Associations of otubain 1, stat, shp and NF-KB2 expression with clinical features in NON-HODGKIN’s lymphoma patients

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:10

Thêm vào BST

Báo xấu

7
lượt xem 1
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

In this study, all the expressions of Otubain-1, NF-κB2, SHPs and STATs genes, the concentrations of cytokines IL-1β, IL-6 and TNF-α and clinical features in NHL patients were examined. To the end, gene expression levels of 82 NHL patients and 56 healthy individuals were determined by quantitative real time RT-PCR and secretion of cytokines by ELISA.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Associations of otubain 1, stat, shp and NF-KB2 expression with clinical features in NON-HODGKIN’s lymphoma patients

ACADEMIA JOURNAL OF BIOLOGY 2024, 46(1): 69–78 DOI: 10.15625/2615-9023/19064 ASSOCIATIONS OF OTUBAIN-1, STAT, SHP AND NF-KB2 EXPRESSION WITH CLINICAL FEATURES IN NON-HODGKIN’s LYMPHOMA PATIENTS Do Thi Trang1, Nguyen Trong Ha2, Nguyen Thi Xuan1,3,* 1 Institute of Genome Research, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Ha Noi, Vietnam 2 103 Hospital, Vietnam Military Medical University, 261 Phung Hung, Ha Dong, Ha Noi, Vietnam 3 Graduate University of Science and Technology, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet, Ha Noi, Vietnam Received 3 October 2023; accepted 6 March 2024 ABSTRACT Non-Hodgkin's lymphoma (NHL) is a group of lymphoproliferative disorders characterized by the abnormal proliferation and accumulation of lymphocytes in the lymphatic system. An ovarian tumor domain containing ubiquitin aldehyde binding protein 1 (Otubain-1) is a deubiquitinating enzyme that cleaves ubiquitin or ubiquitin-like molecules and is expressed in various human tissues. The pathogenesis of NHL is associated with activations of the nuclear transcription factor (NF-κB) and signal transducer and activator of transcription proteins (JAK/STAT) signaling pathways. In this study, all the expressions of Otubain-1, NF-κB2, SHPs and STATs genes, the concentrations of cytokines IL-1β, IL-6 and TNF-α and clinical features in NHL patients were examined. To the end, gene expression levels of 82 NHL patients and 56 healthy individuals were determined by quantitative real time RT-PCR and secretion of cytokines by ELISA. As a result, concentrations of IL-6 and TNF-α in the patient group were found higher than in the healthy individuals and patients with higher LDH concentrations in the clinical cutoff, 280 U/L showed increased concentrations of AST, ALT and GGT than those with normal LDH concentrations. Interestingly, NHL patients with high Otubain-1 expression had significant elevations of GGT and ferritin concentrations as well as STAT-5 expression compared to those with low Otubain-1 expression. In conclusion, the present study indicates that up-regulation of Otubain-1 led to activation of STAT5 in lymphoma cells and liver dysfunction and metabolic syndrome in NHL patients. Keywords: NF-kB2, Otubain-1, non- Hodgkin’s lymphoma and STAT5. Citation: Do Thi Trang, Nguyen Trong Ha, Nguyen Thi Xuan, 2024. Associations of OTUBAIN-1, STAT, SHP and NF-KB2 expression with clinical features in Non-Hodgkin’s lymphoma patients. Academia Journal of Biology, 46(1): 69–78. https://doi.org/10.15625/2615-9023/19064 * Corresponding author email: xuannt@igr.ac.vn 69
