Different roles of functional residues in the hydrophobic binding site of two sweet orange tau

Chia sẻ: Van Tien | Ngày: | Loại File: PDF | Số trang:8

Thêm vào BST

Báo xấu

38
lượt xem 1
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Tài liệu tham khảo về hóa-sinh bằng tiếng anh

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Different roles of functional residues in the hydrophobic binding site of two sweet orange tau

Different roles of functional residues in the hydrophobic binding site of two sweet orange tau glutathione S-transferases Angela R. Lo Piero, Valeria Mercurio, Ivana Puglisi and Goffredo Petrone ` Dipartimento di Scienze Agronomiche, Agrochimiche e delle Produzioni Animali (DACPA), Universita di Catania, Italy Glutathione S-transferases (GSTs) catalyze the conjugation of glutathione Keywords glutathione S-transferase; H-site; to hydrophobic compounds, contributing to the metabolism of toxic site-directed mutagenesis; sweet orange; chemicals. In this study, we show that two naturally occurring tau GSTs tau class glutathione S-transferase (GSTUs) exhibit distinctive kinetic parameters towards 1-chloro-2,4-dini- trobenzene (CDNB), although they differ only in three amino acids Correspondence (Arg89, Glu117 and Ile172 in GSTU1 are replaced by Pro89, Lys117 and A. R. Lo Piero, Dipartimento di Scienze Val172 in GSTU2). In order to understand the effects of the single mis- Agronomiche, Agrochimiche e delle ` matched residues, several mutant GSTs were generated through site-direc- Produzioni Animali (DACPA), Universita di Catania, Via S. Soﬁa 98, 95123, Catania, ted mutagenesis. The analysis of the kinetic parameters of the mutants Italy led to the conclusion that Glu117 provides a critical contribution to the Fax: +39 95 7141581 maintenance of a high-afﬁnity CDNB-binding site. However, the substitu- Tel: +39 95 7580238 tion E117K gives rise to mutants showing increased kcat values for E-mail: rlopiero@unict.it CDNB, suggesting that Lys117 might positively inﬂuence the formation of the transition state during catalysis. No changes in the Km values (Received 27 July 2009, revised 7 October towards glutathione were found between the naturally occurring GSTs 2009, accepted 5 November 2009) and mutants, except for the mutant caused by the substitution R89P in doi:10.1111/j.1742-4658.2009.07481.x GSTU1, which showed a sharp increase in Km. Moreover, the analysis of enzyme reactivation after denaturation showed that this R89P substitution leads to a two-fold enhancement of the refolded enzyme yield, suggesting that the insertion of proline might induce critical structural modiﬁcations. In contrast, the substitution P89R in GSTU2 does not modify the reacti- vation yield and does not impair the afﬁnity of the mutant for glutathi- one, suggesting that all three residues investigated in this work are fundamental in the creation of enzymes characterized by unique biochem- ical properties. Introduction The glutathione S-transferases (GSTs; EC 2.5.1.18) are origin [1–4]. GSTs are widely distributed in nature members of a multifunctional superfamily of enzymes from humans to bacteria [5–7]. In plants, the GSH catalyzing the conjugation of glutathione (GSH) to the addition reaction is coupled to the vacuolar compart- electrophilic groups of hydrophobic and usually mentation of the GSH conjugates because of the lack cytotoxic molecules of either endogenous or exogenous of an effective excretion pathway, which is active in Abbreviations 4-NPB, 4-nitrophenethyl bromide; CDNB, 1-chloro-2,4-dinitrobenzene; ECA, ethacrynic acid; GmGSTU-4-4, Glycine max tau glutathione S-transferase-4-4; GSH, glutathione; G-site, glutathione-binding site; GST, glutathione S-transferase; GSTU, tau glutathione S-transferase; H-site, hydrophobic binding site; NBD-Cl, 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole. 255 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
