intTypePromotion=1

TIỂU LUẬN:CHẨN ĐOÁN VIRUS PMWS (PROCINE MULTISYSTEMIC WASTING SYNDROM) BẰNG KỸ THUẬT GENE

Chia sẻ: Bluesky_12 Bluesky_12 | Ngày: | Loại File: PDF | Số trang:23

0
106
lượt xem
25
download

TIỂU LUẬN:CHẨN ĐOÁN VIRUS PMWS (PROCINE MULTISYSTEMIC WASTING SYNDROM) BẰNG KỸ THUẬT GENE

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Ở Việt Nam hiện nay hầu hết mọi người chăn nuôi heo nhưng vẫn theo hình thức chăn nuôi truyền thống, không có tính chuyên nghiệp dẫn đến hiệu quả thấp.Trong khi nhu cầu của xã hội ngày càng tăng lên, do vậy muốn chăn nuôi được thành công chúng ta phải nắm bắt các kỹ thuật và phương pháp chăn nuôi tiên tiến và làm đồng bộ.

Chủ đề:
Lưu

Nội dung Text: TIỂU LUẬN:CHẨN ĐOÁN VIRUS PMWS (PROCINE MULTISYSTEMIC WASTING SYNDROM) BẰNG KỸ THUẬT GENE

  1. 1 Trường Đại Học Nông Lâm TPHCM Bộ môn Công nghệ sinh học Lớp DH06SH Báo cáo tiểu luận môn Công nghệ sinh học trong thú y CHẨN ĐOÁN VIRUS PMWS (PROCINE MULTISYSTEMIC WASTING SYNDROM) BẰNG KỸ THUẬT GENE Giáo viên hướng dẫn: PGS.TS. NGUYỄN NGỌC HẢI Người thực hiện: NGUYỄN HOÀNG NGÂN Mã sinh viên: 06126086
  2. 2 I. ĐẶT VẤN ĐỀ Hội chứng còi cọc trên heo sau cai sữa PMWS (post weaning multisystemic syndrome) được ghi nhận lần đầu tiên trên một đàn heo ở Canada vào năm 1991. Trên đàn heo này, một số heo sau cai sữa khoảng 2 tuần bắt đầu có biểu hiện còi cọc và bắt đầu không có đáp ứng tốt với việc điều trị. Sau đó, một số trường hợp được ghi nhận ở Mỹ rồi đến các nước châu Âu. Cho đến năm nay, bệnh đã được phát hiện trên nhiều đàn heo ở Mỹ, nhiều nước Châu Âu và một số nước châu Á và gây thiệt hại kinh tế rất lớn trong ngành chăn nuôi heo công nghiệp ở những nước này. Hội chứng PMWS thường xuất hiện ở heo lứa tuổi từ 6 đến 18 tuần, tỷ lệ chết có thể dao động từ 1-2% đến 10-25% ở một số đàn heo. Bệnh xuất hiện với một số triệu chứng điển hình như gầy còm nhanh, thở khó, tiêu chảy, thỉnh thoảng có một số heo bị vàng da, nhạt màu… PMWS thường hay kết hợp với virus gây hội chứng rối loạn sinh sản và hô hấp trên heo ( porcine reproductive respiratory syndrome virus- parasuis, PRRSV), virus cúm heo ( porcine parvovirrus-PPV), và Haemophilus Actinobacillus pleuropneumoniae, Streptococcus suit Mycoplasma hyoppneumonia. 1997 nhóm nghiên cứu thuộc đại học Saskatchewan (Clark, Ellis, Harding, West) đã phân lập PCV2 từ những ca PMWS. Từ đó, người ta đã thực hiện thành công thí nghiệm gây nhiễm PCV2 trên heo. Báo cáo của Neumann và ctv (2002) cho biết những mẫu huyết thanh heo tại Mỹ lưu trữ từ năm 1969 khi đem xét nghiệm tìm kháng thể kháng virus PVC2 đã cho kết quả dương tính. Phương pháp hồi cứu những mẫu mô và huyết thanh lưu trữ bằng kỹ thuật mô hóa miễn dịch và lai trong mô cho thấy PVC2 từng lưu hành tại châu Âu vào những năm 1970 như không có tài liệu nào ghi nhận về bệnh do PVC2 gây ra vào thời điểm đó ( Tucker và ctv, 2006).
  3. 3 II. TỔNG QUAN 1. Tác nhân gây bệnh: Circovirus thuộc họ virus có DNA mạch vòng, không có vỏ bao và chứa • một bộ gen vòng đơn. Dựa vào đó, tổ chức quốc tế về phân loại virus xếp chúng vào một họ mới • của những DNA virus gọi là Circovitidae, giống Circovirus (Lukertvaf cộng sự,1995). PVC có trọng lượng trong CsCl là 1.33-1.34 (Buhk và ctv, 1985) • Là loại virus nhỏ nhất được biết đến và có khả năng sống sót cao trong môi • trường.