Do Thi Trang et al. INTRODUCTION adenocarcinoma (Weng et al., 2016). Non-Hodgkin’s lymphoma (NHL) is a Inactivation of Otubain-1 is observed in group of lymphoproliferative disorders chronic myeloid leukemia in our study (Hoang characterized by the abnormal proliferation and et al., 2022). The activations of Akt-mTOR and accumulation of lymphocytes in lymph nodes MAPK pathways are associated with the or extranodal lymphatic tissues (Swerdlow et expression levels of Otubain-1 (Lin et al., 2009; al., 2016). Globally, the NHL ranked as the 11th Zhou et al., 2014). most commonly diagnosed cancer and occurs Investigations on mechanisms underlying more frequently in males (Mafra et al., 2022). the modulations of functions of lymphoma The estimated incidence of NHL is 5/100,000 cells indicated that the pathogenesis of NHL (nearly 545,000 new cases) and the mortality is related to activations of the nuclear rate is about 3/100,000 (260,000 deaths) transcription factor (NF-κB) and signal worldwide in 2020 (Mafra et al., 2022). NHL is transducer and activator of transcription generally divided into B-cell and T-cell proteins (JAK/STAT) signaling pathways lymphomas, depending on the lymphocyte (Ramis-Zaldivar et al., 2021). Inactivation of lineage (Rogers et al., 2006). Among NHL, SH2 domain-containing tyrosine phosphatase diffuse large B-cell NHL is the most common (SHP) 1 correlates with the advanced stages subtype and has an aggressive natural history of NHL (Witkiewicz et al., 2007). SHP1- but responds well to chemotherapy (Isshiki et deficient mice display a variety of al., 2021). In patients with NHL, lactate hematopoietic abnormalities including dehydrogenase (LDH), β2-microglobulin and hypersensitivity of erythroid progenitors to ferritin have been documented to be erythropoietin and marked myeloid inflammatory and adverse prognostic factors proliferation (Dong et al., 1999). SHP-1 is a (Zhong et al., 2019). Among them, LDH negative regulator of, while SHP2 participates reflects the proliferative activity of lymphoma in promoting activations of JAK/STAT cells and is an important prognostic factor in signaling pathways (Lorenz et al., 2009; NHL (Dumontet et al., 1999). β2- Maroun et al., 2000; Tajan et al., 2015). microglobulin is a marker of tumor burden and Activation of the signaling molecules induces is associated with the prognosis of most types immune cells to secrete inflammatory of NHL, mainly including follicular cytokines, including IL-6, TNF-α and IL-1β, lymphoma, mantle cell lymphoma and diffuse which cause chronic inflammation and the large cell lymphoma (Lazzarino et al., 1998). development of neoplasms and their Cases with increased β2-microglobulin progression (Hoermann et al., 2015). TNF-α concentrations have a high risk of the has been demonstrated to directly contribute development of NHL (Wang et al., 2015). to the enhancement of the growth and development environment of NHL cells An ovarian tumor domain containing (D’Mello K et al., 2021). ubiquitin aldehyde binding protein 1 (Otubain-1) is considered as a In this study, the associations among the deubiquitinating enzyme, which crucially expressions of Otubain-1, NF-κB2, SHPs and regulates the ubiquitination-mediated STATs genes, the concentrations of cytokines degradation and expressed in various human IL-1β, IL-6 and TNF-α and clinical outcomes tissues, such as the kidney, colon, stomach, in 82 NHL patients and 56 healthy individuals brain, and liver (Saldana et al., 2019). Otubain- were determined. 1 is a negative regulator of cell function through MATERIALS AND METHODS the activation of several signalling molecules such as MAPK (Xuan et al., 2019). Increased Clinical samples Otubain-1 expression has been reported in Fresh peripheral blood samples (4 mL) colorectal (Zhou et al., 2014) breast cancers were collected from untreated 82 NHL (Karunarathna et al., 2016) and gastric patients based on cytomorphology and 70