Functional role of the GST H-site residues A. R. Lo Piero et al. animals [8,9]. GSTs, in addition to transfer of GSH to negatively and positively charged amino acids stabi- toxic compounds, act as GSH-dependent peroxidase, lized by an array of hydrogen bonds, and appears to isomerase and oxidoreductases, playing pivotal roles in be a functionally conserved motif in all GST classes plant cell protection, as reviewed by Moons [10]. Plant [27]. In the Glycine max GSTU-4-4 (GmGSTU4-4)– GSTs are abundantly expressed, and show major tran- GSH complex, the strictly conserved residues Arg18, scriptional regulation. It has been reported that GST Glu66, Ser67 and Asp103 appear to form the proposed transcript levels can markedly increase in response to electron-sharing network [26]. Studies of the catalytic a wide variety of stressful conditions, such as herbi- properties of Pinus tabulaeformis GSTU1 by site-direc- cides [1,11], chilling [11,12], hypoxic stress [13], dehy- ted mutagenesis, which demonstrate the crucial role of dration [14], wounding [15], and pathogen attack both Ser67 and Glu66 in GSH binding, corroborate [16,17]. Most GSTs are active as dimers, either homo- these ﬁndings [28]. In contrast, the H-sites of GSTs dimers or heterodimers of subunits ranging from 23 to exhibit a low degree of sequence identity, and hence 30 kDa in size. Subunits of all known GST structures unique structures that reﬂect different functions in vivo exhibit a two-domain fold, the N-terminal domain and [18]. In a previous study, we isolated from sweet C-terminal domain, including the highly conserved orange leaves two distinct GSTU genes sharing 98.6% GSH-binding site (G-site) and the more divergent homology at the nucleotide levels and containing a cosubstrate-binding domain or hydrophobic binding 651 bp ORF. The encoded proteins differ in only three site (H-site) [7,18]. The G-site includes both a-helices amino acids: the triad Arg89, Glu117 and Ile172 found and b-strands as secondary structure elements. The in the isoform GSTU1 is replaced by the triad Pro89, topological arrangement of these elements is usually Lys117 and Val172 in the GSTU2 isoform, all of the bababba, similar to the thioredoxin fold of other mismatches being located in the H-sites of the enzymes GSH-binding or cysteine-binding proteins. The H-site [11]. As long as the enzymes were expressed in vitro is entirely helical, with a variable number of a-helices, and puriﬁed, they exhibited different speciﬁc activity depending on the speciﬁc enzymes [19]. Mechanisti- with 1-chloro-2,4-dinitrobenzene (CDNB) as substrate, cally, the catalysis of the nucleophilic aromatic substi- GSTU1 showing a value three-fold lower than that tution reactions comprises the substrate binding to the observed for GSTU2 [11]. In the present work, site- enzyme’s active site, ionization of GSH to form the directed mutagenesis was used to evaluate the effects highly reactive thiolate anion, and nucleophilic attack of the single mismatched residues on the kinetic prop- by the thiolate at the substrate electrophilic center. erties of isoforms GSTU1 and GSTU2, and also to A hydroxyl group, provided in most plant GSTs by a address questions regarding the functional roles of serine, is considered to be required for the correct ori- these H-site residues. The results have both academic entation and stabilization of the deprotonated thiolate relevance and practical importance, as they will form anion in the active site of the enzyme [20]. On the basis the basis for the design of new engineered GSTs show- of protein sequence similarity, active site residue and ing altered substrate speciﬁcity and enhanced activity gene organization plant GSTs are grouped in four towards xenobiotics. main classes (phi, tau, zeta, and theta) [18,21,22]. The majority of the plant GSTs belongs to the tau (GSTU) Results and Discussion and phi classes, which are plant-speciﬁc. Among the plant GSTs, GSTUs are the most numerous, and Wild-type (GSTU1 and GSTU2) and mutant GSTs members of this class overlap in their function of were expressed and puriﬁed as described in Experimen- enhancing crop stress tolerance. Despite the important tal procedures. After puriﬁcation, all recombinant pro- teins showed a single band in SDS ⁄ PAGE, and an roles of the GSTUs, extensive analysis of critical resi- dues in both domain sites is needed, although the identical molecular mass of about 26.0 kDa, corre- highly conserved nature of the G-site [23] and the sponding to the calculated molecular mass of the recent crystallographic characterization of two GSTUs recombinant sweet orange GST subunits (Fig. 1). [24–26] have allowed researchers to formulate some CDNB is generally considered to be the classic GST general considerations about the N-terminal domains substrate, because most GST isoenzymes display high of the enzymes. Moreover, the existence of a conserved activity towards it. It has been shown that the sweet electron-sharing network that helps the glutamyl c-car- orange GST isoforms exhibit quite different speciﬁc boxylate of GSH to function as a catalytic base, activities with CDNB as substrate, GSTU2 being accepting the proton from the thiol group to form an three-fold more active than GSTU1 [11]. Conse- anionic GSH, has been reported [27]. This network is quently, steady-state kinetic characterization of both characterized by an electrostatic interaction between isoforms with respect to CDNB was performed prior 256 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
