intTypePromotion=1
zunia.vn Tuyển sinh 2024 dành cho Gen-Z zunia.vn zunia.vn
ADSENSE

The medical doctoral thesis: Study on histopathological fearures, immunohistochemistry and methylation of rassf1a gene in prostate cancer

Chia sẻ: _ _ | Ngày: | Loại File: DOCX | Số trang:29

22
lượt xem
3
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Do the following: Study on some histopathological features of prostate carcinoma at Military Hospital 103 according to the 2004 WHO classification. Determine the expression of some immunological markers and methylation status of the RASSF1A gene and compare with some histopathological features in prostate carcinoma.

Chủ đề:
Lưu

Nội dung Text: The medical doctoral thesis: Study on histopathological fearures, immunohistochemistry and methylation of rassf1a gene in prostate cancer

  1. MINISTRY OF EDUCATION  MINISTRY OF  AND TRAINING NATIONAL DEFENSE MILITARY MEDICAL UNIVERSITY  ­­­­­­­­­ VI THUAT THANG STUDY ON HISTOPATHOLOGICAL FEARURES,  IMMUNOHISTOCHEMISTRY AND METHYLATION OF RASSF1A GENE IN PROSTATE CANCER Speciality: Biomedical Sciences  Code: 9720101 THE MEDICAL DOCTORAL THESIS
  2. Ha Noi – 2018WORKS ARE COMPLETED AT  MILITARY MEDICAL UNIVERSITY  Name of supervisors:  1. Prof. Dr. Nguyen Dinh Tao, MD. Ph.D 2. Dr. Nguyen Ngoc Hung, MD. Reviewer 1: Assoc. Prof. Nguyen Van Hung, MD. Ph.D. Reviewer 2:  Assoc. Prof. Quan Hoang Lam, MD. Ph.D. Reviewer 3:  Assoc. Prof. Trinh Tuan Dung, MD. Ph.D. The   thesis   will   be   protected   before   the   Board   of   thesis  dissertation on the day:    /    /    A thesis can be found at: 1. National Library 2. Library of the Military Medical University
  3. 3 INTRODUCTION TO THESIS 1. Set the problem Prostate cancer (Pca) is common in men over age of 65, the  disease   is   occult.   Most   cases   were   detected   accidentally   by  histopathological examination. In Vietnam, the standard age rate in  2012 was 3.4/100000 people and queued the 10 th  in cancer in men.  Pca   can   be   treated   effectively   if   the   disease   is   detected   early.  Therefore, the finding of early detection methods, accurate diagnosis,  proper assessment of histopathological lesions by a standard and a  uniform classification is essential to the development of therapeutic  approaches and prognosis of this disease. Several   studies   have   shown   that   the  RASSF1A  gene  methylation occurs at an early stage in the formation and progression  of   the   Pca.   Thus,  RASSF1A  gene   methylation   marker   is   being  considered to Pca. In Vietnam, studies on DNA methylation in cancer  have   been   carried   out   lately,   histopathological   and  immunohistochemistry studies of Pca according to the 2004 World  Health Organization (WHO) classification of tumors of the prostate  are lacking. Based on that, we do the following: a.   Study   on   some   histopathological   features   of   prostate  carcinoma   at   Military   Hospital   103   according   to   the   2004   WHO  classification. b. Determine the expression of some immunological markers  and methylation status of the RASSF1A gene and compare with some  histopathological features in prostate carcinoma. 2. New contributions of the thesis +   Study   on  RASSF1A  methylation   status   in   some   cases   of  adenocarcinoma of the prostate. +   Compare  RASSF1A  methylation   status   with   some  histopathological features in prostate carcinoma. +   Simultaneous   staining   using   antibodies   against  PSA,  CK34betaE12, p63, CK7, CK5/6 and actin in prostate carcinoma. 3. Structure of the thesis