Associations of OTUBAIN-1, STAT, SHP cytochemistry according to the WHO kits (Thermo Scientific) in accordance with (Swerdlow et al., 2016) classifications, at the the manufacturer’s instructions. National Institute of Haematology and Blood RNA extraction and Real-time PCR Transfusion, Ha Noi, Vietnam. The control group comprised 56 healthy individuals. No Total mRNA was isolated using the individuals in the control population took any Qiashredder and RNeasy Mini Kit from Qiagen medication or suffered from any known acute according to the manufacturer’s instructions. For cDNA first-strand synthesis, 1 µg of total or chronic disease. All patients and volunteers RNA in 12.5 µL DEPC-H2O was mixed with gave written consent to participate in the 1 µL of oligo-dT primer (500 µg/mL, study. Person care and experimental Invitrogen) and heated for 2 min at 70 oC. To procedures were performed according to determine transcript levels of Otubain-1, Vietnamese law for the welfare of humans NF-κB2, STAT-1, STAT-5, STAT-6, SHP-1 and and were approved by the Ethical Committee SHP-2, the quantitative real-time PCR with the of the Institute of Genome Research, Vietnam LightCycler System (Roche Diagnostics) was Academy of Science and Technology. applied. The GenBank accession numbers, Cytokine quantification including NM_017670.3, NM_001322934.2, NM_007315.4, NM_012448.4, NM_003153.5, Serum samples were collected from both NM_002831.6 and NM_002834.5 were used NHL patients and healthy subjects and kept at for analysis of mRNA expressions of -20 oC until they were utilized for ELISA Otubain-1, NF-κB2, STAT-1, STAT-5, STAT-6, analysis. The concentrations of TNF-α, IL-6, SHP-1 and SHP-2 genes, respectively. The and IL-1β were determined by using ELISA following primers were indicated in Table 1. Table 1. Primer sequences used for Real-time PCR Gene Forward (5’→3’) Reverse (5’→3’) Otubain-1 ACAGAAGATCAAGGACCTCCA CAACTCCTTGCTGTCATCCA NK-κB2 TAGCCACAGAGATGGAGGAG CCGAGTCGCTATCAGAGGTA STAT1 CCCTTCTGGCTTTGGATTGAA CTTCCCGGGAGCTCTCACTGA STAT5 CAGACCAAGTTTGCAGCCAC CACAGCACTTTGTCAGGCAC STAT-6 GCCCACTCACTCCAGAGGACCT GGTGTTGGGGAAAGTCGACAT SHP-1 GCC CAG TTC ATT GAA ACC AC GAG GGA ACC CTT GCT CTT CT SHP-2 GAGAGCAATGACGGCAAGTCT CCTCCACCAACGTCGTATTTC GAPDH GGAGCGAGATCCCTCCAAA GGCTGTTGTCATACTTCTCAT PCR reactions were performed in a final 0 s to determine the melting temperature of volume of 20 µL containing 2 µL cDNA, primer dimers and the specific PCR products. 2.4 µL MgCl2 (3 µM), 1 µL primer mix The ratio between the respective gene and (0.5 µM of both primers), 2 µL cDNA corresponding GAPDH was calculated per Master Syber Green I mix (Roche Molecular sample according to the ∆∆ cycle threshold Biochemicals), and 12.6 µL DEPC-treated method (Livak et al., 2001). water. The target DNA was amplified during Statistics 40 cycles of 95 ºC for 10 s, 62 ºC for 10 s, and 72 ºC for 16 s, each with a temperature Statistical analysis was performed with the transition rate of 20 ºC/s, a secondary target SPSS and GraphPad Prism 8 software. The temperature of 50 ºC, and a step size of statistical significance of the differences was 0.5 ºC. Melting curve analysis was determined by the Mann–Whitney U test. P < performed at 95 ºC, 0 s; 60 ºC, 10 s; 95 ºC, 0.05 was considered statistically significant. 71