A. R. Lo Piero et al. Functional role of the GST H-site residues published Km values for GSH [31]. However, in the 6 7 1 2 3 4 5 case of both substrates, GSTU2 showed higher cata- lytic efﬁciency (kcat ⁄ Km) as well as higher kcat values (Table 1). The alignment of the H-site sequences of 20 GSTUs from different plant sources showed that Pro89 and the Lys117 found in GSTU2 are strictly 36 kDa conserved residues, whereas, at the 172 position, the 29 kDa isoleucine is well conserved but valine or threonine can also be found (Fig. S1). Therefore, the naturally occur- ring GSTU1 (Arg89, Glu117, and Ile172) probably has unique features, and might perform a different func- tional role in vivo than GSTU2. This assumption is also supported by the analysis of gene expression, which showed that the GSTU1 gene is induced by cad- mium sulfate, CDNB, cyhalothrin, and cold stress, whereas GSTU2 is constitutively expressed [11]. Given that these naturally occurring GSTUs provided a good opportunity to understand how speciﬁc amino acids might contribute to the enzyme’s biochemical behav- Fig. 1. SDS ⁄ PAGE of the puriﬁed wild-type and mutant GSTs. Lane ior, several mutant GSTs, hereafter referred to by their 1: unpuriﬁed E. coli extract. Lane 2: puriﬁed wild-type GSTU1 (REI). distinctive amino acid triad, were generated by site- Lane 3: puriﬁed wild-type GSTU2 (PKV). Lane 4: puriﬁed PEI directed mutagenesis. In particular, the RKI and RKV mutant. Lane 5: RKV mutant. Lane 6: puriﬁed PKI mutant. Lane 7: mutants were obtained by individually replacing the molecular mass marker. The mutant enzymes are referred to by Glu117 of GSTU1 (REI) with Lys117, and the Pro89 their distinctive triad of amino acids located, respectively, at posi- of GSTU2 (PKV) with Arg89, respectively. Moreover, tions 89, 117, and 172. the PEI and PKI mutants were obtained by replacing Arg89 of GSTU1 (REI) with Pro89, and Glu117 of the PEI mutant with Lys117, respectively. Steady-state to any other investigation concerning their catalytic kinetic analysis of puriﬁed RKI and RKV mutants mechanism. The values of kinetic parameters obtained showed sharp increases of approximately six-fold and by non-linear regression analysis are listed in Table 1. ﬁve-fold in the Km value for CDNB as compared with The results showed that GSTU1 had a lower apparent GSTU1 (REI) (Table 1). Consequently, the results sug- Km for CDNB (0.75 mm) than that exhibited by gest that Lys117-containing enzymes, either wild type GSTU2 (1 mm), this ﬁnding being consistent with a or mutant, do not easily accommodate CDNB in their higher afﬁnity of GSTU1 for this substrate. The Km active site, and also highlight the critical contribution values of GSTU1 and GSTU2 for CDNB are in the of Glu117 to CDNB recognition. Accordingly, the PEI range of those of plant GSTs, whose values vary from mutant, in which the Glu117 is restored as compared 0.12 to 4.43 mm [24,29,30]. As expected on the basis of with the PKI mutant, shows a Km value for CDNB the complete identity of the G-site sequences, the same similar to that of GSTU1 (REI) (Table 1). However, Km for GSH was registered for both isoforms the kcat values for both GSTU2 (PKV) and the E117K (0.5 mm), which is in general agreement with other Table 1. Steady-state kinetic constants of wild-type and mutant GSTs. The kinetic parameters were calculated by using nonlinear regression analysis with the HYPER32 program. Each value represents the mean ± standard deviation of three replicates. CDNB GSH kcat ⁄ Km kcat ⁄ Km Km Vmax kcat Km Vmax kcat (lMÆmin)1) (s)1 · 103) (M)1Æs)1) (lMÆmin)1) (s)1 · 103) (M)1Æs)1) (mM) (mM) GST GSTU1 (REI) 0.75 ± 0.03 2.0 ± 0.10 23.8 ± 1 31.7 ± 1.45 0.5 ± 0.02 1.0 ± 0.1 13.8 ± 0.24 27.7 ± 1.15 GSTU2 (PKV) 1.0 ± 0.07 4.0 ± 0.06 108.1 ± 1 108.1 ± 5.4 0.5 ± 0.03 4.0 ± 0.15 76.9 ± 0.4 153.8 ± 6.94 RKI 5.0 ± 0.2 9.0 ± 0.5 257.1 ± 2 51.4 ± 2.0 0.6 ± 0.03 5.0 ± 0.20 147.0 ± 0.9 245.0 ± 4.26 RKV 4.0 ± 0.4 8.0 ± 0.25 119.4 ± 1 29.8 ± 0.6 0.35 ± 0.02 3.3 ± 0.10 129.4 ± 0.5 369.7 ± 21.12 PKI 4.0 ± 0.4 4.5 ± 0.15 160.7 ± 1.6 40.0 ± 1.5 0.7 ± 0.04 4.0 ± 0.15 64.0 ± 0.63 91.4 ± 2.16 PEI 0.85 ± 0.05 3.0 ± 0.07 28.8 ± 0.07 33.9 ± 2.4 4.0 ± 0.02 7.0 ± 0.3 70.7 ± 0.7 17.6 ± 0.24 257 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