  4. 4 The   thesis   is   135   pages   including:   Introduction   (2   pages);  Chapter 1­ Document overview: 40 pages; Chapter 2­ Subjects and  Methods: 20 pages; Chapter 3­ Research results: 31 pages; Chapter 4­  Discussion: 40 pages; Conclusion: 2 pages; Request: 1 page; List of  articles:   1   page.   The   thesis   has   27   tables   of   data,   1   diagram,   13  figues, 25 images, 148 references (25 in Vietnamese, 123 in English),  annexes to research forms and patient lists. Chapter 1. OVERVIEW OF DOCUMENTS 1.1.   A   brief   description   of   the   histology   of   the   prostate   and  classification of prostate cancer 1.1.1. Histology Histologically   the   structure   of   prostate   consists   of   acinus,  branched ducts and prostate urethral ducts. The acinus and ducts are  lined by an secretary inner cell layer and an outer basal cell layer.  The   prostate   gland   does   not   have   myoepithelium,   the   acinus   and  ducts   are   surrounded   by   smooth   muscle,   fibroblasts   and   collagen  fibers. The acinus and ducts contain faint pink secretions and corpora  amylacea. The main ducts are lined by urothelial epithelium. 2.1.2. The   2004   WHO   histological   classification   of   tumours of the prostate   Carcinoma   of   the   prostate   including   adenocarcinoma,  urothelial carcinoma, squamous cell carcinoma, basal cell carcinoma. 1.2. Carcinoma of the prostate, prostatic intraepithelial neoplasia  and Gleason grading system 1.2.1. Adenocarcinoma of the prostate  *   Adenocarcinoma:   Gland­forming   Pca   typically   contain  glands   that   are   more   crowded   than   in   benign   prostatic   tissue,  although   there   is   overlap   with   certain   benign   mimickers   of   Pca.  Glands   of   adenocarcinoma   of   the   prostate   typically   grow   in   a  haphazard fashion. Glands oriented perpendicular to each other and  glands   irregularly   separated   by   bundle   of   smooth   muscle   are  indicative of an infiltrative process. Another pattern characteristic of  an infiltrative process is the presence of small atypical glands situated  in   between   larger   benign   glands   with   the   loss   of   glandular 
  5. 5 differentiation   and   the   formation   of   cribriform   structures,   fused  glands,   and   poorly   formed   glands   the   distinction   between   benign  glands   based   on   the   architectural   pattern   becomes   more   apparent.  Tumors   composed   of   soild   sheets,   cords   of   cells,   or   isolated  individual cells characterized  undifferentiated Pca. Nuclei in Pca range from those indistinguishable from benign  prostatic   epithelium   to   those  with   overt   malignancy.   In   most   Pca,  there   are   cytological   difference   in   the   malignant   glands   when  compared   to   the   surrounding   benign   glands.   Nuclear   enlargement  with prominent nucleoli is a frequent the finding, althouth not every  cancer cell will display these features. Some neoplastic nuclei lack  prominent nucleoli, yet are enlarged and hyperchromatic. Pca nuclei,  even   in   cancers   which   lack   glandular   differentiation,   show   little  variability   in   nuclear   shape   or   size   from   one   nucleus   to   another.  Mitotic figures may be relatively common in high grade cancer, yet  are infrequent in lower grade tumors. The cytoplasm is brighter than  the benign gland. The acinus may contain crystals, pink secretions or  mucus. It can be seen that perineural invasion, mucinous fibroplasia,  glomerulations. * Primary urothelial carcinoma: the vast majority are high grade  and are associated with an in situ components. A single cell pattern of  pagetoids spreads or burrowing of tumor cells between the basal cell and  secretary   cell   layers   of   the   prostate   is   characteristic.   With   extensive  tumor involvements, urothelial carcinoma fills and expands ducts and  often develops central comedonecrosis. Stromal invasion is associated  with   a   prominent   desmoplastic   stromal   response   with   tumor   cells  arranged in small irregular nests, cords and single cells.  * Squamous cell carcinoma: it is identical to squamous cell  carcinoma of other origin. Adenosquamous carcinoma is defined by the presence of both  glandular (acinar) and squamous cell carcinoma components.   * Basal cell carcinoma: the tumors comprising large basaloid  nests with peripheral palisading and necrosis. Histologic criteria for  malignancy   that   distinguish   it   from   basal   cell   hyperplasia   an 
