The medical doctoral thesis: Study on histopathological fearures, immunohistochemistry and methylation of rassf1a gene in prostate cancer

Chia sẻ: _ _ | Ngày: | Loại File: DOCX | Số trang:29

Thêm vào BST

Báo xấu

17
lượt xem 2
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Do the following: Study on some histopathological features of prostate carcinoma at Military Hospital 103 according to the 2004 WHO classification. Determine the expression of some immunological markers and methylation status of the RASSF1A gene and compare with some histopathological features in prostate carcinoma.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: The medical doctoral thesis: Study on histopathological fearures, immunohistochemistry and methylation of rassf1a gene in prostate cancer

MINISTRY OF EDUCATION MINISTRY OF AND TRAINING NATIONAL DEFENSE MILITARY MEDICAL UNIVERSITY VI THUAT THANG STUDY ON HISTOPATHOLOGICAL FEARURES, IMMUNOHISTOCHEMISTRY AND METHYLATION OF RASSF1A GENE IN PROSTATE CANCER Speciality: Biomedical Sciences Code: 9720101 THE MEDICAL DOCTORAL THESIS
Ha Noi – 2018WORKS ARE COMPLETED AT MILITARY MEDICAL UNIVERSITY Name of supervisors: 1. Prof. Dr. Nguyen Dinh Tao, MD. Ph.D 2. Dr. Nguyen Ngoc Hung, MD. Reviewer 1: Assoc. Prof. Nguyen Van Hung, MD. Ph.D. Reviewer 2: Assoc. Prof. Quan Hoang Lam, MD. Ph.D. Reviewer 3: Assoc. Prof. Trinh Tuan Dung, MD. Ph.D. The thesis will be protected before the Board of thesis dissertation on the day: / / A thesis can be found at: 1. National Library 2. Library of the Military Medical University
3 INTRODUCTION TO THESIS 1. Set the problem Prostate cancer (Pca) is common in men over age of 65, the disease is occult. Most cases were detected accidentally by histopathological examination. In Vietnam, the standard age rate in 2012 was 3.4/100000 people and queued the 10 th in cancer in men. Pca can be treated effectively if the disease is detected early. Therefore, the finding of early detection methods, accurate diagnosis, proper assessment of histopathological lesions by a standard and a uniform classification is essential to the development of therapeutic approaches and prognosis of this disease. Several studies have shown that the RASSF1A gene methylation occurs at an early stage in the formation and progression of the Pca. Thus, RASSF1A gene methylation marker is being considered to Pca. In Vietnam, studies on DNA methylation in cancer have been carried out lately, histopathological and immunohistochemistry studies of Pca according to the 2004 World Health Organization (WHO) classification of tumors of the prostate are lacking. Based on that, we do the following: a. Study on some histopathological features of prostate carcinoma at Military Hospital 103 according to the 2004 WHO classification. b. Determine the expression of some immunological markers and methylation status of the RASSF1A gene and compare with some histopathological features in prostate carcinoma. 2. New contributions of the thesis + Study on RASSF1A methylation status in some cases of adenocarcinoma of the prostate. + Compare RASSF1A methylation status with some histopathological features in prostate carcinoma. + Simultaneous staining using antibodies against PSA, CK34betaE12, p63, CK7, CK5/6 and actin in prostate carcinoma. 3. Structure of the thesis
4 The thesis is 135 pages including: Introduction (2 pages); Chapter 1 Document overview: 40 pages; Chapter 2 Subjects and Methods: 20 pages; Chapter 3 Research results: 31 pages; Chapter 4 Discussion: 40 pages; Conclusion: 2 pages; Request: 1 page; List of articles: 1 page. The thesis has 27 tables of data, 1 diagram, 13 figues, 25 images, 148 references (25 in Vietnamese, 123 in English), annexes to research forms and patient lists. Chapter 1. OVERVIEW OF DOCUMENTS 1.1. A brief description of the histology of the prostate and classification of prostate cancer 1.1.1. Histology Histologically the structure of prostate consists of acinus, branched ducts and prostate urethral ducts. The acinus and ducts are lined by an secretary inner cell layer and an outer basal cell layer. The prostate gland does not have myoepithelium, the acinus and ducts are surrounded by smooth muscle, fibroblasts and collagen fibers. The acinus and ducts contain faint pink secretions and corpora amylacea. The main ducts are lined by urothelial epithelium. 2.1.2. The 2004 WHO histological classification of tumours of the prostate Carcinoma of the prostate including adenocarcinoma, urothelial carcinoma, squamous cell carcinoma, basal cell carcinoma. 1.2. Carcinoma of the prostate, prostatic intraepithelial neoplasia and Gleason grading system 1.2.1. Adenocarcinoma of the prostate * Adenocarcinoma: Glandforming Pca typically contain glands that are more crowded than in benign prostatic tissue, although there is overlap with certain benign mimickers of Pca. Glands of adenocarcinoma of the prostate typically grow in a haphazard fashion. Glands oriented perpendicular to each other and glands irregularly separated by bundle of smooth muscle are indicative of an infiltrative process. Another pattern characteristic of an infiltrative process is the presence of small atypical glands situated in between larger benign glands with the loss of glandular