Functional role of the GST H-site residues A. R. Lo Piero et al. mutants (RKI, RKV, and PKI) were increased as com- for Citrus sinensis GSTU1 (REI) and the PEI mutant, pared with those of the Glu117-containing enzymes as well as for Citrus sinensis GSTU2 (PKV) and the (REI and PEI) (Table 1). This ﬁnding suggests a nega- RKV mutant, by submitting the amino acid sequences tive inﬂuence of Glu117 on the catalytic event. It has to swiss-model [35]. Then, the alignments of the 3D been shown that the addition of GSH to CDNB structural homology models were performed between occurs via an addition–elimination sequence involving the wild-type GSTs and their respective mutants at a short-lived r-complex intermediate (Meisenheimer the 89 position (REI–PEI, and PKV–RKV) by the complex) as transition state [32]. The structure of the web-based program matras [36]. The analysis of the transition state [32] indicates that the enzyme might superimposed REI–PEI models revealed relevant con- provide electrophilic assistance interactions to the formational differences between the enzyme structures, developing charge of the r-complex o-nitro group [33]. mainly involving a-helix1 (from Ser13 to Gly27) and The comparison of the crystal structure of the rat M1- a-helix3 (from Ser67 to Asp80), which represent the 1 GST in complex with the transition state analog catalytic ‘core’ of the G-site [26] (numbering of helices and with the product reveals two completely different is consistent with that of other GSTs) (Fig. 2A). In binding modes for the intermediate and the product, contrast, minimal structural perturbations of the afore- suggesting that a speciﬁc motion is associated with mentioned a-helix1 and a-helix3 were observed in the the collapse of the intermediate into the product case of the superimposed PKV–RKV models, whose [34]. More recently, Axarli et al. [26] have also shown major nonoverlapping regions are, instead, localized in that the catalytic reaction of GmGSTU4-4 is barely the H-site of the enzymes (Fig. 2B). These ﬁndings are sensitive to the nature of the leaving group, as the sub- in agreement with the different values of apparent Km stitution of the chlorine atom with the more electro- for GSH observed between GSTU1 (REI) and the PEI negative ﬂuorine in the CDNB molecule did not affect mutant, and overall indicate that the substitution the kcat values. Altogether, these results are consistent R89P in GSTU1 might modify the architecture of the with the idea that the rate-limiting step of the CDNB– G-site, thus negatively inﬂuencing the enzyme’s afﬁnity GSH catalytic reaction is the physical event of product for GSH. Furthermore, Table 2 shows the recovered release, probably involving structural motions or con- activity following denaturation and refolding of wild- formational changes of the ternary complex. In this type GSTUs and the PEI and RKV mutants. The reac- context, we propose that the substitution in the orange tivation yield of the PEI mutant was two-fold higher GSTU1 of a nucleophilic residue by an electrophilic than that observed in GSTU1 (REI) (Table 2), thus one (E117K) could function in strongly favoring the supporting our hypothesis that Pro89 might have a formation of the transition state during GSH addition structural role in the PEI mutant. However, the recov- to CDNB by providing the required electrophilic assis- ered activities of both GSTU2 (PKV) and the RKV tance to the developing transition state. mutant were similar, suggesting that the substitution As regards the analysis of kinetic parameters regard- P89R in GSTU2 (PKV) does not affect the refolding ing the natural in vivo substrate GSH, the mutants process. Consequently, the putative structural role containing Lys117 showed apparent Km values similar assigned to the Pro89 of the PEI mutant cannot be to those reported for the wild-type GSTs (Table 1). attributed to the Pro89 of GSTU2 (PKV), as the However, the RK and PK enzymes, both wild type RKV mutant, arising from the P89R substitution in and mutants, showed a strong increase in the kcat ⁄ Km GSTU2 (PKV), has both similar Km values (Table 1) values with respect to the Glu117-containing enzymes and similar reactivation yields after denaturation (REI and PEI) (Table 1), indicating that the substitu- (Table 2) as GSTU2 (PKV). Therefore, the results tion E117K is crucial to the formation of enzymes with lead to the conclusion that all three amino acids inves- higher catalytic efﬁciency. Interestingly, the PEI tigated in this work take part in the creation of mutant