Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:9

Thêm vào BST

Báo xấu

5
lượt xem 1
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt trình bày việc sử dụng kết hợp các nghiên cứu dược lý như biểu hiện quá mức có chọn lọc của PACAP, knock-down gen PACAP ở vùng giữa bụng dưới đồi và đánh giá thức ăn thu nhận ở chuột nhắt.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt

Vietnam J. Agri. Sci. 2023, Vol. 21, No. 1: 31-39 Tạp chí Khoa học Nông nghiệp Việt Nam 2023, 21(1): 31-39 www.vnua.edu.vn Nguyễn Thành Trung1*, Yuki Kambe2, Trần Thị Ánh1, Nguyễn Mạnh Tường1 1 Khoa Thú y, Học viện Nông nghiệp Việt Nam 2 Trường Đại học Kagoshima, Nhật Bản * Tác giả liên hệ: nguyenthanhtrung@vnua.edu.vn Ngày nhận bài: 31.10.2022 Ngày chấp nhận đăng: 27.01.2023 TÓM TẮT Nicotine là một trong những nguyên nhân gây giảm tính thèm ăn. Nhiều báo cáo đã chỉ ra các cơ chế sinh học thần kinh cơ bản của tác động chán ăn của việc hút thuốc lá thông qua các thụ thể nicotine ở não bộ. Tuy nhiên, nicotine có thể hoạt động thông qua một con đường bổ sung do polypeptide kích hoạt cyclase adenylate tuyến yên (PACAP) điều chỉnh trong não bộ hay không vẫn chưa được xác định. Trong nghiên cứu này, chúng tôi sử dụng kết hợp các nghiên cứu dược lý như biểu hiện quá mức có chọn lọc của PACAP, knock-down gen PACAP ở vùng giữa bụng dưới đồi (VMH) và đánh giá thức ăn thu nhận ở chuột nhắt. Kết quả cho thấy, liều lượng nicotine phụ thuộc nồng độ làm giảm lượng thức ăn thu nhận ở những con chuột được điều trị hàng ngày trong 5 ngày liên tiếp. Ngoài ra, với tác dụng ức chế cho ăn ở chuột nhắt trắng bị knock-out gen PACAP được quan sát rõ rệt hơn. Hơn nữa, sự biểu hiện quá mức của PACAP trong vùng VMH làm tăng sự biểu hiện của a4 của nicotine. Cùng với đó, sự knock- down gen PACAP trong VMH làm giảm sự biểu hiện của a4. Tóm lại, sự biểu hiện của nicotine thụ thể a4 ở vùng dưới đồi có thể được điều chỉnh bởi gen PACAP trong VMH. Từ khóa: Nicotine, thức ăn thu nhận, trọng lượng, PACAP, chuột nhắt. The Crosstalk Between nicotine and PACAP in the Appetite Regulation in the Mouse Hypothalamus ABSTRACT Nicotine is one of the causes of suppressed appetite. Many reports have shown the underlying neurobiological mechanisms of the anorexia effects of cigarette smoking through nicotine receptors in the brain. However, whether nicotine may act through an additional pathway regulated by polypeptide pituitary adenylate cyclase (PACAP) in the brain is yet to be determined. To address these issues, we used pharmacological combination such as overexpression, knockdown PACAP gene in VMH and feeding in this study. At first, we found that dose-dependent nicotine decreased the food intake in mice treated daily for 5 days. In addition, more pronounced effects of inhibition feeding were observed in PACAP knockout mice. Furthermore, overexpression of PACAP in the VMH increased the expression while knockdown of PACAP in the VMH decreased the expression of α4 of Nicotine. Taken together, these results suggested that the expression of α4 receptor of Nicotine in the hypothalamus might be regulated by PACAP in the VMH. Keywords: Nicotine, food intake, body weight, PACAP, mouse. 31
Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt       -  - -   µ 32
Nguyễn Thành Trung, Yuki Kambe, Trần Thị Ánh, Nguyễn Mạnh Tường ′ ′   ′ ′  Gen Tên mồi Trình tự (5’-3’) Nguồn 2 F GGTCGTCACCATCATCATC Taillebois & cs. (2014) R CCACGACGGTATCTTGTGC 4 F TGAGAATGTCACCTCCATCAGG Kedikian & cs. (2013) R CTTTGCGGTGACTCACTTGACA 7 F CCGACATCACAGGATACATTGC R GGTAGACGGAATGAGAGGTTCT 2 F TGGAGCCCAGAAGAGTTTGATG R CTCCAATGCTGTCGTCTCCTAT 4 F CTACAGGAAGCATTAGAGG Smith & cs. (2014) R CAGAATACACACAATCACG GAPDH F GAAGGTCGGTGTGAACGGAT Kambe & cs. (2021) R CTCGCTCCTGGAAGATGGTG 33
Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt ± ä ≤ µ × ± - - µ µ µ µ µ 34
Nguyễn Thành Trung, Yuki Kambe, Trần Thị Ánh, Nguyễn Mạnh Tường                 35
Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt PACAP 2 4 12.5 1.25 1.25 * 10.0 1.00 1.00 PACAP/GAPDH 4/GAPDH 2/GAPDH 7.5 0.75 0.75 5.0 0.50 0.50 2.5 0.25 0.25 0.0 0.00 0.00 EGFP PACAP EGFP PACAP EGFP PACAP 7 2 4 1.25 1.25 1.5 1.00 1.00 2/GAPDH 7/GAPDH 4/GAPDH 1.0 0.75 0.75 0.50 0.50 0.5 0.25 0.25 0.00 0.00 0.0 EGFP PACAP EGFP PACAP EGFP PACAP         ä 36
Nguyễn Thành Trung, Yuki Kambe, Trần Thị Ánh, Nguyễn Mạnh Tường        PACAP 2 4 1.25 3.5 1.25 3.0 1.00 1.00 PACAP/GAPDH 2.5 * 2/GAPDH 4/GAPDH 0.75 0.75 2.0 0.50 1.5 0.50 1.0 0.25 0.25 0.5 0.00 0.0 0.00 Scramble ShPACAP Scramble ShPACAP Scramble ShPACAP 7 2 4 1.25 1.25 6 1.00 1.00 5 7/GAPDH 2/GAPDH 4/GAPDH 4 0.75 0.75 3 0.50 0.50 2 0.25 0.25 1 0.00 0.00 0 Scramble ShPACAP Scramble ShPACAP Scramble ShPACAP      37
Sự giao tiếp chéo giữa nicotine và PACAP trong điều hòa tính thèm ăn ở vùng dưới đồi của chuột nhắt in the hypothalamic arcuate nucleus of obese tub/tub mice. Synapse. 52(4): 245-57. Breslau N. (1995). Psychiatric comorbidity of smoking and nicotine dependence. Behav Genet. 25(2): 95-101. Brunzell D.H., Stafford A.M. & Dixon C.I. (2015). Nicotinic receptor contributions to smoking: insights from human studies and animal models. Current addiction reports. 2(1): 33-46. Burling T.A. & Ziff D.C. (1988). Tobacco smoking: a comparison between alcohol and drug abuse inpatients. Addict Behav. 13(2): 185-90. Decker M.W., Brioni J.D., Bannon A.W. & Arneric S.P. (1995). Diversity of neuronal nicotinic acetylcholine receptors: lessons from behavior and implications for CNS therapeutics. Life Sci. 56(8): 545-70. Fulkerson J.A. & French S.A. (2003). Cigarette smoking for weight loss or control among adolescents: gender and racial/ethnic differences. J Adolesc Health. 32(4): 306-13. Grunberg N.E. (1982). The effects of nicotine and cigarette smoking on food consumption and taste Albanes D., Jones D. Y., Micozzi M. S. & Mattson M. preferences. Addict Behav. 7(4): 317-331. E. (1987). Associations between smoking and body Hughes J.R., Higgins S.T. & Bickel W.K. (1994). weight in the US population: analysis of NHANES nicotine withdrawal versus other drug withdrawal II. Am J Public Health. 77(4): 439-44. syndromes: similarities and dissimilarities. Aurnhammer C., Haase M., Muether N., Hausl M., Addiction. 