Do Thi Trang et al. RESULTS AND DISCUSSION clinical cutoff, 280 U/L, was 70/82 patients (85.4%), in which the patients were diagnosed Clinical features in patients with NHL in stage I in 16/70 (22.9%), 12/70 (17.1%) in A comprehensive correlation analysis of stage II, 13/70 (18.6%) in stage III and 29/70 82 patients with NHL showed significant (41.4%) in stage IV. The patients with normal increases in glucose, ferritin, AST, ALT, LDH LDH concentrations were diagnosed in stage I and β2-microglobulin concentrations in the in 4/12 (33.33%), 3/12 (25%) in stage II, 2/12 patient group (Table 2). Consistently, LDH is (16.67%) in stage III and 3/12 (25%) in stage an important prognostic factor in patients with IV. Importantly, the patients with LDH NHL (Dumontet et al., 1999) and cases with concentrations above the clinical cutoff were elevated β2-microglobulin concentrations are older and had elevations of AST, ALT and at increased risk of early mortality (Wang et GGT concentrations than those with normal al., 2015). Among the 82 patients with NHL LDH concentrations, however, the differences at diagnosis in this study, the frequency of did not reach the statistical significances patients with higher LDH concentrations the (Table 3). Table 2. Associations between Otubain-1 expression and clinical parameters in NHL patients Characteristic Normal Total Otubain-1 Number of patients range N = 82 High (n = 52) Low (n = 30) p-value Age (years) 56.6 (17–86) 57.9 (17–75) 54.4 (21–86) 0.34 Sex, male (n, %) 50 (61) 32 (61.5) 18 (60) 0.841 Urea (mmol/L) 3.3–6.6 6.01 ± 2.62 5.95 ± 2.03 6.11 ± 3.46 0.79 Glucose (mmol/L) 3.9–5.6 6.6 ± 2.8 6.68 ± 3.25 6.45 ± 1.81 0.728 Creatinine (µmol/L) 50–110 81.7 ± 22.13 80.03 ± 17.95 84.65 ± 28.17 0.365 Uric acid (µmol/L) < 420 332.3 ± 128 331.8 ± 136.3 333.4 ± 114 0.955 Total bilirubin (µmol/L) 0–21 12.63 ± 10.72 11.54 ± 7.14 14.56 ± 15.09 0.219 Indirect bilirubin (µmol/L) 0–17 3.28 ± 7.51 2.68 ± 3.54 4.32 ± 11.6 0.34 Total protein (g/L) 60–80 70.92 ±8.73 70.49 ± 9.23 71.68 ± 7.84 0.555 Albumin (g/L) 35–50 36.8 ± 5.41 36.2 ± 5.24 37.9 ± 5.61 0.18 Globulin (g/L) 20–35 34.1 ± 7.44 34.28 ± 8.2 33.77 ± 5.99 0.764 Ferritin (ng/ml) 10–300 569.3 ± 508.9 659.6 ± 528.1 409.8 ± 437.1 0.031* AST (GOT) (U/L) 5–40 46.99 ± 76.19 39.62 ± 44.52 59.99 ± 112.18 0.244 ALT (GPT) (U/L) 7–55 57.29 ± 106.7 51.15 ± 62.61 68.14 ± 158 0.489 GGT (U/L) < 66 57.8 ±83.7 70.7 ± 101 35 ± 29 0.05* LDH (U/L) 140–280 580.5 ± 472.7 541 ± 473.1 650.3 ± 471.8 0.315 β2 microglobulin 0.8–2.2 2.97 ±1.99 2.82 ± 1.53 3.22 ± 2.65 0.373 concentration (mg/L) Hemoglobin (g/L) 120–180 124.5 ± 19.77 122.6 ± 17.18 127.9 ± 23.6 0.243 Erythrocytes (10*12 cells/L) 3.8–5.9 4.13 ± 0.62 4.04 ± 0.53 4.29 ± 0.73 0.087 Otubain-1 is known as a negative 6 and TNF-α are known as inflammatory regulator of the release of IL-6, but not TNF-α mediators of cell growth, in mouse dendritic cells (Xuan et al., 2019). In maturation/differentiation and programmed this finding, the serum concentrations of IL-6 cell death (Xuan et al., 2015). The and TNF-α in the patient group were also concentrations of TNF-α are elevated in cases found higher than in healthy individuals, of diffuse large B-cell lymphoma and however, these patients showed no change in associated with an increased risk of the serum concentrations of IL-1β (Fig. 1). IL- developing this disease (Edlefsen et al., 2014). 72