showed an eight-fold increase in the Km value enzymes showing unique structures and, consequently, for GSH as compared with GSTU1 (REI) (substitution functions. R89P) (Table 1), suggesting that such mutation of the The substrate speciﬁcity of the sweet orange GSTs H-site might exert its effects upon the G-site kinetic was also investigated in order to identify catalytic properties. Recently, Axarli et al. [25] reported the activities that may be related to their biological func- crystal structure of the GSTU4-4 from soybean, which tion. To this end, some substrates in addition to shares 71% sequence similarity with the orange CDNB were examined, including 7-chloro-4-nitro- GSTUs [11]. The consistency in the fold of GSTs and benzo-2-oxa-1,3-diazole (NBD-Cl), with which mam- the availability of the structure of GmGSTU4-4 malian a-class GSTs show high activity [37], the alkyl prompted us to construct molecular homology models halide 4-nitrophenethyl bromide (4-NPB), related to 258 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
A. R. Lo Piero et al. Functional role of the GST H-site residues a,b-alkenals, which may be formed during oxidative A stress [29] (Table 3). Overall, CDNB is the preferred substrate of both naturally occurring (REI and PKV) and mutant GSTs, with the RKV and PKV enzymes showing the highest speciﬁc activity. Relatively lower activity was detected with the mammalian GST sub- strate NBD-Cl (Table 3). Interestingly, the mutant enzyme RKV is able to conjugate 4-NPB to GSH, whereas wild types, as well as other mutant GSTs, are not, thus suggesting the crucial role of Val172, but not of Ile172, in creating the active site architecture that is suitable to accommodate the aforesaid substrate. This ﬁnding is of particular interest, as alkyl halides have toxicological interest in view of their occurrence as environmental pollutants [38]. Therefore, the RKV mutant, owing to the distinguishing ability to conju- B gate 4-NPB to GSH (Table 3) and to the extremely high catalytic efﬁciency towards GSH (Table 1), exhib- its great potential for the development of enzymes with novel properties, e.g. the ability to reclaim strongly contaminated environments through nucleophilic sub- stitution reactions involving either aryl halide or alkyl halide xenobiotics. None of the enzymes is active with ECA, suggesting that wild-type and mutant GSTs might not be directly involved in the removal of harm- ful oxidative stress byproducts (Table 3). The data showing that recombinant orange GSTs do not exhibit in vitro glutathione peroxidase activity (not shown) support this last hypothesis. Fig. 2. Representation of the 3D homology models of the wild-type Experimental procedures GSTs and their respective mutants at position 89. (A) Superposition of wild-type GSTU1 (REI) and the PEI mutant (R89P). (B) Superposi- Molecular cloning of sweet orange GSTU1 and tion of the wild-type GSTU2 (PKV) and the RKV mutant (P89R). GSTU2 Wild-type GSTs are shown in yellow, and mutants are shown in red. The nonoverlapping regions between the superimposed 3D Cloning of sweet orange GSTU1 and GSTU2 genes and models appear as red areas. their transfer into the expression vector pEXP1–DEST (Invitrogen, Carlsbad, CA, USA) was as described by Lo Table 2. Recovered activity after denaturation and refolding of wild-type and mutant GSTs. The recovered GST activities were Table 3. Speciﬁc activity of the wild-type and mutant GSTs measured in standard conditions after dilution of the denaturating towards different substrates. The GST assay was performed in agent to an ineffective concentration. Each value represents the standard conditions in the presence of 1 mM of different sub- mean ± standard deviation of three replicates. strates. Each value represents the mean ± standard deviation of three replicates. ND, not detectable. GST Recovered activity after denaturation (%) Activity [nmol (minÆmg)1)] GSTU1 (REI) 25 ± 0.5 PEI 49 ± 1 GST CDNB 4-NPB NBD-Cl ECA GSTU2 (PKV) 36 ± 0.8 GSTU1 (REI) 45.7 ± 1.2 ND 26.1 ± 0.8 ND (RKV) 37 ± 0.7 PEI 56.3 ± 1.4 ND 23.1 ± 0.2 ND RKI 66.8 ± 1.8 ND 53.6 ± 0.9 ND RKV 81.1 ± 1.7 148 ± 1.5 17.7 ± 0.2 ND the role of GSTs in detoxiﬁcation processes, and ethac- PKI 75 ± 1.5 ND 38.3 ± 0.6 ND rynic acid (ECA), a phenylacetic derivative that con- GDSTU2 (PKV) 79.2 ± 1.6 ND 27.2 ± 0.3 ND tains an electrophilic group, similar to the cytotoxic 259 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