  6. 6 infiltrative   pattern,   extraprostatic   extension,   perineural   invasion,  necrosis and stromal desmoplasia. 1.2.2. Prostatic intraepithelial neoplasia of the prostate (PIN) PIN is best characterized as a neoplastic transformation of the  lining epithelium of prostatic ducts and acini. High grade PIN (HGPIN)  is characterized by a more uniform morphologic alteration, The acini  and   ducts   are   lined   malignant   cells   with   a   variety   of   architectural  complexity   and   pattern.   The   individual   cells   are   almost   uniformly  enlarged with increased nuclear/cytoplastic ratio. Therefore showing less  variation in nuclear size than that seen in low grade PIN. 1.2.3. Gleason grading system Gleason grading system defines five histological patterns with  decreasing differentiation.  Gleason   pattern   1,   2,   3,   4,   5.   Pca   has   a   pronounced  morphological heterogeneity and usually more than one histological  pattern is present. The primary and secondary pattern, i.e. the most  prevalent the second most prevalent pattern are added to obtained a  Gleason scores. 1.4. Immunohistochemistry in prostate carcinoma Immunohistochemistry is a special staining technique that uses  specific   antibodies   to   determine   the   presence   of   corresponding  antigens on tissue sections or on cell types present in tissue. Application   of   Immunohistochemistry   to   Pca   is   aimed   at:  helping to identify the origin of the tumor, identifying the type of  histopathology, identifying the variants of adenocarcinoma, Gleason  grading,   distinguishing   malignant   lesions   from   benign   lesions,  identify the invasion and metastasis of cancer. In   this   study,   we   performed   immunohistochemical   staining  with monoclonal antibodies against PSA, CK34βE12, p63, CK5/6,   CK7, actin. 1.5. DNA methylation in cancer 1.5.1. DNA methylation in prostate cancer  DNA methylation  is an  epigenetic  mechanism that occurs by  the addition of a methyl (­CH 3) group to DNA. In human genome, 
  7. 7 DNA   methylation   process   is   the   covalent   addition   of   the   methyl  group at   the   5­carbon   of   the   cytosine   ring   resulting   in   5­ methylcytosine   (5­mC).   In   prostate   cancer,  RASSF1A  tumor  suppressor gene is often methylated. Methylation­specific PCR (MS­ PCR   or   MSP)   is   one   of   the   most   commonly   used   methods   for  gene/sequence­specific detection of DNA methylation. In this study,  RASSF1A  gene  methylation   was   selected   to   analysis   DNA  methylation in prostate adenocarcinoma. 1.5.2. Methylation specific PCR Principles: The DNA undergoes bisulfite conversion of cytosine  to uracil and then the methylated sequences are selectively amplified  with primers specific for methylation. . Chapter 2. OBJECTIVES AND RESEARCH METHODS 2.1. Objects 2.1.1. The group of patients for histopathological research 84  specimens  of  prostate  carcinoma (84  patients)  performed  transurethral resection of the prostate (TURP) at Military Hospital  103 (from June 2008 to July 2017) that were diagnosed   as primary  carcinoma.   Patients   who   have   medical   records;   reports   for  histopathology;   paraffin   imbedded   tissue   samples   are  adequate  to  analysis. Exclusion criteria: Secondary   Pca   and   cases   do   not   meet   the   need   of   criteria  which mention above. 2.1.2. The group of patients for immunohistochemistry research + 31 tissue samples of primary prostate carcinomas. + 2 tissue samples of primary urothelial carcinomas ­   Samples   of   cancer   are  adequate  to   carry   out   an  immunohistochemical staning and still have antigenicity. ­   Immunohistochemical   staining  with   monoclonal   antibodies  against PSA; CK34βE12; p63; CK5/6; CK7; actin. 2.1.3. The group of patients for RASSF1A methylation research