5 differentiation and the formation of cribriform structures, fused glands, and poorly formed glands the distinction between benign glands based on the architectural pattern becomes more apparent. Tumors composed of soild sheets, cords of cells, or isolated individual cells characterized undifferentiated Pca. Nuclei in Pca range from those indistinguishable from benign prostatic epithelium to those with overt malignancy. In most Pca, there are cytological difference in the malignant glands when compared to the surrounding benign glands. Nuclear enlargement with prominent nucleoli is a frequent the finding, althouth not every cancer cell will display these features. Some neoplastic nuclei lack prominent nucleoli, yet are enlarged and hyperchromatic. Pca nuclei, even in cancers which lack glandular differentiation, show little variability in nuclear shape or size from one nucleus to another. Mitotic figures may be relatively common in high grade cancer, yet are infrequent in lower grade tumors. The cytoplasm is brighter than the benign gland. The acinus may contain crystals, pink secretions or mucus. It can be seen that perineural invasion, mucinous fibroplasia, glomerulations. * Primary urothelial carcinoma: the vast majority are high grade and are associated with an in situ components. A single cell pattern of pagetoids spreads or burrowing of tumor cells between the basal cell and secretary cell layers of the prostate is characteristic. With extensive tumor involvements, urothelial carcinoma fills and expands ducts and often develops central comedonecrosis. Stromal invasion is associated with a prominent desmoplastic stromal response with tumor cells arranged in small irregular nests, cords and single cells. * Squamous cell carcinoma: it is identical to squamous cell carcinoma of other origin. Adenosquamous carcinoma is defined by the presence of both glandular (acinar) and squamous cell carcinoma components. * Basal cell carcinoma: the tumors comprising large basaloid nests with peripheral palisading and necrosis. Histologic criteria for malignancy that distinguish it from basal cell hyperplasia an
6 infiltrative pattern, extraprostatic extension, perineural invasion, necrosis and stromal desmoplasia. 1.2.2. Prostatic intraepithelial neoplasia of the prostate (PIN) PIN is best characterized as a neoplastic transformation of the lining epithelium of prostatic ducts and acini. High grade PIN (HGPIN) is characterized by a more uniform morphologic alteration, The acini and ducts are lined malignant cells with a variety of architectural complexity and pattern. The individual cells are almost uniformly enlarged with increased nuclear/cytoplastic ratio. Therefore showing less variation in nuclear size than that seen in low grade PIN. 1.2.3. Gleason grading system Gleason grading system defines five histological patterns with decreasing differentiation. Gleason pattern 1, 2, 3, 4, 5. Pca has a pronounced morphological heterogeneity and usually more than one histological pattern is present. The primary and secondary pattern, i.e. the most prevalent the second most prevalent pattern are added to obtained a Gleason scores. 1.4. Immunohistochemistry in prostate carcinoma Immunohistochemistry is a special staining technique that uses specific antibodies to determine the presence of corresponding antigens on tissue sections or on cell types present in tissue. Application of Immunohistochemistry to Pca is aimed at: helping to identify the origin of the tumor, identifying the type of histopathology, identifying the variants of adenocarcinoma, Gleason grading, distinguishing malignant lesions from benign lesions, identify the invasion and metastasis of cancer. In this study, we performed immunohistochemical staining with monoclonal antibodies against PSA, CK34βE12, p63, CK5/6, CK7, actin. 1.5. DNA methylation in cancer 1.5.1. DNA methylation in prostate cancer DNA methylation is an epigenetic mechanism that occurs by the addition of a methyl (CH 3) group to DNA. In human genome,