Functional role of the GST H-site residues A. R. Lo Piero et al. Piero et al. [11]. The nucleotide sequences of wild-type included in the peak core were collected and assayed for GSTs were submitted to GenBank under the following GST activity (see below). A negative control of the recombi- accession numbers: EF597102 (GSTU1-coding sequence) nant protein expression was also performed by incubating the E. coli extract with empty plasmid. SDS ⁄ PAGE was car- and FJ184997 (GSTU2-coding sequence). ried out according to the method described in Laemmli [40]. Site-directed mutagenesis GST enzyme assay Site-directed mutagenesis of GSTU1 and GSTU2 was per- formed by PCR using sweet orange pEXP–GSTU1 and The GST assay was routinely performed as described in Lo pEXP–GSTU2 as templates (Gene Tailor Site-directed Piero et al. [3]. In the substrate speciﬁcity experiment, the reaction mixture (ﬁnal volume 0.5 mL), containing 1· mutagenesis system; Invitrogen). The PCR reaction mix- NaCl ⁄ Pi (pH 7.4), 1 mm glutathione, 1 mm different sub- tures contained 10 lm each primer, 1 U of Accuprime Pfx DNA polymerase (Invitrogen), 0.3 mm each dNTP, 1 mm strates, and puriﬁed recombinant enzymes (10–20 lg), was incubated at 30 °C for 15 min. GSH conjugates were MgSO4, and 18 lg of methylated plasmid DNA, in ﬁnal volume of 50 lL. PCR conditions were optimized to the detected by measuring the absorbance of samples at 340 nm. Molar extinction coefﬁcients of 9600 m)1Æcm)1 following: 94 °C for 2 min (one cycle), 94 °C for 30 s, (CDNB), 13 000 m)1Æcm)1 (NBD-Cl) and 1200 m)1Æcm)1 55 °C for 30 s, and 68 °C for 5 min (20 cycles), and 68 °C for 10 min (one cycle). All the mutagenesis primers are (4-NPB) were used. All measurements were adjusted by shown in Table 4. The PCR products were analyzed on a subtracting the absorbance values obtained for the nonen- 1% agarose gel containing 0.5 lgÆmL)1 ethidium bromide zymatic conjugation of substrates. The apparent Km and and puriﬁed with the Qiaquick gel extraction kit (Qiagen, Vmax values for GSH of both wild-type and mutant GSTs Hilden, Germany). All the mutants were conﬁrmed by were determined in the presence of GSH in the concentra- sequencing the plasmid DNA with the T7 promoter and T7 tion range 0.1–1.0 mm and a ﬁxed CDNB concentration of reverse primers. 1 mm. Alternatively, for the determination of CDNB apparent Km and Vmax values, GSH was used at a ﬁxed concentration of 1 mm and the CDNB concentration was In vitro expression and puriﬁcation of sweet varied in the range 0.1–1 mm. The kinetic parameters were orange wild-type and mutant GSTs derived using nonlinear regression analysis with the hyper32 program, available at http://homepage.ntlworld. In vitro expression of functionally active GSTs, both wild com/john.easterby/hyper32.html. The experiments were types and mutants, was performed according to the method repeated three times on independent enzyme preparations. described in Lo Piero et al. [11]. Brieﬂy, protein expression Kinetic comparison of the His-tagged and untagged was achieved in a cell-free system (Expressway Plus; Invitro- enzymes showed that the extra six histidines on the N-ter- gen) by incubating the plasmids (15 lg), in IVPS Plus minus did not interfere with the activity or function of the Escherichia coli extract for 6 h at 25 °C, to promote proper enzymes (data not shown). protein folding. The recombinant proteins were puriﬁed by loading the cell-free extract onto a His-graviTrap column prepacked with Ni2+–Sepharose 6 fast ﬂow (GE Healthcare, Refolding studies Milwaukee, WI, USA). The unspeciﬁc bound proteins were Refolding experiments were performed according to a slight removed by washing the column with 20 mm phosphate modiﬁcation of the method described by Zeng et al. [28]. buffer (pH 8.0), 500 mm NaCl, and 20 mm imidazole. The All enzymes (70 lg) were incubated in a denaturation buf- His-tagged protein was eluted with 500 mm imidazole by fer (4 m guanidinium chloride, 0.1 m phosphate, and 1 mm recovering 0.2 mL fractions. Fractions were tested for pro- EDTA, pH 6.5) at 25 °C for 30 min. At the end of the tein content using the Bradford method [39], and those Table 4. Primers used in site-directed mutagenesis. Primers (5¢- to 3¢) Template Mutant GSTU1 E117K-for: AAGACATGGACCACAAAGGGAGAAGAGCAGGAG RKI E117K-rev: TGTGGTCCATGTCTTCGTCGAAGCATC GSTU2 P89R-for: TGGCTTCCCTCTGATCGCTACCAGAGAGCTCAA RKV P89R-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC GSTU1 R89P-for: TTGCTTCCCTCTGATCCCTACCAGAGAGCTCAA PEI R89P-rev: ATCAGAGGGAAGCAATGGAGCCTTGTC PEI E117K-for: TTTGGAAAGTCCAGCATTGAGGCTGAGTGCCCC PKI E117K-rev: GCTGGACTTTCCAAATGTCTCATA 260 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