  8. 8 ­   20 tissue samples of   adenocarcinoma were identified by  histopathology. ­  10   tissue   samples   of     benign   hyperplasia   of   the   prostate  (BHP) were identified by histopathology      (in order to compare  RASSF1A  methylation rate in cancer  with  BHP) ­  Tissue samples of adenocarcinoma  and BHP  are sufficient  for DNA methylation assay. 2.2. Research methods 2.2.1. Research design ­ Prospective study  ­ Sampling method: full and intentional sampling. ­ Sample size: Calculated according to a ratio survey With  α  = 5%;  Z1­ /2    = 1.96; d = 0.1; p = 78%. Filled in the  above formula, sample size is 66 samples. In fact, prostate cancer  specimens obtained from TURP are usually small, and insufficience  of quantification for many techniques. We have collected 84 samples. 2.2.2. Materials, chemicals, research equipment 2.2.2.1. Information gathering materials +   Medical   records   and   reports   of   histopathology   of   the  Histopathology Department – Military Hospital 103. + Collecting informations  including:  histopathological  types;  forms; variants of prostate carcinoma. Differentiation of the tumor is  calculated by the Gleason grading system including Gleason pattern  1, 2, 3, 4, 5. The most prevalent pattern and secondary most prevalent  pattern are added to obtain a Gleason score.  +   Malignant   specific   features,   intraluminal   features   and  adenocarcinomas associated with HGPIN were as follows: have or  have no.  Staining intensity of tumor cells  were as follows:  “faint”  (1+);   “moderate”   (2+);   “strong”   (3+);   “very   strong”   (4+). 
  9. 9 Methylation of the RASSF1A gene was as follows: unmethylated (­),  methylated (+). +   All   the   H.E   staining   specimens   (84   patients)   and  immunohistochemical   staining   specimens   (33   patients)   were  examined on optical microscope with Nguyen Manh Hung and Tran  Ngoc Dung (Department of Histopathology of Military Hospital 103)  with illustrated photos. +   Methylation   assay:   20   adenocarcinomas   samples   and   10  BHP   samples   were   analyzed   together   with   Vo   Thi   Thuong   Lan  (Hanoi University of Sciences). 2.2.2.2. Tissue samples of Pca which obtained from TURP Fragments were randomly submitted to the study. 2.2.2.3.   Tissue   sections   were   studied   by   using   for   H.E   staining,  immunohistochemical staining and methylation assay ­ Fixation of the the tissue samples in a 10% neutral buffered  formaldehyde   solution,   then   embedded   in   paraffin   blocks.   Trimmed  paraffin   blocks   are   cut   at   3­10   micrometers   (5   micrometers   is  commomly used) to make the H.E stain and immunohistochemical stain. ­ Tissue sections of 84 samples prostate carcinoma were stained for  H.E to histopathological analysis; Tissue sections of 33 samples prostate  carcinoma  were stained for  antibodies   against   PSA,   CK34βE12,   p63,   CK5/6, CK7 and actin to immunohistochemical analysis.  ­  Number of samples for methylation analysis: 20 samples of  prostatic adenocarcinoma and 10 samples of BHP. 2.2.3. Techniques used in research 2.2.3.1. H.E staning technique ­ H.E. stain was performed according to routine histological  technique. ­   The   use   of   histopathological   criteria   and   the   2004   WHO  classification of tumors of the prostate. ­ Use the Olympus CX21 optical microscope. 2.2.3.2. Immunohistochemical technique +   Chemicals,   antibodies,   buffer   solution,   detection   system  (Leica, USA).