  4. 4 Gồm có 2 tuyp được tìm thấy ở heo, bao gồm type 1 (PVC1) và type 2 • (PVC2) Bộ gen DNA của PCV1 gồm 1759bp và của PCV2 là 1768bp (Meehan và • ctv,1997). Bộ gen của PVC gồm 6 khung đọc mở (open reading frame – ORFs), ORF1 • mã hóa cho protein tham gia vào quá trình nhân lên của virus và ORF2 mã hóa cho các gen cấu trúc của virus. Trên heo hiện có hai loại PVC: PVC1 và PVC2 với bộ nhiễm sắc thể tương • đồng khoảng 68-78%, trong đó ORF tương đồng khoảng 83% về trình tự nucleotide và 86% acid amin. PVC1 được xem như là virus nhiễm thường xuyên và tự nhiên trên tế bào thận heo PK15 và là virus không gây bệnh. Ngược lại, PVC2 được xem như là tác nhân gây PMWS. PVC nhân lên tốt nhất trong môi trường tế bào PK/15. Sự nhân lên của • virus có thể đánh giá bằng kỹ thuật miễn dịch huỳnh quang hoặc nhuộm miễn dịch peroxidase đối với hầu hết tế bào bị nhiễm PVC. Bằng kỹ thuật nhuộm nhân tập trung, thỉnh thoảng trên heo bị PMWS, bệnh tích thể bao hàm ưa kiềm trong tế bào chất của một số tế bào nhiễm PCV2 cũng được tìm thấy ( Clark,1997,Harding,1997,Allan và ctv,1999). a/ Circovirus type 1 (PVC-1): Năm 1974, các nhà khoa học đã phân lập được Circovirus type 1 từ tế bào • thận heo. Hiện nay, chúng không gây bệnh cho heo. • b/ Circovirus type 2 (PVC-2):
  5. 5 Figure 2. Morphology and genomic organisation of PCV2. A. The PCV2-virion consists of a capsid without envelope. B. The genome of PCV2 is a single stranded circular DNA molecule with a stem loop structure. C. A highly conserved nonanucleotide sequence is located on the top of the stem loop structure. Close to the stem loop structure the ORF2 starts on the viral strand coding for the capsid protein, in the other direction, on the complementary strand, starts ORF1 that codes for the Rep protein.
  6. 6 Figure3. Porcine circovirus type 2 (PCV2) with fine outer capsid Được ghi nhận đầu tiên vào 1991 tại Tây Canada, phát hiện ở vết thương. • Bao gồm nhiều chủng khác nhau (kiểu sinh học và kiểu gen). Kháng thể • trên PVC-2 đã được phát hiện ở huyết thanh heo nuôi tại Bỉ năm 1985. Từ những kinh nghiệm nghiên cứu ban đầu cho thấy, khi gây nhiễm virus • type 2 lên heo, heo sẽ biểu hiện những tổn thương đặc trưng của bệnh. Tuy nhiên, nếu một loại virus khác như Parvovirus heo (PPV) hay PRRSV được tiêm vào cùng một lúc thì heo cũng mang những biểu hiện tương tự. Những nguyên nhân gây ra bệnh thường là do nhiễm PCV type 2 hay một vài loại virus khác nhưng không phải tất cả heo bị nhiễm PCV và PPRS không có biểu hiện bệnh lý PMWS. Những nghiên cứu về huyết thanh tại Châu Âu và Bắc Mỹ cho thấy, sự lây • nhiễm lan rộng trong đàn heo nhưng chỉ một phần nhỏ đàn có huyết thanh