Associations of OTUBAIN-1, STAT, SHP Table 3. Associations between LDH concentrations and clinical parameters in NHL patients Characteristic LDH Number of patients High (n = 70) Normal (n = 12) p-value Age (years) 57.3 (17–86) 48 (27–79) 0.1 Sex, male (n, %) 42 (60) 8 (66.67) 0.724 Urea (mmol/L) 6.06 ± 2.65 5.62 ± 2.77 0.64 Glucose (mmol/L) 6.66 ± 2.96 6.23 ± 1.68 0.674 Creatinine (µmol/L) 81.26 ± 23.19 82.92 ± 17.15 0.836 Uric acid (µmol/L) 332.6 ± 135.2 330.7 ± 86.16 0.967 Total bilirubin (µmol/L) 12.8 ± 11.55 11.9 ± 2.07 0.817 Indirect bilirubin (µmol/L) 3.41 ± 8.06 2.46 ± 0.93 0.73 Total protein (g/L) 70.59 ± 8.6 74.39 ± 10.44 0.227 Albumin (g/L) 36.6 ± 5.4 38.6 ± 6.17 0.31 Globulin (g/L) 33.98 ± 7.44 35.79 ± 8.4 0.499 Ferritin (ng/ml) 573.8 ± 529.6 482.5 ± 424.6 0.621 AST (GOT) (U/L) 50.72 ± 81.72 23.53 ± 12.97 0.325 ALT (GPT) (U/L) 62.9 ± 114.3 23.46 ± 20.76 0.307 GGT (U/L) 62.5 ± 89.7 31.9 ± 12.6 0.31 LDH (U/L) 645.17 ± 481.4 201.05 ± 76.43 0.007** β2 microglobulin concentration (mg/L) 3.001 ± 2.1 2.97 ± 1.22 0.961 Hemoglobin (g/L) 124.8 ± 20.25 123.2 ± 19.15 0.825 Erythrocytes (10*12 cells/L) 4.15 ± 0.64 4.05 ± 0.64 0.68 Figure 1. Arithmetic means ± SEM (n = 56–82) of IL-1β, TNF-α and IL-6 concentrations are attained from sera of healthy donors (white bars) and NHL patients (grey bars). *** (p < 0.001) indicates a significant difference from healthy donors (Mann–Whitney U test) Associations of Otubain-1 expression with Recently, Otubain-1 is downregulated in clinical outcomes in NHL chronic myeloid leukemia (Hoang et al., 2022). In this study, we asked whether there are The associations of Otubain-1 expression associations among Otubain-1 expression levels and susceptibility to NHL are unknown. levels, clinical outcomes and activations of 73
Do Thi Trang et al. signalling genes including NF-kBs, STATs and significantly higher GGT and ferritin levels SHPs. Accordingly, the expression levels of compared to those with low Otubain-1 Otubain-1 were examined by quantitative real expression (Table 2). In addition, there were no time-PCR and divided into two groups based significant differences in the other clinical on the median Otubain-1 expression values in indicators between the two groups (Table 1). healthy controls (high vs. low). A high GGT and ferritin are known to be involved in Otubain-1 expression group was detected in 52 pathophysiological processes, including liver samples (63.4%) and a low Otubain-1 damage and metabolic syndrome (Chen et al., expression group was detected in 30 samples 2010), suggesting that patients with high (36.6%) (Fig. 2 & Table 2). Importantly, NHL Otubain-1 expression had risks of these patients with high Otubain-1 expression had diseases. Figure 2. Otubain-1 expression in NHL patients. The graph indicates the mRNA levels of Otubain-1 in control individuals (n = 56) and NHL patients with high Otubain-1 expression (n = 52) and low Otubain-1 expression (n = 30); GAPDH was used as a reference gene for relative quantification; each dot represents a single sample. * (p < 0.05) and *** (p < 0.001) show significant differences from healthy individuals, ≠≠≠ (p < 0.001) shows significant