zunia.vn

Tuyển sinh 2024 dành cho Gen-Z

zunia.vn

» Luận Văn - Báo Cáo

» Báo cáo khoa học

Báo cáo nông nghiệp:" Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột"

Chia sẻ: Nguyễn Phương Hà Linh Linh | Ngày: | Loại File: PDF | Số trang:7

Báo xấu

77
lượt xem 3
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Để xác định ảnh hưởng của Mucuna pruriens (MP) đến sự biểu hiện của một số gen tổng hợp catecholamine, nghiên cứu này xác định sự thay đổi của hàm lượng mRNA và protein của tyrosine hydroxylase (TH) và aromatic l- amino acid decarboxylase (AADC). TH là enzyme thứ nhất và AADC là enzyme...

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Báo cáo nông nghiệp:" Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột"

J. Sci. Dev. 2011, 9 (Eng.Iss. 1): 84 - 90 HANOI UNIVERSITY OF AGRICULTURE EFFECT OF MUCUNA PRURIENS ON CATECHOLAMINE BIOSYNTHETIC ENZYME GENE EXPRESSION IN RAT BRAIN Ảnh hưởng của Mucuna pruriens đến sự biểu hiện gen tổng hợp catecholamine trên mô não chuột Nguyen Thi Hiep1, Truong Thi Thanh Mai2, Bui Thai Hang1, Kim Sung Jun3 1 College of Food Industry, Da Nang City, Vietnam 2 College of Education – University of Danang, Da Nang City, Vietnam 3 College of Science, Chosun University, Gwang ju, Korea Corresponding author email: bluebio203@gmail.com Received date: 13.04.2011 Accepted date: 05.05.2011 TÓM TẮT Để xác định ảnh hưởng của Mucuna pruriens (MP) đến sự biểu hiện của một số gen tổng hợp catecholamine, nghiên cứu này xác định sự thay đổi của hàm lượng mRNA và protein của tyrosine hydroxylase (TH) và aromatic l- amino acid decarboxylase (AADC). TH là enzyme thứ nhất và AADC là enzyme thứ hai trong chu trình tổng hợp catecholamine. Hàm lượng mRNA của TH và AADC được xác định trong mô não của chuột bằng kỹ thuật RT- PCR. Hàm lượng protein được xác định bằng kỹ thuật Western blot. Chuột được nghiên cứu với liều lượng MP khác nhau (0, 100, 200, 300 và 400 mg/kg) lần lượt trong thời gian 2 giờ và 4 giờ. Kết quả chỉ ra rằng MP làm tăng cả hàm lượng mRNA và protein của TH và AADC ở liều lượng 400 mg/kg trong 2 giờ và ở liều lượng 200 mg/kg trong 4 giờ. Kết quả này cho biết, MP có ảnh hưởng tích cực đến sự biểu hiện của TH và AADC gen và mức độ ảnh hưởng đó phụ thuộc vào liều lượng cũng như thời gian sử dụng MP. Từ khóa: AADC, biểu hiện gen, catecholamines, TH. SUMMARY To determine the effect of Mucuna pruriens (MP) on the catecholamine biosynthetic enzyme encoding genes, we determined changes in mRNA and protein levels of tyrosine hydroxylase (TH) and aromatic l- amino acid decarboxylase (AADC), the first rate – limiting and the second enzyme in the catecholamine biosynthetic pathway. TH and AADC mRNA levels were examined in rat brain tissue by RT- PCR. Protein levels were determined by Western blot analysis. Rats were treated with different doses of MP (0, 100, 200, 300 and 400 mg/kg) for 2 and 4 hrs.. The results showed that the MP significantly increased the levels of TH and AADC mRNA and protein at a dose of 400 mg/kg for 2 hrs and at a dose of 200 mg/kg for 4hrs, respectively. These results indicated that MP has significant effects on the expression of TH and AADC genes and the level of expression depends on the treatment dose and duration of administration. Key words: AADC, catecholamines, gene expression, TH. and epinephrine) called "catecholamines". 1. INTRODUCTION Tyrosine hydroxylase (TH) is the first and Parkinson’s disease (PD) is the most common rate-limiting enzyme in the biosynthesis of neurodegenerative movement disorder and affects catecholamines, which is neurotransmitter involved over six million people all over the world (Licker et in a variety of important physiological functions al., 2009). This disease is a degenerative disease of (Milsted et al., 2004). The regulation of TH protein the nervous system due to the progressive loss of level and activity represents a central means for nigrostriatal dopaminergic neurons and decrease in controlling catecholamine synthesis (Kumer et al., striatal dopamine. Dopamine is produced by 1996). Changes in TH expression generally reflect dopaminergic neuronal cells and is one of three altered activity of dopaminergic neurons in brain. main neurotransmitters (dopamine, norepinephrine 84
Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain The aromatic l- amino acid decarboxylase The fresh seeds of MP (from Gwang-ju city, (AADC) is the second enzyme in the catecholamine South of Korea) were collected by removing peel biosynthesis. AADC is a non-specific enzyme and then ground to a paste by grinder. This powder was kept in deep freezer -700C and freezing-dry. A mainly implicated in the synthesis of dopamine and serotonin through the decarboxylation of a substrates total of 100g of the dry powder was completely (L-DOPA), 5-hydroxytryptophan in neuronal and dissolved in 100ml of saline before use. non-neuronal cells (Yuichi Okazaki and Yoshikazu 2.2. Animal experiments Shizuri, 2001). Unlike other enzymes which are Male Sprague-Dawlay rats, 6 ~ 8 weeks of age involved in catecholamine biosynthetic pathway, and weights from 250~300g were used in all AADC is still generally considered not to be limiting in regulating of catecholamine biosynthesis. experiments. Animals were housed four per cage and Nevertheless, some recent studies concerning the under controlled environmental conditions (12 hrs light / dark cycle and room temperature 25 ± 2oC. regulation of AADC in vivo and in vitro through phosphorylation indicate that this enzyme may play Food and water were supplied all the time. Rats were the role in regulation of catecholamine biosynthesis treated by MP powder dissolved in saline with dose (Waymire and Haycock, 2002). The immobilization of 100, 200, 300 and 400 mg/kg each for 2 and 4 hrs stress stimulation induced also increases in TH and (each group = 5 rats). The control groups received AADC activity (Kubovcakova et al., 2004; the same volume of saline instead of MP. Micutkova et al., 2003). 2.3. Total RNA isolation and relative quantification Seeds of Mucuna pruriens (MP) have been of mRNA levels by Reverse transcriptase described as an useful therapeutic agent in various polymerase chain reaction (RT – PCR) diseases of the human nervous and reproductive system including PD in the ancient Indian medical Total RNA was isolated from frozen brain tissues by using the TrizolTM reagent (Invitrogen system (Manyam et al., 2004). MP contains L-dopa (5%), 5-indole compounds (tryptamine and 5- Co. USA). Reverse transcription was performed hydroxytriptamine), and four tetrahy- from 4 μg of total RNA samples using oligo (dT) droisoquinolines alkaloidals (Eustace et al, 2006; primer and Moloney murine leukemia virus Misra and Wagner, 2004). In addition, MP consists ribonuclease (M-MLV) (BioNEER co. Korea) of co-enzyme Q-10 and nicotinamide adenine according to the manufacturer’s instructions. dinucleotide (NADH), which have neuroprotective Quality of cDNA was verified by PCR activities (Manyam et al., 2004). amplification of β-actin. The cDNA was stored at - Although many researches have focused on 20oC for further using. the therapeutic effects of natural plant extracts, The determining of catecholamine however, until now, there are few researches on synthesizing enzymes, TH, AADC as well as genetic analysis of catecholamine biosynthetic housekeeper β-actin gene expression was carried enzyme genes induced by MP. Therefore, in