  7. 7 dương tính là từng biểu hiện bệnh lý. Điều này có vẻ như hầu hết những ca lây nhiễm có biểu hiện ngầm với bệnh. Heo con có thể bị nhiễm trước khi cai sữa. Sức đề kháng: PCV2 đề kháng cao với nhiều chất sát trùng ( ethanol, • chlohexidine, iodine và formaldehyde), có thể tồn tại trong môi trường suốt nhiều tháng, chịu đụng sức nóng 70oC/15’ và không bị vô hoạt ở pH=3. Virus có thể được phân lập từ các mô lưu trữ ở -70oC trong nhiều tháng (Ellis và ctv,1998). Sodiumhydroxide và Virkon S với độ pha loãng 1% có hiệu quả nhất trong việc bất hoạt PCV2 (Royer và ctv, 2001). Bằng thực nghiệm, người ta ghi nhận PCV2 có thể lây truyền ngang dọc, • theo các đường hô hấp, đường máu, nhau thai và sinh dục. Virus tồn tại trong những heo mang trùng từ 5-6 tháng. Phân, nước tiểu, • máu, dịch tiết ở mũi của những heo còn nhỏ bị nhiễm PVC2cos chứa acid nucleic của PCV2 và những phương tiện lan truyền virus trong đàn. Thực nghiệm, gây nhiễm PCV2 cho heo nuôi thí nghiệm lúc một ngày tuổi, • Krakowka và ctv (2001)đã phát hiện acid nucleic của PCV2 có trong phân, nước tiểu, nước mắt của héo sau 31 ngày gây nhiễm. Ngoài ra, PCV2 cũng được tìm thấy trong tinh dịch của những heo đực • nhiễm bệnh và sẽ lây truyền virus qua giao phối (Kim và ctv,2001). Lây truyền dọc cũng được ghi nhận. Sự chết của bào thai và sẩy thai có liên • quan đến sự nhiễm bệnh qua đường sinh dục (Bogdan và ctv,2001). 2. Cách gây bệnh. Cơ chế gây bệnh của PCV2 trên heo đến nay chưa được biết rõ. Tuy nhiên, qua phương pháp lây nhiễm trên heo sống, Misinzo và ctv (2006) đã phát hiện PCV2 có trong nhiều loại tế bào như tế bào gan, biểu mô, nội mô, lympho bào, tế bào cơ trơn và nguyên sợi bào. Krakowka và ctv (2001) gây nhiễm qua đường mũi hay tiêm tĩnh mạch của heo thí nghiệm, các tác giả nhận thấy có sự
  8. 8 hiện diện của bạch cầu đơn nhân và đại thực bào trong phổi, hạch hạnh nhân, hạch lympho, lách và những cơ quan khác trong hệ thống miễn dịch; còn tại phổi, gan, thận, dạ dày-ruột và lách khoảng ngày 14-21sau gây nhiễm. Tình trạng nhiễm virus huyết xuất hiện lúc 14 ngày sau khi nhiễm và kéo dài 2-4 tuần. Sau khi gây nhiễm 21 ngày, phổi của thú có nhiều vùng bị xẹp và mất chức năng, hạch lympho sưng lớn và chuyển sang màu nâu Đối với hệ thống miễn dịch, PCV2 tấn công vào tế bào đích là các tế bào hình sao và tương tác với các tế bào dòng tủy (tế bào lympho B, lympho T, tế bào NK ngoại trừ tế bào bạch cầu đơn nhân lớn) làm giảm tế bào lympho tại hạch hạnh nhân và hạch lympho để lại bệnh tích vi thể rất đặc trưng. Mức độ cấp tính của bệnh tích vi thể và số lượng PCV2 trong bệnh tích liên quan chặc chẽ với mức độ nghiêm trọng của biểu hiện lâm sàng. PCV2 có thể làm hư hại hệ thống miễn dịch bằng cách ức chế miễn dịch. Ngoài ra, virus PCV2 còn tác dụng làm giảm tiểu cầu nghiêm trọng gây xuất huyết mô kéo dài. Sự tấn công của virus vào gan khởi đầu làm cho các tế bào gan, tế bào Kupffer, tế bào nội mô bị sưng và triễn dưỡng nên gan to ra. Sau đó, các tế bào này sẽ bị dung giải nên giảm số lượng và kích thướt tế bào gan teo lại, đồng thời mật có thể ứ lại trong các ống mật khiến gan trở nên vàng. 3.Nguyên nhân lây nhiễm. Nhiễm từ tinh dịch heo bệnh, phân, phương tiện, vật dụng (quần áo, xe • đẩy,…) hay từ những loài khác (Chuột, Chim,…) Tiếp xúc giữa heo bệnh với heo khỏe mạnh. • Do Stress (trong quá trình vận chuyển, thay đổi môi trường, thay đổi • chuồng trại,… Do nhập nhiều heo với các độ tuổi khác nhau và chăn nuôi với mật độ dày • đặc.