differences from the low Otubain-1 expression group (Mann–Whitney U test) Recently, activation of MAPKp38, but not prolonged phosphorylation of LPS-stimulated NF-κB is regulated by Otubain-1 (Xuan et al., p38MAPK (Xuan et al., 2019). The evidences 2019). Differently, NHL patients with high suggested that activation of STAT5 might be Otubain-1 expression had significantly correlated with the regulatory effects of increased levels of STAT-5 compared to those Otubain-1 on the functions of lymphoma cells. with low Otubain-1 expression (Fig. 3). In this study, the expression levels of NF- Activations of other signalling molecules κB2 and SHP-1 were notably reduced in NHL including, NF-kB2, STAT1, STAT6, SHP1 and SHP2 were not related to Otubain-1 expression cases compared to the control group (Fig. 3). levels (Fig. 3). Differently, Otubain-1 interacts Similarly, SHP-1 expression is the loss in with NF-κB2 to control its activation in B cells hematological malignancies, leading to the (Li et al., 2019). Recently, our study indicated activation of the JAK/STAT pathway in these that downregulation of Otubain-1 expression patients (Chim et al., 2004; Oka et al., 2002) results in enhanced DC function mediated by and activation of SHP-1 signalling is known 74
Associations of OTUBAIN-1, STAT, SHP to induce cell apoptosis in NHL (Chen et al., essential thrombocythemia patients (O’Sullivan 2022). Unlike the results of this study, NF-κB2 et al., 2019). is found to be upregulated in B-cell NHL (Savli In conclusion, the present study indicated et al., 2016) and activations of NF-κB2 and that overexpression of Otubain-1 resulted in JAK-STAT pathways are involved in the activation of STAT5, liver dysfunction and pathogenesis of HL (Zhang et al., 2018). In metabolic syndrome in NHL patients. addition, overexpression of SHP-2 is detected Otubain-1 might be a good candidate for in patients with leukemia (Voena et al., 2007) further study on its role in regulating the and the expression levels of STAT3 and functional activation of lymphoma cells STAT5 are enhanced in polycythemia vera and mediated through STAT5 signalling. Figure 3. Associations between Otubain-1 and signalling gene expressions in NHL patients. Graphs indicate the mRNA levels of NF-KB2, STAT-1, STAT-5, STAT-6, SHP-1 and SHP-2 in control individuals (n = 56) and NHL patients with high Otubain-1 expression (n = 52) and low Otubain-1 expression (n = 30). *(p
Do Thi Trang et al. Chen T., Ren Y., Liu Y., Long Y., Zhang X., Hoermann G., Greiner G., Valent P., 2015. Yu H., Xu J., Yu T., Tian H., 2010. Serum Cytokine Regulation of gamma-glutamyl transferase, ferritin and Microenvironmental Cells in the risk of type 2 diabetes in women from Myeloproliferative Neoplasms. Mediators a Chinese minority. Diabetes Res Clin Inflamm, 2015: 869242. Pract, 90: 352–7. Isshiki Y., Melnick A., 2021. Epigenetic Chim C. S., Fung T. K., Cheung W. C., Liang Mechanisms of Therapy Resistance in R., Kwong Y. L., 2004. SOCS1 and SHP1 Diffuse Large B Cell Lymphoma hypermethylation in multiple myeloma: (DLBCL). Curr Cancer Drug Targets, 21: implications for epigenetic activation of 274–82. the Jak/STAT pathway. Blood, 103: Karunarathna U., Kongsema M., Zona S., 4630–5. Gong C., Cabrera E., Gomes A.R., Man D'Mello K. P., Zhao L., Kaser E. C., Zhu Z., E.P.S., Khongkow P., Tsang J.W.H., Xiao H., Wakefield M. R., Bai Q., Fang Khoo U.S., Medema R.H., Freire R., Lam E.W.F., 