7 DNA methylation process is the covalent addition of the methyl group at the 5carbon of the cytosine ring resulting in 5 methylcytosine (5mC). In prostate cancer, RASSF1A tumor suppressor gene is often methylated. Methylationspecific PCR (MS PCR or MSP) is one of the most commonly used methods for gene/sequencespecific detection of DNA methylation. In this study, RASSF1A gene methylation was selected to analysis DNA methylation in prostate adenocarcinoma. 1.5.2. Methylation specific PCR Principles: The DNA undergoes bisulfite conversion of cytosine to uracil and then the methylated sequences are selectively amplified with primers specific for methylation. . Chapter 2. OBJECTIVES AND RESEARCH METHODS 2.1. Objects 2.1.1. The group of patients for histopathological research 84 specimens of prostate carcinoma (84 patients) performed transurethral resection of the prostate (TURP) at Military Hospital 103 (from June 2008 to July 2017) that were diagnosed as primary carcinoma. Patients who have medical records; reports for histopathology; paraffin imbedded tissue samples are adequate to analysis. Exclusion criteria: Secondary Pca and cases do not meet the need of criteria which mention above. 2.1.2. The group of patients for immunohistochemistry research + 31 tissue samples of primary prostate carcinomas. + 2 tissue samples of primary urothelial carcinomas Samples of cancer are adequate to carry out an immunohistochemical staning and still have antigenicity. Immunohistochemical staining with monoclonal antibodies against PSA; CK34βE12; p63; CK5/6; CK7; actin. 2.1.3. The group of patients for RASSF1A methylation research
8 20 tissue samples of adenocarcinoma were identified by histopathology. 10 tissue samples of benign hyperplasia of the prostate (BHP) were identified by histopathology (in order to compare RASSF1A methylation rate in cancer with BHP) Tissue samples of adenocarcinoma and BHP are sufficient for DNA methylation assay. 2.2. Research methods 2.2.1. Research design Prospective study Sampling method: full and intentional sampling. Sample size: Calculated according to a ratio survey With α = 5%; Z1 /2 = 1.96; d = 0.1; p = 78%. Filled in the above formula, sample size is 66 samples. In fact, prostate cancer specimens obtained from TURP are usually small, and insufficience of quantification for many techniques. We have collected 84 samples. 2.2.2. Materials, chemicals, research equipment 2.2.2.1. Information gathering materials + Medical records and reports of histopathology of the Histopathology Department – Military Hospital 103. + Collecting informations including: histopathological types; forms; variants of prostate carcinoma. Differentiation of the tumor is calculated by the Gleason grading system including Gleason pattern 1, 2, 3, 4, 5. The most prevalent pattern and secondary most prevalent pattern are added to obtain a Gleason score. + Malignant specific features, intraluminal features and adenocarcinomas associated with HGPIN were as follows: have or have no. Staining intensity of tumor cells were as follows: “faint” (1+); “moderate” (2+); “strong” (3+); “very strong” (4+).
9 Methylation of the RASSF1A gene was as follows: unmethylated (), methylated (+). + All the H.E staining specimens (84 patients) and immunohistochemical staining specimens (33 patients) were examined on optical microscope with Nguyen Manh Hung and Tran Ngoc Dung (Department of Histopathology of Military Hospital 103) with illustrated photos. + Methylation assay: 20 adenocarcinomas samples and 10 BHP samples were analyzed together with Vo Thi Thuong Lan (Hanoi University of Sciences). 2.2.2.2. Tissue samples of Pca which obtained from TURP Fragments were randomly submitted to the study. 2.2.2.3. Tissue sections were studied by using for H.E staining, immunohistochemical staining and methylation assay Fixation of the the tissue samples in a 10% neutral buffered formaldehyde solution, then embedded in paraffin blocks. Trimmed paraffin blocks are cut at 310 micrometers (5 micrometers is commomly used) to make the H.E stain and immunohistochemical stain. Tissue sections of 84 samples prostate carcinoma were stained for H.E to histopathological analysis; Tissue sections of 33 samples prostate carcinoma were stained for antibodies against PSA, CK34βE12, p63, CK5/6, CK7 and actin to immunohistochemical analysis. Number of samples for methylation analysis: 20 samples of prostatic adenocarcinoma and 10 samples of BHP. 2.2.3. Techniques used in research 2.2.3.1. H.E staning technique H.E. stain was performed according to routine histological technique. The use of histopathological criteria and the 2004 WHO classification of tumors of the prostate. Use the Olympus CX21 optical microscope. 2.2.3.2. Immunohistochemical technique + Chemicals, antibodies, buffer solution, detection system (Leica, USA).