  10. 10 + Evaluation of results according to McNeal et al. (1991). 2.2.3.3. Determine gene methylation status of RASSF1A + Some steps of the MSP technique ­   DNA   extraction   from   paraffin­embedded   specimens.   The  quality   DNA   of   specimens   were   tested   by   Polymerase   Chain  Reaction (PCR) targeting house keeping gene,   β­globin; evaluation  PCR product by electrophoresis on 1.5% agarose gel. ­ Bisulfite   conversion:   The   extracted   DNA   is   treated   with  bisulfite and purified by Epitect Kit (Qiagen, Cat, No 59104). ­   Examination   of   genomic   DNA   before   and   after   bisulfite  treatment by PCR, amplifying  β­globin gene . The PCR product was  separated on a 1.5% agarose gel in order to test the ability of DNA  treated with bisulfite. ­ MSP was performed with specific PCR primers to detect the  methylation   of   the  RASSF1A  gene.  RASSF1A­M210­F/RASSF1A­ M211­R  primer amplify methylated DNA­specific product (170 bp).  Whereas,   nested   PCR   was   performed   with  RASSF1A­Un­ F1/RASF1A­Un­R1  and  RASSF1A­Un­F2/RASSF1A­Un­R2  primers (Table 2.3) in order to amplify unmethylated DNA­specific  product. Table 2.3. Primer sequences for PCR and MSP Primers Sequneces (5’3’) GL­F CAACTTCATCCACGTTCACC GL­R GAAGAGCCAAGGACAGGTAC RASSF1A­M210­F GGGTTTTGCGAGAGCGCG RASSF1A­M211­R GCTAACAAACGCGAACCG RASSF1A­Un­F1 GGGGTTTTGTGAGAGTGTGTTTAG RASF1A­Un­R1 TAAACACTAACAAACACAAACC RASSF1A­Un­F2 GAGAGTGTGTTTAGTTTTGTTTTTG RASF1A­Un­R2 CCACAAAACAAACCCCAACTTCAA 2.3. Data analysis: Data is processed by SPSS13 software.
  11. 11 2.4.   Ethical   issues   in   research:   The   ethical   principles   in  research are guaranteed. Chapter 3. RESEARCH RESULTS 3.1. Proportion of patients with prostate carcinoma by age group The proportion of patients with prostate carcinoma was highest  in   the   70­79   age   group   (42.86%);   average   age:   74.34   ±   9.27;   no  patients under the age of 40 years seen. 3.2.   The   results   identify   some   histopathological   features   of  prostate carcinoma 3.2.1. Determine the types of prostate carcinoma according to the   2004 WHO histological classification of tumors of the prostate Table 3.2. Types of histopathology Types of histopathology  Number (n = 84) Ratio (%) 1. Adenocarcinoma 82/84 97,6 Acinar adenocarcinoma 80/82 97,6 Ductal adenocarcinoma 2/82 2,4 2. Urothelial carcinoma 2/84 2,4 3. Squamous cell carcinoma 0 0 4. Basal cell carcinoma 0 0 3.2.3. Ratio of adenocarcinoma associated with HGPIN Table 3.4. Association between adenocarcinoma and HGPIN  Histopathology  Number  Ratio  p (n=82) (%)
  12. 12 Adenocarcinoma associated with HGPIN 60 73,2 Adenocarcinoma without associated with  22 26,8
  13. 13 Gleason score Gleason 2­4 Gleason 5­7 Gleason 8­10 Total Malignant  n=14 (%) n=58 (%) n=10 (%)  (%) specific  features Have  1/14 (7,2%) 47/58 (81%) 9/10 (90%) 57 (69,5%) Have no 13/14 (92,8%) 11/58 (19%) 1/10 (10%) 25 (30,5%) Total 14 (100%) 58 (100%) 10 (100%) 82 (100%) P
  14. 14 Crystalloids  & Pink dense  secretions Contain 14/14 (100%) 55/58 (94,83%) 1/10 (10%) 70 (85,4%) No contain 0/14 (0%) 3/58 (5,17%) 9/10 (90%) 12 (14,6%) Total 14 (100%) 58 (100%) 10 (100%) 82 (100%) p
  15. 15 (2+) 13 (44,8%) 2/2  (3+) 9 (31%) 0/2  (4+) 0 (0%) 0/2  3.3.4.   Distribution   of   PSA   expression   levels   of   tumor   cells   according to Gleason grade Table 3.17. PSA expression levels according to Gleason grade (n = 31) Gleason score                   Leve Grade Grade Grade Grade Total p l 2 3 4 5 (%) (1+) 5 2 7 (22,6%) (2+) 15 15 (48,4%)