89(11): 1461-70. Rauschhuber C., Huber I., Nitschko H., Busch U., Jang M.H., Shin M.C., Lim B.V., Chung J.H., Kang Sing A., Ehrhardt A. & Baiker A. (2011). H.S., Kang S.A., Choue R.W., Kim E.H. & Kim Universal Real-Time PCR for the Detection and C.J. (2002). nicotine administration decreases Quantification of Adeno-Associated Virus nitric oxide synthase expression in the Serotype 2-Derived Inverted Terminal Repeat hypothalamus of food-deprived rats. Neurosci Lett. Sequences. Human Gene Therapy Methods. 322(1): 29-32. 23(1): 18-28. Kambe Y., Yamauchi Y., Thanh Nguyen T., Thi Bäckberg M. & Meister B. (2004). Abnormal Nguyen T., Ago Y., Shintani N., Hashimoto H., cholinergic and GABAergic vascular innervation Yoshitake S., Yoshitake T., Kehr J., Kawamura N., 38
Nguyễn Thành Trung, Yuki Kambe, Trần Thị Ánh, Nguyễn Mạnh Tường Katsuura G., Kurihara T. & Miyata A. (2021). The Peptide in Mice. Molecular Neurobiology. pivotal role of pituitary adenylate cyclase- 57(4): 2101-2114. activating polypeptide for lactate production and Nisell M., Nomikos G.G. & Svensson T.H. (1995). secretion in astrocytes during fear memory. nicotine dependence, midbrain dopamine systems Pharmacol Rep. 73(4): 1109-1121. and psychiatric disorders. Pharmacol Toxicol. Kedikian X., Faillace M.P. & Bernabeu R. (2013). 76(3): 157-62. Behavioral and Molecular Analysis of Nicotine- Perkins K.A., Epstein L.H., Sexton J.E., Solberg- Conditioned Place Preference in Zebrafish. PLOS Kassel R., Stiller R.L. & Jacob R.G. (1992). ONE. 8(7): e69453. Effects of nicotine on hunger and eating in male Levin E.D., Morgan M.M., Galvez C. & Ellison G.D. and female smokers. Psychopharmacology (Berl). (1987). Chronic nicotine and withdrawal effects on 106(1): 53-9. body weight and food and water consumption in Rudecki A.P. & Gray S.L. (2016). PACAP in the female rats. Physiol Behav. 39(4): 441-4. Defense of Energy Homeostasis. Trends in Meister B., Gömüç B., Suarez E., Ishii Y., Dürr K. & Endocrinology & Metabolism. 27(9): 620-632. Gillberg L. (2006). Hypothalamic Smith M.L., Souza F.G.O., Bruce K.S., Strang C.E., proopiomelanocortin (POMC) neurons have a Morley B.J. & Keyser K.T. (2014). Acetylcholine cholinergic phenotype. Eur J Neurosci. receptors in the retinas of the á7 nicotinic 24(10): 2731-40. acetylcholine receptor knockout mouse. Molecular Mineur Y.S., Abizaid A., Rao Y., Salas R., DiLeone vision. 20: 1328-1356. R.J., Gündisch D., Diano S., De Biasi M., Horvath Taillebois E., Beloula A., Quinchard S., Jaubert- T.L., Gao X.B. & Picciotto M.R. (2011). nicotine Possamai S., Daguin A., Servent D., Tagu D., decreases food intake through activation of POMC Thany S. H. & Tricoire-Leignel H. (2014). neurons. Science. 332(6035): 1330-2. Neonicotinoid Binding, Toxicity and Expression of Nguyen T.T., Kambe Y., Kurihara T., Nakamachi T., Nicotinic Acetylcholine Receptor Subunits in the Shintani N., Hashimoto H. & Miyata A. (2020). Aphid Acyrthosiphon pisum. PLOS ONE. Pituitary Adenylate Cyclase-Activating 9(5): e96669. Polypeptide in the Ventromedial Hypothalamus Is Tao Y.X. (2010). The melanocortin-4 receptor: Responsible for Food Intake Behavior by physiology, pharmacology, and pathophysiology. Modulating the Expression of Agouti-Related Endocr Rev. 31(4): 506-43. 39