  9. 9 Do thú sản xuất liên tục. • 4. Triệu chứng a. Heo cai sữa và heo trưởng thành Sốt 41 - 42 oC, đột tử, có thể xuất hiện những triệu chứng thần kinh. • Sụt cân, hốc hác, lông thô ráp, da tái nhợt, đôi khi bị vàng da, chậm phát • triển (giai đoạn 6-8 tuần tuổi) và tai bị đổi màu. Một số trường hợp, bệnh thường kèm với một số triệu chứng về hô hấp • (khó thở do viêm phổi) và tiêu hóa (30% trường hợp bị tiêu chảy và loét dạ dày. Ngoại vi hạch bạch huyết sưng to, đặc biệt là giữa hai chân sau của heo. • Nếu ta dựng đỡ heo lên thì có thể thấy hạch bẹn có kích cỡ lớn như một quả banh golf. Thường phát hiện triệu chứng viêm da suy thận (PDNS) trong những đàn bị • PMWS. Tỉ lệ heo cai sữa chết khoảng từ 6-10% nhưng thông thường cao hơn • (20%). Tỉ lệ chết ở heo lớn hơn có thể lên đến 10%. Những ca bệnh có thể kéo dài trong một đàn nhiều tháng. Chúng thường • đạt đến đỉnh điểm sau 6-12 tháng và sau đó giảm từ từ. b. Heo nái và heo con: Những con heo trưởng thành, heo nái và heo con không bị ảnh hưởng. • Hiếm khi một con heo mới thôi bú bị ảnh hưởng bệnh cho đến khi nó được • 6 tuần tuổi. Đôi khi những triệu chứng xảy ra tương tự như trên nhưng là do thú bị suy • sinh dưỡng, thiếu nước, loét dạ dày, viêm ruột non do trực khuẩn, bệnh lý, PRRS và những bệnh khác… Lúc đó, chúng ta phải biết loại trừ nếu bệnh xảy ra cùng lúc hay theo sau PMWS. Mối quan hệ của hệ bệnh này không
  10. 10 được hiểu rõ nhưng mỗi bệnh có thể xuất hiện trong các đàn mà không cần có bệnh kia. 5. Bệnh tích: Mổ khám tử thi Xác súc vật bị gầy và da vàng. • Lách và nhiều hạch bạch huyết sưng to. Tuy nhiên, vẫn phải đặt nghi vấn • trong những trường hợp hình ảnh tuyến bạch huyết sưng to. Thân bị sưng phồng với những đốm trắng nhỏ có thể quan sát bằng mắt từ • bề mặt. Phổi thường dính, có đốm phù nề, có vằn và dai • Ngực, mô và cơ quan ổ bụng bị phù nề hay úng nước. • 6. Giới thiệu phương pháp PCR a. Nguyên tắc chung Thành phần cơ bản cho phản ứng PCR bao gồm: DNA bản mẫu, mồi xuôi, mồi ngược, dNTP (dATP, dCTP, dTTP, dGTP), dung dịch đệm cho phản ứng PCR, MgCl2, Tap polymerase. Tất cả các DNA polymerase khi hoạt động tổng hợp một mạch DNA mới từ mạch khuôn đều cần sự hiện diện của những mồi chuyên biệt. Mồi là những oligonucleotide có khả năng bắt cặp bổ sung với một đầu 3’của mạch khuôn. DNA polymerase sẽ nối dài mồi để hình thành mạch mới. Mồi xuôi (forward primer: F) tác động lên sợi DNA theo chiều từ 3’->5’. Mồi ngược (Reverse primer: R) tác đọng theo chiều từ 5’->3’. Phản ứng PCR sẽ nhân bản trình tự nằm giữa hai đoạn mới này. Phản ứng PCR cho phép khuếch đại từ một DNA ban đầu thành một số lượng lớn DNA và được thực hiện nhờ enzyme DNA polymerase không cần đến sự hiện diện của tế bào. Kỹ thuật này được thực hiện trên cơ sở phản ứng sinh tổng hợp DNA theo ba giai đoạn sau:
  11. 11 • Giai đoạn biến tính: ở nhiệt độ 92-95oC, hai chuỗi DNA được tách ra để làm khuôn mẫu để tổng hợp mới hai mạch bổ sung; giai đoạn ủ để lai phân tử (hybridization), hai mồi bắt cặp bổ sung với mạch khuôn của DNA ở hai đầu nhằm chuẩn bị cho sự kéo dài; giai đoạn kéo dài (elongation) tạo thành chuỗi DNA bổ sung với chuỗi DNA gốc. Mỗi chu kỳ gồm ba bước trên sẽ lặp đi lặp lại nhiều lần, lượng DNA được nhân lên theo cấp số nhân. Ba giai đoạn xảy ra trong điều kiện nhiệt độ khác nhau nên cần phải có máy luân nhiệt kiểm soát phản ứng với tính tự động hóa một cách chính xác. Sự lặp lại theo chu kỳ thường xảy ra khoảng 30 lần để làm tăng hoạt một gen thành một khối lương lớn hơn rất nhiều lần so với khối lượng DNA ban đầu. b. Ứng dụng PCR trong nghiên cứu PCV2 Kỹ thuật PCR lần đầu tiên được ứng dụng để phát hiện PCV2 trong mô được báo cáo vào năm 1997 bởi Narar và ctv. Trên thế giới, nhiều tác giả đã ứng dụng kỹ thuật PCR để tìm hiểu đặc tình của PCV2 trong những đàn có hoặc không có hội chứng PMWS như Allan và ctv (1998), Harmel (1998), Calsamiglia (2001), Kim (2002), Segales và Morvan (2002)… Trong chuẩn đoán những bệnh liên quan với PCV2, các tác giả (Mori và ctv,2000; Lyoo và Park, 2001; Royer và ctv, 2001) đều nhận định kỹ thuật PCR là rất nhạy và đặc hiệu trong chuẩn đoán xác định PCV2. Nghiên cứu về PCV2 bằng phương pháp xét nghiệm khác nhau, Stevenson (2000) nhận định kỹ thuật PCR là nhạy nhất, kế đến là kỹ thuật lai trong mô và thấp nhất là kỹ thuật phân lập virus. Quardani và ctv (1999) cho biết độ nhạy của kỹ thuật PCR trong phát hiện PCV2 có thể đạt đến 5pg DNA của virus. 7.Chuẩn đoán PMWS virus A. Giới thiệu chung về các phương pháp chuẩn đoán PMWS virus Trong chuẩn đoán xác định nguyên nhân gây ra PMWS cần phải sử dụng các kỹ thuật thể hiện liên quan trực tiếp giữa virus và bệnh tích mô, chính vì tế kỹ thuật
  12. 12 hóa mô miễn dịch, lai tại chỗ… được khuyến cáo áp dụng nhiều hơn so với kỹ thuật PCR hoặc phân lập virus đơn thuần. Việc phát hiện PVC2 chỉ cho phép kết luận thú bị nhiễm PVC2 nhưng không thể kết luận thú bị PMWS. DNA hoặc kháng nguyên của PVC2 có thể phát hiện bằng kỹ thuật hóa mô miễn dịch, lai tại chỗ trong đại thực bào của nhiều loại mô bệnh. Do đó sự khác biệt về gen của ORF2 nhiều hơn so với ORF1 nên các đoạn dò thường được thiết kế dựa trên sự khác biệt gen của ORF2 nhằm chuẩn đoán phân biệt PCV1 và PCV2. Muirhead (2002) cho rằng để chuẩn đoán chính xác PMWS cần dựa trên 3 tiêu chí: biểu hiện lâm sàng, bệnh tích đặc trưng và xét nghiệm chứng minh acid nucleotide hoặc kháng nguyên của PCV2 liên quan đến bệnh tích đặc trưng. • Những biểu hiện lâm sàng: tuổi mắc bệnh thường từ 6-14 tuần có khi lên đến 20 tuần, còi cọc, giảm tăng trọng, chậm lớn, chết đột ngột, có thể đi kèm với chứng thở khó hoặc hoàng đảng. Chuẩn đoán phân biệt heo bệnh do PCV2 so với những nguyên nhân khác cũng làm heo còi, suy nhược như suy dinh dưỡng, thiếu ăn, thiếu nước, loét dạ dày, viêm phổi địa phương, viêm ruột do E.coli, bệnh hồng lỵ trên heo, hội chứng PRRS, PDNS (Pemek và ctv,2002). • Bệnh tích mổ khám: tích nhiều dịch trong các xoang suy thoái các tổ chức lympho, hạch lympho sưng lớn và viêm nhiễm tại các cơ quan khác. • Những xét nghiệm tại phòng thí nghiệm: Bệnh tích vi thể: thể bao hàm ưa kiềm, nang lympho thoái triễn, mô bệnh tiến triển từ viêm mô lympho đến u hạt trong cơ quan (chủ yếu phổi và hạch lympho). Phương phát huyết thanh học: giúp đánh giá tình trạng nhiễm PCV2 trong đàn. Kháng thể có thể được phát hiện bằng phương pháp miễn dịch huỳnh tế bào một quang gián tiếp (IFA), xét nghiệm miễn dịch peroxidase gián tiếp trên tế bào một lớp (IPMA) hoặc Elisa. Trong đó, phương pháp Elisa cạnh tranh hiện được chọn để phát hiện PCV2 trong mọi tình huống với PCV2 là kháng nguyên và tác nhân