this out by RT-PCR. Specific primers, annealing study, we analyzed the effects of MP on the gene temperatures, number of cycles and size of each expression of TH and AADC, the first rate – fragment for TH, AADC and β-actin mRNA are limiting and the second enzyme in the shown in table 1. PCR products were analyzed on catecholamine biosynthetic pathway, 1.2% agarose gel in 0.5 X TBE (Tris-Boric acid- EDTA) buffers containing EtBr. Intensity of 2. MATERIALS AND METHODS individual bands was evaluated by Gel Quant software (DNR Bio-Imaging Systems Ltd.). 2.1. MP sample preparation Table 1. Oligonucleotide sequence of primers used in PCR for amplification Temp.of No. of Size of Gene Genes Sequences of primers annealing cycles fragment Reference 5’ GCTGTCACGTCCCCAAGGTT 3’ 0 TH 64 C/45’’ 35 380bp M10244 3’ TCAGACACCCGACGCACAGA 5’ 5’ CTTCAGATGGCAACTACTCC 3’ 0 AADC 60 C/45’’ 35 345 bp U31884 3’ CTTCGGTTAGGTCAGTTCTC 5’ 5’ CCTCTATGCCAACACAGT 3’ 0 β-actin 56 C/45’’ 30 155 bp BC063166 3’ AGCCACCAATCCACACAG 5’ 85
Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun Table 2. Antibodies used for western blot assay Antibodies Species Dilution Source Primary antibodies Anti-TH (0MA-04051) Mouse (monoclonal IgG1) 1:2000 Affinity Bio Reagents Anti-AADC (ab3905) Rabbit polyclonal 1:1000 Abcam plc Actin Mouse (monoclonal IgG1) 1:2000 Biomeda crop. Secondary antibodies HRP conjugated(Sc-2054) Goat-anti-mouse IgG1 1:1000 Santa Cruz Biotechnology HRP conjugated(Sc-2055) Goat-anti-rabbit IgG1 1:1000 Santa Cruz Biotechnology exposed to X-ray film (BioMax MS-1, Eastman 2.4. Total protein isolation and western blot analysis Kodak). A digital image system was used to determine the density of the bands (Gel Quant, Total protein was separated in the organic DNR Bio-Imaging Systems Ltd.). phase during the preparation of total RNA and subsequently precipitated with isopropanol, and 2.5. Statistical analysis then it was washed three times with 0.3 M Data were presented as mean ± S.E.M. Results guanidine hydrochloride. After washing with 70% were evaluated by Student’s test and by one- way ethanol, protein was dried and dissolved in 1% analysis of variance (ANOVA). A value of P ≤ 0.05 SDS. Protein concentration was determined by was considered statistically significant. using a Bicinchoninic acid (BCA) protein assay kit (Cabres Co. USA). Bovine serum albumin (BSA) (Sigma-Aldrich Co. USA) was used as the 3. RESULTS standard. 3.1. Effects of MP on TH and AADC mRNA levels Total 10 μg of protein isolated from brain expression in rat brain tissue tissue was separated by sodium dodecyl sulphate- polyarylamide gel (SDS-PAGE; 5% stacking gel To determine the effects of MP on the and 10.5% separating gel) and then transfered to a catecholamine biosynthetic enzyme genes, we polyvinylidene fluoride (PVDF) membrane. Non- determined changes in mRNA level of TH and specific binding sites were blocked by immersing AADC, the first rate-limiting and the second the membranes in 3% BSA in Tris- buffered saline enzyme in this pathway. TH and AADC mRNA Tween (TBST) for overnight at 4oC on a shaker. levels were examined by RT-PCR. Rats were Levels of the TH and AADC immunoreactive treated with different doses of MP (0, 100, 200, protein were determined using TH and AADC 300, and 400 mg/kg) each for 2 and 4 hrs. As primary antibody (Table 2). After membranes shown in Fig.1 and Fig. 2, TH and AADC mRNA washed several times with washing buffer TBS-T, levels increased in dose-dependent manner. the membranes were incubated with primary anti- However, the AADC mRNA level was less than TH and AADC antibody for 2hrs at 4oC, followed TH mRNA level. In particular, at 2 hrs TH mRNA by incubation with secondary antibodies (Table 2) increased by 2.2 ± 3 folds (P
Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain Con Con 100 200 300 400 (mg/kg) 380 pb TH 345 pb AADC 150 pb β-actin TH AADC 2.5 ** ** RRelative gene expression n ** ela tiv e g en e ex p ressio ** 2.0 1.5 1.0 0.5 0.0 400 (㎎/㎏) Con 100 200 300 Figure. 1. The effects of MP on the TH and AADC mRNA levels in rat brain tissue at after 2hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one-way ANOVA and Tukey’s test: *P
Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun increased highly significantly at a dose of 100 mg/kg 3.2. Effect of MP on TH and AADC protein level by 2.53 times. But only doses of 200 mg/kg and 300 expression in rat brain tissue mg/kg have significantly upregulated the TH protein The protein levels of TH and AADC were for 4hrs, while doses of 100 mg/kg and 400 mg/kg determined by western blot analysis at 2 and 4 hrs showed the down regulation (Fig. 4). AADC protein after treatment. All different doses of MP induced levels did not change at different doses of MP in the TH and AADC protein levels at 2hrs. TH protein 4hrs treatment. The above results indicate that TH levels increased significantly at 1.34, 5.62, 6.92 and AADC protein levels were significantly up and 9.74 folds with the doses of 100, 200, 300, 400 regulated with the treatment of MP. mg/kg, respectively (Fig. 3), AADC protein levels TH AADC ** 10 Relative protein levels Relative protein levels 8 ** 6 4 ** * 2 0 400 (㎎/㎏) Con Con 100 200 300 Figure. 3. The effects of MP on the TH and AADC protein levels in rat brain tissue at after 2hrs treatment. Values (n=5/group) are presented as mean ± S.E and compared by one- way ANOVA and Tukey’s test: *P
Effect of Mucuna pruriens on catecholamine biosynthetic enzyme gene expression in rat brain genes depends on MP doses and duration of 4. DISCUSSION administration. Thus, MP may provide a platform The seed powder of MP has been used in for future drug discoveries and novel therapy traditional Ayurvedic India medicine for disease strategies for PD. therapy including PD. All compounds of MP seed Acknowledgements have been identified by several studies (Eustace et This work was support by a reseach grant al., 2006; Misra 2004). These researches showed provied by Chosun University, 2007. that MP has high contents of crude protein, amino acids, total phenols, tannins and, especially, L- dopa. In additional, MP contains co-enzyme Q-10 REFERENCES and nicotinamide adenine dinucleotide (NADH), Christopher A. Lieu, R. Kunselman Allen, which have neuroprotective activities (Manyam et V.Manyam Bala, Venkiteswaran Kala, and al., 2004). MP treatment is known to increase the Subramanian Thyagarajan. (2010). A water dopamine content in the rat brain and MP exhibited extract of Mucuna pruriens provides long – term twice the antiparkinsonian activity compared with amelioration of parkinsonism with reduced risk synthetic levodopa (Manyam et al., 2004). for dyskinesias. Parkinsonism and related Furthermore, synthetic levodopa causes drug – disorders. 16: 458 – 465. induced dyskinesias in majority of patients with Duan Chun- Li, Yue Su, Chun –Li Zhao, Qun – PD. MP, however, is reputed to provide anti- Yuan Xu and Hui Yang.(2005). The assays of parkinsonian benefits without inducing dyskinesias activities and function of TH, AADC and GCH1 (Christopher et al., 2010). and their potential use in ex vivo gene therapy of The regulation of TH and AADC expression PD. Brain Research Protocols. 16: 37 – 43. has attracted much attention in the field of Eustace A lyayi, Holger Kluth and Markus neurology. Indeed, the biological function of TH Rodehutscord.