10 + Evaluation of results according to McNeal et al. (1991). 2.2.3.3. Determine gene methylation status of RASSF1A + Some steps of the MSP technique DNA extraction from paraffinembedded specimens. The quality DNA of specimens were tested by Polymerase Chain Reaction (PCR) targeting house keeping gene, βglobin; evaluation PCR product by electrophoresis on 1.5% agarose gel. Bisulfite conversion: The extracted DNA is treated with bisulfite and purified by Epitect Kit (Qiagen, Cat, No 59104). Examination of genomic DNA before and after bisulfite treatment by PCR, amplifying βglobin gene . The PCR product was separated on a 1.5% agarose gel in order to test the ability of DNA treated with bisulfite. MSP was performed with specific PCR primers to detect the methylation of the RASSF1A gene. RASSF1AM210F/RASSF1A M211R primer amplify methylated DNAspecific product (170 bp). Whereas, nested PCR was performed with RASSF1AUn F1/RASF1AUnR1 and RASSF1AUnF2/RASSF1AUnR2 primers (Table 2.3) in order to amplify unmethylated DNAspecific product. Table 2.3. Primer sequences for PCR and MSP Primers Sequneces (5’3’) GLF CAACTTCATCCACGTTCACC GLR GAAGAGCCAAGGACAGGTAC RASSF1AM210F GGGTTTTGCGAGAGCGCG RASSF1AM211R GCTAACAAACGCGAACCG RASSF1AUnF1 GGGGTTTTGTGAGAGTGTGTTTAG RASF1AUnR1 TAAACACTAACAAACACAAACC RASSF1AUnF2 GAGAGTGTGTTTAGTTTTGTTTTTG RASF1AUnR2 CCACAAAACAAACCCCAACTTCAA 2.3. Data analysis: Data is processed by SPSS13 software.
11 2.4. Ethical issues in research: The ethical principles in research are guaranteed. Chapter 3. RESEARCH RESULTS 3.1. Proportion of patients with prostate carcinoma by age group The proportion of patients with prostate carcinoma was highest in the 7079 age group (42.86%); average age: 74.34 ± 9.27; no patients under the age of 40 years seen. 3.2. The results identify some histopathological features of prostate carcinoma 3.2.1. Determine the types of prostate carcinoma according to the 2004 WHO histological classification of tumors of the prostate Table 3.2. Types of histopathology Types of histopathology Number (n = 84) Ratio (%) 1. Adenocarcinoma 82/84 97,6 Acinar adenocarcinoma 80/82 97,6 Ductal adenocarcinoma 2/82 2,4 2. Urothelial carcinoma 2/84 2,4 3. Squamous cell carcinoma 0 0 4. Basal cell carcinoma 0 0 3.2.3. Ratio of adenocarcinoma associated with HGPIN Table 3.4. Association between adenocarcinoma and HGPIN Histopathology Number Ratio p (n=82) (%)
12 Adenocarcinoma associated with HGPIN 60 73,2 Adenocarcinoma without associated with 22 26,8
13 Gleason score Gleason 24 Gleason 57 Gleason 810 Total Malignant n=14 (%) n=58 (%) n=10 (%) (%) specific features Have 1/14 (7,2%) 47/58 (81%) 9/10 (90%) 57 (69,5%) Have no 13/14 (92,8%) 11/58 (19%) 1/10 (10%) 25 (30,5%) Total 14 (100%) 58 (100%) 10 (100%) 82 (100%) P
14 Crystalloids & Pink dense secretions Contain 14/14 (100%) 55/58 (94,83%) 1/10 (10%) 70 (85,4%) No contain 0/14 (0%) 3/58 (5,17%) 9/10 (90%) 12 (14,6%) Total 14 (100%) 58 (100%) 10 (100%) 82 (100%) p
15 (2+) 13 (44,8%) 2/2 (3+) 9 (31%) 0/2 (4+) 0 (0%) 0/2 3.3.4. Distribution of PSA expression levels of tumor cells according to Gleason grade Table 3.17. PSA expression levels according to Gleason grade (n = 31) Gleason score Leve Grade Grade Grade Grade Total p l 2 3 4 5 (%) (1+) 5 2 7 (22,6%) (2+) 15 15 (48,4%)