A. R. Lo Piero et al. Functional role of the GST H-site residues incubation period, they were rapidly diluted up to an inef- transferases: implications for classiﬁcation of non-mam- fective guanidinium chloride concentration (1 : 30) in a malian members of an ancient enzyme superfamily. renaturation buffer (0.1 m phosphate, pH 6.5, 1 mm Biochem J 360, 1–16. EDTA), and the recovered activity towards the substrate 8 Sandermann H Jr (1992) Plant metabolism of xenobiot- CDNB was immediately monitored. ics. Trends Biochem Sci 17, 82–84. 9 Rea PA (1999) MRP sub family ABC transporters from plants and yeast. J Exp Bot 50, 895–913. Sequence alignment and structural modeling 10 Moons A (2005) Regulatory and functional interactions of plant growth regulators and plant glutathione trans- The comparison of the C-terminal GST protein sequences ferases (GSTs). Vitam Horm 72, 155–202. was performed by using the multiple sequence alignment 11 Lo Piero AR, Mercurio V, Puglisi I & Petrone G (2009) program clustalw 1.8. To generate structural models, Gene isolation and expression analysis of two distinct amino acid sequences of GSTs, both wild type and sweet orange [Citrus sinensis L. (Osbeck)] tau-type mutants, were submitted to swiss-model (http://swissmod- glutathione transferases. Gene 443, 143–150. el.expasy.org/) [35]. Homology models were generated using 12 Lo Piero AR, Puglisi I, Rapisarda P & Petrone G the known X-ray structure of GmGSTU4-4 (Protein Data (2005) Anthocyanin accumulation and related gene Bank code: 2vo4A) as template. The 3D homology models expression in red orange fruit induced by low tempera- were compared with matras [36], and jmol version 2.7 was ture storage. J Agric Food Chem 53, 9083–9088. used to generate 3D images. 13 Moons A (2003) Osgstu3 and osgtu4, encoding tau class glutathione S-transferases, are heavy metal and hypoxic Acknowledgements stress-induced and differentially salt stress-responsive in rice roots. FEBS Lett 553, 427–432. Financial support was provided by a grant to Dr 14 Bianchi MW, Roux C & Vartanian N (2002) Drought Angela Roberta Lo Piero by the University of Catania, regulation of GST8, encoding the Arabidopsis homo- Fondi del Bilancio Universitario, Progetti di Ricerca di logue of ParC ⁄ Nt107 glutathione transferase ⁄ peroxi- Ateneo (PRA), 2006, Project title: ‘Isolamento e carat- dase. Physiol Plant 116, 96–105. terizzazione di un gene codiﬁcante per la glutatione 15 Vollenweider S, Weber H, Stolz S, Chetelat A & transferasi coinvolta nei meccanismi di trasferimento Farmer EE (2000) Fatty acid ketodienes and fatty acid nel vacuolo dei pigmenti antociani nella polpa di ara- ketotrienes: Michael addition acceptors that accumulate nce rosse e bionde.’ in wounded and diseased Arabidopsis leaves. Plant J 24, 467–476. 16 Mauch F & Dudler R (1993) Differential induction of References distinct glutathione transferases of wheat by xenobiotics 1 Edwards R & Dixon DP (2000) The role of glutathione and by pathogen attack. Plant Physiol 102, 1193–1201. transferases in herbicide metabolism. In Herbicides and 17 Dean JD, Goodwin PH & Hsiang T (2005) Induction Their Mechanisms of Action (Cobb AH & Kirkwood of glutathione S-transferase genes of Nicotiana benth- RC eds), pp 38–71. Shefﬁeld, Shefﬁeld Academic Press. amiana following infection by Colletotrichum destructi- 2 Axarli I, Rigden DJ & Labrou NE (2004) Characteriza- vum and C. orbiculare and involvement of one in tion of the ligandin site of maize glutathione transferase resistance. J Exp Bot 56, 1525–1533. I. Biochem J 382, 885–893. 18 Edwards R, Dixon DP & Walbot V. (2000) Plant gluta- 3 Lo Piero AR, Puglisi I & Petrone G (2006) Gene isolation, thione transferases: enzymes with multiple functions in analysis of expression and in vitro synthesis of a glutathi- sickness and in health. Trends Plant Sci 5, 193–198. one S-transferase from orange fruit [Citrus sinensis L. 19 Frova C (2006) Glutathione transferases in the genom- (Osbeck)]. J Agric Food Chem 54, 9227–9233. ics era: new insight and perspective. Biomol Eng 23, 4 Dixon DP, Lapthorn A, Madesis P, Mudd EA, Day A 149–169. & Edwards R (2008) Binding and glutathione conjuga- 20 Labrou NE, Mello LV & Clonis YD (2001) Functional tion of porphyrinogens by plant glutathione transfer- and structural role of the glutathione binding residues ases. J Biol Chem 283, 20268–20276. in maize (Zea mays) glutathione S-transferase I. 5 Hayes JD, Flanagan JU & Jowsey IR (2005) Glutathione Biochem J 358, 101–110. transferases. Annu Rev Pharmacol Toxicol 45, 51–88. 21 Dixon DP, Lapthorn A & Edwards R (2002) Plant 6 Allocati N, Federici L, Masulli M & Di Ilio C (2009) glutathione transferases. Genome Biol 3, 3004.1–3004.10. Glutathione transferases in bacteria. FEBS J, 276, 22 Frova C (2003) The plant glutathione gene family: 58–75. genomic structure, functions, expression and evolution. 7 Sheehan D, Meade G, Foley VM & Dowd CA (2001) Physiol Plant 119, 469–479. Structure, function and evolution of glutathione 261 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS
Functional role of the GST H-site residues A. R. Lo Piero et al. 23 Droog F (1997) Plant glutathione S-transferases, a tale 34 Ji X, Armstrong RN & Gilliland GL (1993) Snapshots of theta and tau. J Plant Growth Regul 16, 95–107. along the reaction coordinate of an SNAr reaction cata- 24 Thom R, Cummins I, Dixon DP, Edwards R, Cole DJ lyzed by glutathione transferase. Biochemistry 32, & Lapthorn AJ (2002) Structure of a tau class gluta- 12949–12954. thione S-transferase from wheat active in herbicide 35 Schwede T, Kopp J, Guex N & Peitsch MC (2003) detoxiﬁcation. Biochemistry 41, 7008–7020. SWISS-MODEL: an automated protein homology-mod- 25 Axarli I, Dhavala P, Papageorgiou AC & Labrou NE eling server. Nucleic Acids Res 31, 3381–3385. (2009) Crystallographic and functional characterization 36 Kawabata T (2003) MATRAS: a program for protein 3D of the ﬂuorodifen-inducible glutathione transferase from structure comparison. Nucleic Acids Res 31, 3367–3369. Glycine max reveals an active site topography suited for 37 Ricci C, Caccuri AM, Lo Bello M, Pastore A, Piemonte diphenylether herbicides and a novel L-site. J Mol Biol F & Federici G (1994) Colorimetric and ﬂuorometric 385, 984–1002. assays of glutathione transferase based on 7-chloro- 26 Axarli I, Dhavala P, Papageorgiou AC & Labrou NE 4-nitrobenzo-2-oxa-1,3-diazole. Anal Biochem 218, (2009) Crystal structure of Glycine max glutathione 463–465. transferase in complex with glutathione: investigation of 38 Wheeler JB, Stourman NV, Thier R, Dommermuth A, the mechanism operating by the tau class glutathione Vuilleumier S, Rose JA, Armstrong R & Guengerich transferases. Biochem J 422, 247–256. FP (2001) Conjugation of haloalkanes by bacterial and 27 Winayanuwattikun P & Ketterman AJ (2005) An elec- mammalian glutathione transferases: mono- and dihalo- tron-sharing network involved in the catalytic mecha- methanes. Chem Res Toxicol 14, 1118–1127. nism is functionally conserved in different glutathione 39 Bradford MM (1976) A rapid and sensitive method for transferase classes. J Biol Chem 280, 31776–31782. the quantitation of microgram quantities of protein 28 Zeng QY & Wang XR (2005) Catalytic properties of utilizing the principle of protein-dye binding. Anal glutathione-binding residues in a s class glutathione Biochem 72, 248–254. transferase (PtGSTU1) from Pinus tabulaeformis. FEBS 40 Laemmli UK (1970) Cleavage of structural proteins Lett 579, 2657–2662. during the assembly of head of bacteriophage T4. 29 Kilili KG, Atanassova N, Vardanyan N, Clatot N, Nature 227, 680–685. Al-Sabarna K, Kanellopoulos PN, Makris AM & Kampranis SC (2004) Differential roles of tau class Supporting information glutathione S-transferase in oxidative stress. J Biol Chem 279, 24540–24551. The following supplementary material is available: 30 Dixon DP, Cole DJ & Edwards R (1999) Dimerisation Fig. S1. Alignment of the sweet orange GST H-site of maize glutathione transferases in recombinant bacte- sequences with those of 18 representative members of ria. Plant Mol Biol 40, 997–1008. tau class GSTs. 31 Clark AG (1989) The comparative enzymology of the This supplementary material can be found in the glutathione S-transferases from non-vertebrate organ- online version of this article. ism. Comp Biochem Physiol B 92, 419–446. Please note: As a service to our authors and readers, 32 Armstrong RN (1997) Structure, catalytic mechanism, this journal provides supporting information supplied and evolution of glutathione transferase. Chem Res by the authors. Such materials are peer-reviewed and Toxicol 10, 2–18. may be re-organized for online delivery, but are not 33 Johnson WW, Liu S, Ji X, Gilliland GL & Armstrong copy-edited or typeset. Technical support issues arising RN (1993) Tyrosine 115 participates both in chemical from supporting information (other than missing ﬁles) and physical steps of the catalytic mechanism of a glu- should be addressed to the authors. tathione transferase. J Biol Chem 268, 11508–11511. 262 FEBS Journal 277 (2010) 255–262 ª 2009 The Authors Journal compilation ª 2009 FEBS