  13. 13 phản ứng cạnh tranh là kháng thể đơn dòng đặc hiệu PCV2. Kỹ thuật Elisa cạnh tranh có độ nhạy đến 99.5% và độ đặc hiệu cũng khá cao 97.1 (Walker và ctv, 2000). Hóa mô miễn dịch tế bào ( ICC_ immunocytochemitry) và kỷ thuật lai trong mô (ISH_insitu hybridisation): cả hai phương pháp được dùng để phát hiện kháng nguyên PCV2 trong các mô của những ca PMWS. Hầu hết các nghiên cứu về PMWS hoặc PCV2 đều sử dụng một hoặc cả hai kỹ thuật này. Trong đó, kỹ thuật ICC nhạy hơn rất nhiều so với kỹ thuật ISH (Neilly và ctv,1999). Phân lập virus: phương pháp này liên quan đến việc nuôi cấy trên môi trường tế bào PK_15 được ly trích từ những mô của mô không lây nhiễm PCV1, nhưng cách này mất nhiều ngày và không nhạy so với kỹ thuật ICC và ISH (Sorden,2000). Về cơ bản, phân lập virus chủ yếu phục vụ cho việc bào chế vaccine và định type virus. Người ta không ứng dụng nó vào mục đích chuẩn đoán hoặc chứng minh sự có mặt của PCV2 hay hội chứng PMWS trong đàn. Kỹ thuật PCR: có độ chính xác cao và ít tốn thời gian nên hiện nay được úng dụng trong chuẩn đoán phân biệt giữa PCV1 và PCV2. Trong đó, kỷ thuật PCR nhiều mồi (multiplex PCR assays) hiện được sử dụng rộng rãi để phát hiện những chủng PCV2 phân lập từ những ca khác nhau. So với nhiều phương pháp khác lợi thế của phương pháp PCR là có thể ứng dụng để xét nghiệm cho nhiều loại mẫu khác nhau như huyết thanh, mẫu mô tươi hoặc đong lạnh và cả những mẫu tinh dịch. Do có độ nhạy cao nên kỹ thuật PCR đòi hỏi phòng thí nghiệm phải hiện đại và kỹ thuật viên thao tác tốt. B.Sử dụng phương pháp PCR để chuẩn đoán. a. Bước đầu ghi nhận sự hiện diện của Porcine circovlrus type 2 trên heo biểu hiện còi tại một số trại heo công nghiệp ở TP. Hồ Chí Minh và vùng lân cận. VẬT LIỆU VÀ PHƯƠNG PHÁP
  14. 14 Mẫu: bạch huyết của những heo có dấu hiệu còi cọc sau cai sữa, lứa tuổi từ 6 đến 18 tuần, nuôi tại một số trại heo công nghiệp từ thành phố Hồ Chí Minh và một số tỉnh lân cận. Sử dụng phương pháp PCR để phát hiện sự hiện diện của virus PCV2 trong mô. Ly trích DNA của virus PCV2 theo mô tả của Lyoo K, và cộng sự (2001). Chạy phản ứng PCR theo mô tả của Harm và cộng sự (2001). Bộ primer sử dụng đặc hiệu cho sản phẩm với kích thướt 702bp. Các thành phần cho một phản ứng chạy PCR chứa 50 μl dung dịch hỗn hợp bao gồm: 1 μl dung dịch MgCl2 15mM, 0.4 μl dNTPs, 10pmol mỗi đoạn mồi, 1 U Tap DNA polymerase và 3 μl dung dịch nẫu ly trích DNA, sau đó cho thêm nước để đạt thể tích 50 μl. Hỗn hợp chạy PCR với thông số theo như mô tả của sản phẩm này. Sản phẩm PCR được phân tích ở nồng độ agar 0.8%. KẾT QUẢ VÀ THẢO LUẬN Trong 25 mẫu bạch huyết được thu thập và xét nghiệm để thăm dò sự hiện diện của PCV type 2 bằng phương pháp PCR, chúng tôi phát hiện được 9 mẫu dương tính với virus này chiếm tỷ lệ 36%. Tỷ lệ mẫu dương tính tại các trại được thu thập mẫu như sau: NGHIÊN CỨU KHOA HỌC KỶ THUẬT Bảng 1: tỷ lệ dương tính với PCV type 2 tại các trại được khảo sát: Trại/chỉ tiêu theo 1 2 3 4 dõi Số mẫu theo dõi 4 5 6 10 Số mẫu khảo sát 1 0 2 6 Tỷ lệ % 25,00 0,00 33,33 60,00 Tỷ lệ dương tính đối với PCV2 trên heo còi tại các trại biến động rất lớn, từ không nhiễm đến 60%. Điều này xảy ra do điều kiện vệ sinh chăm sóc, nguồn gốc heo,