  16. 16 34βE12 p63 Adenocarcinoma Benign part  (+) (+) 31 31 Cancer part (­) (­) Urothelial cancer Benign part 2 (+) 2 (+) Cancer part (+) (+) ­  Adenocarcinoma:  benign   part   expressed  CK34βE12   and   p63,  whereas the cancer part did not express CK34βE12 and p63. ­   Urothelial   carcinoma:  benign   part   and  cancer   part  expressed  CK34βE12 and p63. 3.3.8. Status and level of CK7 and CK5/6 expression of benign and   malignant urothelial cell Table 3.21. Status and level of CK7 and CK5/6 expession of  benign and malignant urothelial cells     Markers (n=33) Histopa CK7 CK5/6 thology Adenocarcinoma Benign part (4 +) (­) 31 31   Cancer part (­) (­) Urinary cancer Benign part (4+) (­) 2 2 Cancer part (­) (­) ­  Adenocarcinoma:  benign part expressed  CK7, but  did  not  express  CK5/6. The cancer part did not express CK7 and CK5/6. ­   Urothelial   carcinoma:  benign   part   expressed  CK7,  but   did  not  express CK5/6. The cancer part did not express CK7 and CK5/6. 3.3.9. Status and level of actin expression of various stromal types 
  17. 17 ­ The mooth muscle of the prostate gland and vascula expressed actin. ­ Fibrous cells, basal cells, endothelial cells did not express actin. 3.4. Results of RASSF1A methylation study 3.4.2. Results of evaluating the efficiency of bisulfite treatment Results of genomic DNA before and after bisulfite treatment,  amplifying β­globin gene by PCR was indicated in Figure 3.2 Figure   3.2.  PCR   products   amplified   the   β­globin   gene   from   the   before (red band) and after DNA (yellow band) treated with bisulfite   of the PCa and BHP samples. Prior to bisulfite treatment, samples were amplified PCR product  (250   bp).   After   treatment   with   bisulfite,   PCR   product   was   not  obserbed in gel eletrophoresis. Thus, genomic DNA were completely  treated with bisulfite. 3.4.3. Result of RASSF1A methylation in prostate cancer Methylated   and   Unmethylated   DNA­specific   products   was  detected   in   11/20   (170   bp)   and   20/20   (137   bp)   Pca   samples,  respectively.   RASSF1A methylation ratio in prostate cancer is 11/20  specimens (55.0%)  
  18. 18 Figure 3.. MSP product of PCa samples (P1­P20) using methylated  primer   (RASSF1A­M210­F/RASSF1A­M211­R)     and  unmethylated  primer (RASSF1A­Un­F2/ RASSF1A­Un­R2) 3.4.4.  Result   of   RASSF1A   methylation   in   begnin  hyperplasia   of   prostate Figure 3.4. MSP result of BHP samples (B1­B10)  Note: (m):  methylated DNA, (u):  unmethylated DNA. (­):  negative   control without DNA template MSP analysis also revealed that the methylation of  RASSF1A  was   detected   in   2/10   patients   with   BHP.  Methylated   and  unmethylated DNA­specific products was detected in 2/10 (170 bp)  and 10/10 (137 bp) BHP samples, respectively.
  19. 19 3.4.5.  Relationship   between   RASSF1A   methylation   and   pathological   characteristics in prostate cancer and begnin hyperplasia of  prostate 3.4.5.1. RASSF1A methylation in Pca and BHP Table 3.3. RASSF1A methylation ratio in PCa and BHP Sample Number (n=30) Methylation (%) PCa 20 11/20 (55%) BHP 10   2/10 (20%) Methylation of  RASSF1A  was  detected in 55% and 20%    patients  with prostate cancer and begnin hyperplasia of prostate, respectively. 3.4.5.3. Methylation of RASSF1A methylation according to Gleason  score/tumor differentiation Bảng 3.25. Ratio of RASSF1A methylation according to Gleason   score/ differentiation of tumor Number Methylation  Gleason score differentiation (n=20) (%) Well ­  2­4 7 2 (28,6%) differentiated Moderately  5­7 8 4 (50%) differentiated poorly­  8­10 5 5 (100%) differentiated RASSF1  methylation   increased   according   to   Gleason   score  differentiation of tumor.
  20. 20 3.4.5.4.  Methylation of  the  RASSF1A gene  and  status  of  neural   invasion
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2