tuberose varieties/lines, the bulb control treatment still gave less of dead plantlets than the others did (just 3.0%). The obtained results indicated that the in vitro control and 5 Gy treatments gave the death percentage increasing up to 8.5 and 7.2% (over 20 plantlets), respectively. 4.3.3. The abnormal phenotypes of single/double petal tuberose varieties/lines All the mutant shoots with the above characteristics could not be regenerated into the normal plants at the in vitro stage and most of them gradually died. The alive plantlets indicated that the differences of leaf and shoot phenotypes were not clearly recognized. 4.4. Research content 4 4.4.1. The growth and flowering of single petal tuberose varieties/lines on the field (M1) - The death rate of plantlets 15
The higher the dose of radiation got, the higher the death rate of plantlets was after 60 day cultivating. Plantlets irradiated at the in vitro control treatment, 5 and 10 Gy showed the equal death rates of 4.0%. The 25 and 30 Gy doses were lethal to most of the plantlets (about 8%). - Shoot number, leaf number, bulb number and bulb diameter The growth of irradiated explants decreased when a higher dose of irradiation of gamma ray was treated. During the cultivation, this emphasis of growth was shown by both in number of shoots and number of leaves produced. The number of shoots produced on 5 Gy dose plantlets was a little smaller, whereas that of shoots sharply increased on the bulb control plantlets. The leaf numbers varied on different doses, from the average of 48.9 leaves to that of 130.3 leaves. The average bulb number of the 25 Gy was 14.5, the maximum value, and that of untreated plants was 13.5. The 25 Gy dose plants has the largest number of bulbs but the shoot and leaf numbers showed a significant difference compared to that among the treated plants and the two control ones. The biggest diameter of bulbs was about 4.1 cm, corresponding to the 15 and 25 Gy tuberose lines (Table 4.3). Gamma ray Shoot Leaf Bulb Bulb dose (Gy) number number number diameter (cm) Table 4.3: The growth Bulb control 9.4a 107.8b 13.5ab 3.0d parameters of single b a b In vitro control 7.3 130.3 13.0 3.4c petal tuberose lines de c c 5 5.1 89.7 11.5 3.3cd 10 7.0 bc 121.0 ab 10.9 c 2.7e after 180 day cd c d 15 5.6 89.6 8.3 4.1a cultivating de e e 20 4.2 48.9 6.4 3.1cd 25 4.7 de 80.9 cd 14.5 a 4.1a Note: Values within the 30 3.8 e 67.0 d 9.5 d 3.7b columns followed by different letters are F * * * * significantly different at CV (%) 14.1 9.1 7.1 4.4 5% probability level. - Flowering time, inflorescence height, floret number/spike and floret diameter The bulb control, 10 and 25 Gy treatments took minimum days (147.0) to initiate flowering as compared to the rest of the treatments, 16
whereas the in vitro control; 5; 20 and 30 Gy ones took maximum days (175.0) to produce flowers in its 25% plants. As far as the height of inflorescence was concerned, the 20 and 25 Gy lines produced inflorescence with the maximum height (118.0 and 122.7 cm) excelling those of the other treatments. Regarding the number of florets/spike, the 25 Gy plants produced 41.3 florets, more than those produced by the rest of the treatments. In spite of having the highest spike, the 20 Gy plants had the least number of florets (28.0). Data related to diameter of flower illustrated that bigger sized flowers (3.6 cm) were produced by 25 Gy line as compared to the rest of the treatments, whereas smaller sized ones (1.8 cm và 2.9 cm) were produced at 5 and 30 Gy doses. Because of the unopened flowers, the 5 Gy plants had florets with the smallest diameters (Table 4.4). Table 4.4: Flowering characteristics of single petal tuberose varieties/lines at the M1 generation Gamma ray Flowering Inflorescence Floret Floret diameter dose (Gy) time (days) height (cm) number/spike (cm) Bulb control 147.7a 91.0d 36.0abc 3.0b bc cd cd In vitro control 175.3 103.0 31.3 3.0b bc bc bcd 5 175.0 107.3 34.0 1.8c a bc abc 10 152.7 108.7 36.0 3.5a 15 162.0ab 108.0bc 40.7ab 3.5a bc ab d 20 177.7 118.0 28.0 3.1b a a a 25 155.7 122.7 41.3 3.6a c bc cd 30 181.3 110.0 30.7 2.9c F * * * * CV (%) 5.8 6.3 10.7 6.8 Note: Values within the columns followed by different letters are significantly different at 5% probability level. - The abnormal characteristics of the single petal tuberose varieties/lines after irradiating with 60Co gamma + At leaf part: There were 7 leaf phenotypes of single petal tuberose lines after 60 day cultivating. Both of the control treatments with normal 17