  15. 15 việc xuất nhập heo ở mỗi trại khác nhau. Hội chứng còi cọc sau cai sữa do PCV2 được mô tả là có thể xuất hiện ở bất kỳ dạng trại chăn nuôi nào, từ trại nuôi heo thịt đến trại nuôi heo giống, cũng như không phụ thuộc vào quy mô chăn nuôi, từ trại có 30 heo nái đến trại có 10.000 nái. Dewey C, (2000) đã thực hiện thí nghiệm để tìm ra nguyên nhân gây hội chứng còi trên heo sau cai sữa và ông đã rút ra kết luận rằng vấn đề vệ sinh chăm sóc và điều kiện địa lý cũng như mật độ chăn nuôi có ảnh hưởng chủ yếu trong việc phát tán mầm bệnh gây ra hội chứng này. Bảng 2. Tỷ lệ mẫu dương tính với PCV type 2 tại các trại được khảo sát. Nhóm tuổi(tuần)/ 6-8 9-11 12-18 Chỉ tiêu theo dõi Số mẫu khảo sát 8 10 7 Số mẫu dương tính 3 4 2 Tỷ lệ % 37,55 40,00 28,57 Kết quả cho thấy có thể phát hiện được virus PCV2 ở bất cứ nhóm tuổi heo nào có biểu hiện còi. Bảng 3. Sự phân bố virus PCV2 trên 3 loại hạch bạch huyết của heo có biểu hiện còi. Vị trí hạch/chỉ tiêu Hạch bẹn cạn Hạch phổi Hạch ruột theo dõi Số mẫu khảo sát 25 25 25 Số mẫu dương tính 9 3 5 Tỷ lệ % 36,00 12,00 20,00 Kết quả từ phản ứng PCR cho thấy hạch bẹn cạn là vị trí phát hiện PCV2 cao nhất trên những heo được khảo sát. Ngoài vị trí các hạch bạch huyết như hạch hạnh nhân vùng miệng của heo cũng như phát hiện có sự khu trú của virus PCV2 (Segales J và ctv,2001).
  16. 16 Phần lớn những nghiên cứu về bệnh này trên thế giới đều cho rằng virus PCV2 có liên quan đến sự suy giảm miễn dịch của heo, làm heo dễ bị kế phát những mầm bệnh khác, phổ biến nhất là những vi khuẩn gây bệnh đường hô hấp. Maes R,2000 cho rằng tỷ lệ bệnh do PCV2 gây ra thì thấp, nhưng tỷ lệ chết thường lên đến 100%. Bahnson P (2002) đã xác nhận vai trò của PCV2 trong việc gây hội chứng PMWS ở heo. b. Phát hiện virus PCV2 bằng kỷ thuật PCR Phân bố, thu thập và bảo quản mẫu. Phân bố mẫu. Chọn những trại có tiền sử heo cai sữa bị còi hoặc đang có heo còi với tỷ lệ tăng đột ngột sau cai sữa với những quy mô khác nhau (theo đàn nái) để lấy mẫu. Dựa theo số liệu điều tra qui mô, cơ cấu đàn heo của chi cục thú y TP Hồ Chí Minh năm 2005 (tài liệu lưu hành nội bộ). Chúng tôi phân thành 5 loại quy mô chăn nuôi theo số lượng heo nái trong trại như sau:
  17. 17 Quy mô trại heo Số trại lấy mẫu Số heo còi chọn Tổng cộng heo còi Theo số lượng heo mổ/ trại chọn mổ nái. ≤10 5 2 10 11-50 4 2-3 9 51-100 6 2-4 16 101-200 4 3-5 14 >200 3 5-6 16 Tổng cộng 65 Thu thập và bảo quản mẫu Số heo chọn khảo sát là 65 con, được ghi nhận tất cả triệu chứng, sau đó mổ khám để ghi lại bệnh tích theo mức độ nặng nhẹ của ca bệnh và chụp hình theo từng cụm quan sát. Bước tiến hành 1. ly trích DNA lần lượt từ các mẫu đã chọn (Lyoo và Park,2001) • Cắt nhỏ mẫu (khoảng 1 cm3) cho vào ống eppendorf • Thêm 60 μl dung dịch đệm (50mM tris-HCl, 1mM EDTA và 1% SDS, pH=8) và 3 μl protease, ủ hỗn hợp ở 55oC trong 1h. • Cho vào hỗn hợp phenol/chloroform/isoamyl alcohol (25:24) vortex nhẹ, ly tâm 12.000 vòng/phút trong 2 phút, lấy phần nước nổi, cho thêm vào 1mL ethanol lạnh, ủ ở -20oC trong 2h, ly tâm 12.000 vòng/phút trong 2 phút ở 10oC, lấy cặn làm ráo • Cho thêm vào 180 μl TE 1X, vortex, ủ 55oC trong 15 phút. • Cho vào 20μl natri acetate 2M, trộn đều, tiếp tục cho vào 500μl ethanol tuyệt đối lạnh, trộn đều, ủ ở trong 15 phút ly tâm 12.000 vòng/phút trong 2 phút ở 10oC bỏ phần nổi, lấy cặn, rửa cặn bằng 1ml ethanol 70%, ly