(2006). Chemical composition, and AADC is very important for the dopamine antinutritional constituents, precaecal crude biosynthesis as well as for brain function under protein and amino acid digestibility in three physiological and pathological conditions. The unconventional tropical legumes in broilers. J study of Duan et al., (2005) found that the Sci Food Agric. 86: 2166 – 2171. expression of TH and AADC genes could fulfill the Katzenschlarger R, Evans A, Manson A, P N function of dopamine synthesis. The present study Patsalos, N Ratnaraj, H Watt, L Timmermann, R was carried out to evaluate the effects of MP on the Van der Geissen, A J Lees.(2004). Mucuna catecholamine biosynthetic enzyme genes, pruriens in Parkinson’s disease: a double blind particularly TH and AADC. The results showed chinical and pharmacological study. J Neuol that the levels of TH mRNA and protein increased Neurosurg Psychiatry.75: 1672 -1677. significantly at different doses of MP at both 2hrs Kumer S.E. and K. E. Vrana (1996). Intricate and 4hrs treatment. Similarly, the AADC mRNA regulation of tyrosine hydroxylase activity and and protein levels rose slightly at different doses of gene expression. Jounal of neurochemistry. 67: MP at 2hrs treatment. In contrast, the level of 443-462. AADC protein did not change at different doses of MP at 4hrs after treatment. The levels of TH Kubovcakova L., O. Krizanova and R. Kvetnansky mRNA and protein are always higher than those of (2004). Identification of the aromatic L-amino AADC at different doses of MP during the acid decarboxylase gene expression in various treatment period. These results indicate that MP has mice tissued and its modulation by a complex and different effect on TH and AADC immobilization stress in stellate ganglia. Jounal gene expression in the rat brain tissue. of neuroscience.126: 375-380. Licker V, E Kovari, D. F. Hochstrasser, P. R. 5. CONCLUSIONS Burkhard (2009). Proteomics in human Parkinson’s disease research. J Proteomics 73: The present study shows that both 10-29. catecholamine biosynthetic enzymes encoding Manyam B.V., M. Dhanasekaran., and T.A. Hare genes TH and AADC were up – regulated by the (2004). Neuroprotective effects of the treatment of MP. The expression of TH and AADC 89
Nguyen Thi Hiep, Truong Thi Thanh Mai, Bui Thai Hang, Kim Sung Jun Antiparkinson drug Mucuna Pruriens. Jounal of of Mucuna pruriens seeds. Phytochemistr. 65: Phytotherapy Research. 18: 706-172. 2565 - 2567. Manyam B.V., M. Dhanasekaran, and T. Hare Yuichi Okazaki and Yoshikazu Shizuri. (2001) (2004). Effect of antiparkison drug HP-200 Identification of the aromatic l- amino acid (Mucuna pruriens) on the central decarboxylase (AADC) gene and its expression monoaminergic neurotransmitters. Phytother in the attachment and metamorphosis of the Res. 18: 97-101. barnacle, Balanus amphitrite. J develop Growth Differ. 43: 33 – 41. Milsted A., L. Serova, E.L. Sabban, and G. Dunphy (2004). Regualtion of tyrosine hydroxylase gene Waymire J.C., and J.W. Haycock (2002). Lack of transcription by Sry. Neuroscience Letters. 369: regulation of aromatic L-amino acid 203-207. decarboxylase in intact bovine chromaffin cells. Jounal of Neurochemistry. 81:589-593. Misra L. and H. Wagner (2004). Alkaloidal constituents 90

CÓ THỂ BẠN MUỐN DOWNLOAD

LV.26: Bộ 320 Luận Văn Thạc Sĩ Y Học

320 tài liệu

1253 lượt tải

THÔNG TIN

TRỢ GIÚP

HỖ TRỢ KHÁCH HÀNG

Theo dõi chúng tôi

Chịu trách nhiệm nội dung:

Nguyễn Công Hà - Giám đốc Công ty TNHH TÀI LIỆU TRỰC TUYẾN VI NA

LIÊN HỆ

Địa chỉ: P402, 54A Nơ Trang Long, Phường 14, Q.Bình Thạnh, TP.HCM

Hotline: 093 303 0098

Email: support@tailieu.vn

Giấy phép Mạng Xã Hội số: 670/GP-BTTTT cấp ngày 30/11/2015 Copyright © 2022-2032 TaiLieu.VN. All rights reserved.