16 34βE12 p63 Adenocarcinoma Benign part (+) (+) 31 31 Cancer part () () Urothelial cancer Benign part 2 (+) 2 (+) Cancer part (+) (+) Adenocarcinoma: benign part expressed CK34βE12 and p63, whereas the cancer part did not express CK34βE12 and p63. Urothelial carcinoma: benign part and cancer part expressed CK34βE12 and p63. 3.3.8. Status and level of CK7 and CK5/6 expression of benign and malignant urothelial cell Table 3.21. Status and level of CK7 and CK5/6 expession of benign and malignant urothelial cells Markers (n=33) Histopa CK7 CK5/6 thology Adenocarcinoma Benign part (4 +) () 31 31 Cancer part () () Urinary cancer Benign part (4+) () 2 2 Cancer part () () Adenocarcinoma: benign part expressed CK7, but did not express CK5/6. The cancer part did not express CK7 and CK5/6. Urothelial carcinoma: benign part expressed CK7, but did not express CK5/6. The cancer part did not express CK7 and CK5/6. 3.3.9. Status and level of actin expression of various stromal types
17 The mooth muscle of the prostate gland and vascula expressed actin. Fibrous cells, basal cells, endothelial cells did not express actin. 3.4. Results of RASSF1A methylation study 3.4.2. Results of evaluating the efficiency of bisulfite treatment Results of genomic DNA before and after bisulfite treatment, amplifying βglobin gene by PCR was indicated in Figure 3.2 Figure 3.2. PCR products amplified the βglobin gene from the before (red band) and after DNA (yellow band) treated with bisulfite of the PCa and BHP samples. Prior to bisulfite treatment, samples were amplified PCR product (250 bp). After treatment with bisulfite, PCR product was not obserbed in gel eletrophoresis. Thus, genomic DNA were completely treated with bisulfite. 3.4.3. Result of RASSF1A methylation in prostate cancer Methylated and Unmethylated DNAspecific products was detected in 11/20 (170 bp) and 20/20 (137 bp) Pca samples, respectively. RASSF1A methylation ratio in prostate cancer is 11/20 specimens (55.0%)
18 Figure 3.. MSP product of PCa samples (P1P20) using methylated primer (RASSF1AM210F/RASSF1AM211R) and unmethylated primer (RASSF1AUnF2/ RASSF1AUnR2) 3.4.4. Result of RASSF1A methylation in begnin hyperplasia of prostate Figure 3.4. MSP result of BHP samples (B1B10) Note: (m): methylated DNA, (u): unmethylated DNA. (): negative control without DNA template MSP analysis also revealed that the methylation of RASSF1A was detected in 2/10 patients with BHP. Methylated and unmethylated DNAspecific products was detected in 2/10 (170 bp) and 10/10 (137 bp) BHP samples, respectively.
19 3.4.5. Relationship between RASSF1A methylation and pathological characteristics in prostate cancer and begnin hyperplasia of prostate 3.4.5.1. RASSF1A methylation in Pca and BHP Table 3.3. RASSF1A methylation ratio in PCa and BHP Sample Number (n=30) Methylation (%) PCa 20 11/20 (55%) BHP 10 2/10 (20%) Methylation of RASSF1A was detected in 55% and 20% patients with prostate cancer and begnin hyperplasia of prostate, respectively. 3.4.5.3. Methylation of RASSF1A methylation according to Gleason score/tumor differentiation Bảng 3.25. Ratio of RASSF1A methylation according to Gleason score/ differentiation of tumor Number Methylation Gleason score differentiation (n=20) (%) Well 24 7 2 (28,6%) differentiated Moderately 57 8 4 (50%) differentiated poorly 810 5 5 (100%) differentiated RASSF1 methylation increased according to Gleason score differentiation of tumor.
20 3.4.5.4. Methylation of the RASSF1A gene and status of neural invasion