2016. OTUB1 inhibits the Y., 2021. The role of interleukins and the ubiquitination and degradation of FOXM1 widely studied TNF-α in non-Hodgkin's in breast cancer and epirubicin resistance. lymphoma. Medical oncology Oncogene, 35: 1433–44. (Northwood, London, England), 38: 56. Lazzarino M., Orlandi E., Klersy C., Astori Dong Q., Siminovitch K. A., Fialkow L., C., Brusamolino E., Corso A., Bellio L., Fukushima T., Downey G. P., 1999. Gargantini L., Morra E., Bernasconi C., Negative regulation of myeloid cell 1998. Serum CA 125 is of clinical value in proliferation and function by the SH2 the staging and follow-up of patients with domain-containing tyrosine phosphatase- non-Hodgkin's lymphoma: correlation 1. J Immunol, 162: 3220–30. with tumor parameters and disease Dumontet C., Drai J., Bienvenu J., Berard E. activity. Cancer, 82: 576–82. N., Thieblemont C., Bouafia F., Bayle F., Li Y., Yang J.Y., Xie X., Jie Z., Zhang L., Shi Moullet I., Salles G., Coiffier B., 1999. J., Lin D., Gu M., Zhou X., Li H.S., Profiles and prognostic values of LDH Watowich S.S., Jain A., Yun Jung S., Qin isoenzymes in patients with non-Hodgkin's J., Cheng X., Sun S.C., 2019. Preventing lymphoma. Leukemia, 13: 811–7. abnormal NF-κB activation and Edlefsen K. L., Martínez-Maza O., Madeleine autoimmunity by Otub1-mediated p100 M. M., Magpantay L., Mirick D. K., stabilization. Cell research, 29: 474–85. Kopecky K. J., LaCroix A. Z., De Roos A. Lin J. T., Lineberry N. B., Kattah M. G., Su L. J., 2014. Cytokines in serum in relation to L., Utz P. J., Fathman C. G., Wu L., 2009. future non-Hodgkin lymphoma risk: Naive CD4 t cell proliferation is evidence for associations by histologic controlled by mammalian target of subtype. International journal of cancer, rapamycin regulation of GRAIL 135: 913–22. expression. J Immunol, 182: 5919–28. Hoang N. H., Huyen N. T., Trang D. T., Canh Livak K. J., Schmittgen T. D., 2001. Analysis N. X., Mao C. V., Sopjani M., Vuong N. of relative gene expression data using B., Xuan N. T., 2022. Effects of real-time quantitative PCR and the 2(- Vinblastine and Vincristine on the Delta Delta C(T)) Method. Methods, 25: function of chronic myeloid leukemic 402–8. cells through expression of A20 and Lorenz U., 2009 SHP-1 and SHP-2 in T cells: CYLD. Cell Mol Biol (Noisy-le-grand), two phosphatases functioning at many 68: 47–53. levels. Immunol Rev, 228: 342–59. 76
Associations of OTUBAIN-1, STAT, SHP Mafra A., Laversanne M., Gospodarowicz M., Savli H., Akkoyunlu R. U., Cine N., Gluzman Klinger P., De Paula Silva N., Pineros M., D. F., Zavelevich M. P., Sklyarenko L. Steliarova-Foucher E., Bray F., Znaor A., M., Koval S. V., Sunnetci D., 2016. 2022. Global patterns of non-Hodgkin Deregulated Levels of the NF-kappaB1, lymphoma in 2020. Int J Cancer, 151: NF-kappaB2, and Rel Genes in Ukrainian 1474–81. Patients with Leukemia and Lymphoma in the Post-Chernobyl Period. Turk J Maroun C. R., Naujokas M. A., Holgado- Haematol, 33: 8–14. Madruga M., Wong A. J., Park M., 2000. The tyrosine phosphatase SHP-2 is Swerdlow S. H., Campo E., Pileri S. A., required for sustained activation of Harris N. L., Stein H., Siebert R., Advani extracellular signal-regulated kinase and R., Ghielmini M., Salles G. A., Zelenetz epithelial morphogenesis downstream A. D., Jaffe E. S., 2016. The 2016 revision from the met receptor tyrosine kinase. Mol of the World Health Organization Cell Biol, 20: 8513–25. classification