  18. 18 tâm 12.000 vòng/phút trong 2 phút ở 10oC, lấy cặn rồi làm khô cặn trong tủ ấm ở 55oC. • Hòa tan cặn bằng 200μl TE 1X, ủ 25oC qua đêm, vortex. Sản phẩm PCR sau khi ly trích được giữ ở -20oC hoặc sử dụng ngay. Thực hiện phản ứng PCR. Tiến hành phản ứng PCR với sản phẩm DNA đã ly trích bằng cách dùng cặp mồi đặc hiệu với PCV2 (Hams và ctv, 2001). Mồi xuôi PCV1067: 5’ TTAGGCTTTAAGTGGGTGTG 3’. Mồi ngược PCV1740: 3’ATGACGTATCCAAGGAGCCG 5’. Các thành phần cho phản ứng PCR phát hiện DNA của virus PCV2: PCR bufer 10X 1.5 μl MgCl2 15mM 1μl dNTPs 10mM 0.35μl MX 0.5mM 0.8μl MN 0.5mM 0.8μl Tap DNA polymerase 5UI 0.2μl DNA mẫu 2μl Nước cất hai lần vô trùng đầy đủ 20μl Trộn đều nhẹ nhàng hỗn hợp trên, chạy PCR để khuếch đại DNA bằng máy luân nhiệt Chu trình chạy PCR bằng máy luân nhiệt. 940C trong 5 phút 94oC trong 60s 56oC trong 56s 72oC trong 45s 72oC trong 3 phút Điện di trên gel agarose và đọc kết quả.
  19. 19 Sản phẩm đã khuếch đại được kiểm tra bằng cách chạy điện di trên thạch agarose 20% trong dung dich TBE với thời gian 30 phút. Nhuộm gel trong dung dịch ethidium bromide 1/10.000 Đọc kết quả bằng máy chụp gel có gắn với màn hình vi tính (sử dụng phần mềm Quantitu one 2000). Sản phẩm PCR cần thu hoạch tại vị trí 702bp. 9. Kết quả và thảo luận Trong nghiên cứu này, đã ghi nhận sự hiện diện của virus PCV2 dựa vào cặp mồi được Harms và ctv (2001) mô tả. Kết quả của phương pháp PCR cho sản phẩm có kích thướt 702bp. Một số tác giả khác cũng đã thiết kế những cặp mồi khác nhau để phát hiện virus PCV2 như Quardani và ctv (1999), Lyoo và Park (2001), Fenaux và ctv (2002). Mỗi cặp mồi sẽ cho sản phẩm PCR có kích thướt đặc trưng tương ứng. Hình 1. Kết quả chạy PCR để phát hiện PCV2 từ heo có biểu hiện còi. Nghiên cứu về PCV2 có rất nhiều kỹ thuật khác nhau. Trong đó, kỹ thuật huyết thanh học (IFA, IPMA hoặc Elisa) dùng để đánh giá tình trạng nhiễm
  20. 20 PCV2 của đàn, kỹ thuật mô hóa miễn dịch hoặc lai trong mô nhằm phát hiện kháng nguyên PCV2 trong mô heo nhiễm PCV2 và heo mắc hội chứng PMWS. Phân lập virus phục vụ công tác điều chế vacine và định tuýt virus PCV. Riêng kỹ thuật PCR được ứng dụng nhiều nhất phục vụ công tác chuẩn đoán xác định PCV2.(Lekcharoensuk và ctv, 2004). Tương tự như phương pháp huyết thanh học, hạn chế của kỷ thuật PCR là không thể chuẩn đoán phân biệt giữa những ca dương tính PCV2 với các ca PMWS. Ngoài ra, kỹ thuật này đòi hỏi phải có phòng xét nghiệm chuẩn và kỹ thuật viên thao tác tốt nhằm tránh sự phân loại nhằm lẫn do vấy nhiễm từ phòng thí nghiệm hoặc nhiễm chéo suốt trong quá trình thu thập mẫu… Khắc phục hạn chế của kỹ thuật PCR định tính, PCR định lượng đang được phát triển. Nó kết hợp chặc chẽ một nồng độ biết trước của DNA cạnh tranh để giúp so sánh các mức độ DNA PCV2 trong huyết thanh của heo khỏe mạnh so với DNA PCV2 của những heo mắc hội chứng PMWS (Liu và ctv,2000). Các tác giả cũng cho biết độ nhạy của kỹ thuật PCR trong phát hiện PCV2 đạt đến 99.7% và độ đặc hiệu là 98.1%.
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2