of lymphoid neoplasms. Blood, 127: 2375–90. O'Sullivan J., Mead A. J., 2019. Heterogeneity in myeloproliferative neoplasms: Causes Tajan M., de Rocca Serra A., Valet P., Edouard T., Yart A., 2015. SHP2 sails and consequences. Adv Biol Regul, 71: from physiology to pathology. Eur J Med 55–68. Genet, 58: 509–25. Oka T., Ouchida M., Koyama M., Ogama Y., Voena C., Conte C., Ambrogio C., Boeri Erba Takada S., Nakatani Y., Tanaka T., E., Boccalatte F., Mohammed S., Jensen Yoshino T., Hayashi K., Ohara N., Kondo O.N., Palestro G., Inghirami G., Chiarle E., Takahashi K., Tsuchiyama J., R., 2007. The tyrosine phosphatase Shp2 Tanimoto M., Shimizu K., Akagi T., interacts with NPM-ALK and regulates 2002. Gene silencing of the tyrosine anaplastic lymphoma cell growth and phosphatase SHP1 gene by aberrant migration. Cancer Res, 67: 4278–86. methylation in leukemias/lymphomas. Cancer Res, 62: 6390–4. Wang X. L., Wang X. L., He S., Zhai H. L., 2015. Association of beta2-microglobulin Ramis-Zaldivar J. E., Gonzalez-Farre B., with the prognosis of non-Hodgkin's Nicolae A., Pack S., Clot G., Nadeu F., lymphoma: a meta analysis. Int J Clin Exp Mottok A., Horn H., Song J. Y., Fu K., Med, 8: 3992–9. Wright G., Gascoyne R.D., Chan W. C., Weng W., Zhang Q., Xu M., Wu Y., Zhang Scott D.W., Feldman A.L., Valera A., M., Shen C., Chen X., Wang Y., Sheng Enjuanes A., Braziel R.M., Smeland E. B., W., 2016. OTUB1 promotes tumor Staudt L.M., Rosenwald A., Rimsza L. M., invasion and predicts a poor prognosis in Ott G., Jaffe E.S., Salaverria I., Campo E., gastric adenocarcinoma. American journal 2021. MAPK and JAK-STAT pathways of translational research, 8: 2234–44. dysregulation in plasmablastic lymphoma. Haematologica, 106: 2682–93. Witkiewicz A., Raghunath P., Wasik A., Junkins-Hopkins J.M., Jones D., Zhang Rogers B. B., 2006. Overview of non- Q., Odum N., Wasik M. A., 2007. Loss of Hodgkin's lymphoma. Semin Oncol Nurs, SHP-1 tyrosine phosphatase expression 22: 67–72. correlates with the advanced stages of Saldana M., VanderVorst K., Berg A. L., Lee cutaneous T-cell lymphoma. Hum Pathol, H., Carraway K. L., 2019. Otubain 1: a 38: 462–7. non-canonical deubiquitinase with an Xuan N. T., Trung D. M., Minh N. N., Nghia emerging role in cancer. Endocrine- V. X., Giang N. V., Canh N. X., Toan N. related cancer, 26: R1–R14. L., Cam T. D., Nga N. T., Tien T. V., 77
Do Thi Trang et al. Hoang N. H., 2019. Regulation of Zhong H., Chen J., Cheng S., Chen S., Shen p38MAPK-mediated dendritic cell R., Shi Q., Xu P., Huang H., Zhang M., functions by the deubiquitylase otubain 1. Wang L., Wu D., Zhao W., 2019. HLA, 93: 462–70. Prognostic nomogram incorporating Xuan N. T., Wang X., Nishanth G., Waisman inflammatory cytokines for overall A., Borucki K., Isermann B., Naumann survival in patients with aggressive non- M., Deckert M., Schluter D., 2015. A20 Hodgkin’s lymphoma. EBioMedicine, 41: expression in dendritic cells protects mice 167–74. from LPS-induced mortality. Eur J Immunol, 45: 818–28. Zhou Y., Wu J., Fu X., Du W., Zhou L., Meng X., Yu H., Lin J., Ye W., Liu J., Peng H., Zhang Y., Tong L., Chen S., Wu W., Wang L., 2018. Analysis of NFKB2‑mediated Liu R.-y., Pan C., Huang W., 2014. regulation of mechanisms underlying the OTUB1 promotes metastasis and serves as development of Hodgkin's lymphoma. a marker of poor prognosis in colorectal Molecular medicine reports, 17: 8129–36. cancer. Molecular Cancer, 13: 258. 78