intTypePromotion=1

Giới thiệu kỹ thuật giải trình tự gen và Real - Time PCR

Chia sẻ: Sunshine_3 Sunshine_3 | Ngày: | Loại File: PDF | Số trang:9

0
329
lượt xem
92
download

Giới thiệu kỹ thuật giải trình tự gen và Real - Time PCR

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Giải trình tự gen là tìm ra trình tự sắp xếp của các nucleotides trên đoạn gen được quan tâm nhằm phát hiện sự đột biến gen hoặc để thiết kế gen mồi (primer) và các vector tách dòng (cloning) nhằm tạo ra các protein tái tổ hợp có giá trị cao trong Y học (vaccine, thuốc chữa bệnh, các sinh phẩm phục vụ chẩn đoán bệnh hoặc nghiên cứu khoa học…). Kỹ thuật giải trình tự gen được công bố năm 1975 bởi Sanger (nguyên lý enzym) và Maxam - Gilbert năm 1977 (nguyên lý phân giải hoá học). Hiện nay, các kỹ thuật này đã được cải tiến rất nhiều...

Chủ đề:
Lưu

Nội dung Text: Giới thiệu kỹ thuật giải trình tự gen và Real - Time PCR

  1. TCNCYH phô b¶n 32 (6) - 2004 Giíi thiÖu kü thuËt gi¶i tr×nh tù gen vµ Real - Time PCR Lª V¨n Phñng* Tr−êng §¹i häc Y Hµ Néi 1. Kü thuËt gi¶i tr×nh tù gen §Ó gi¶i tr×nh tù ®−îc gen FliC, b−íc ®Çu tiªn Gi¶i tr×nh tù gen lµ t×m ra tr×nh tù s¾p xÕp cña lµ ph¶i thiÕt kÕ cÆp måi ®Æc hiÖu. CÆp måi nµy ®· c¸c nucleotides trªn ®o¹n gen ®−îc quan t©m ®−îc thiÕt kÕ t¹i Labo trung t©m Y Sinh häc, ®−îc nh»m ph¸t hiÖn sù ®ét biÕn gen hoÆc ®Ó thiÕt kÕ ®Æt tªn lµ FliC_b_seqF (aag cgg cta ttt cgc cgc c gen måi (primer) vµ c¸c vector t¸ch dßng = 19 nucleotides) vµ FliC_b_SeqR (cgt gtc ggt (cloning) nh»m t¹o ra c¸c protein t¸i tæ hîp cã gi¸ gaa tca atc gc = 20 nucleotides). C¸c tr×nh tù nµy trÞ cao trong Y häc (vaccine, thuèc ch÷a bÖnh, ®· ®−îc göi ®i tæng hîp thµnh c¸c olignucleotide c¸c sinh phÈm phôc vô chÈn ®o¸n bÖnh hoÆc t¹i C«ng ty Invitrogen (Hång K«ng). §Ó thiÕt kÕ nghiªn cøu khoa häc…). ®−îc c¸c cÆp måi nµy, c¸c th«ng tin vÒ gen FliC Kü thuËt gi¶i tr×nh tù gen ®−îc c«ng bè n¨m ph¶i ®−îc thu thËp tr−íc trªn c¸c ng©n hµng d÷ 1975 bëi Sanger (nguyªn lý enzym) vµ Maxam - liÖu gen (GenBank hoÆc EMBL ch¼ng h¹n). Gilbert n¨m 1977 (nguyªn lý ph©n gi¶i ho¸ häc). B−íc thø hai lµ t¸ch chiÕt ADN tõ c¸c chñng HiÖn nay, c¸c kü thuËt nµy ®· ®−îc c¶i tiÕn rÊt Salmonella, c¸c ADN nµy sÏ dïng lµm khu«n nhiÒu nhê nh÷ng tiÕn bé míi vÒ khoa häc vµ c«ng trong ph¶n øng PCR ë b−íc tiÕp theo. Qu¸ tr×nh nghÖ (Ho¸ häc, VËt lý, §iÖn tö vµ C«ng nghÖ t¸ch chiÕt nµy kh«ng khã, c¸c Labo sinh häc th«ng tin), lµm cho hiÖu suÊt cña viÖc gi¶i tr×nh tù ph©n tö ®Òu cã th−êng quy nµy. gen ngµy mét cao; ng−êi ta cã thÓ gi¶i mét tr×nh B−íc thø ba lµ ch¹y PCR lÇn 1 víi cÆp måi vµ tù dµi hµng ngh×n cÆp base chØ trong vßng vµi ADN khu«n nãi trªn. §iÒu kiÖn tèi −u cho ph¶n tiÕng ®ång hå, ®iÒu mµ tr−íc ®©y ph¶i lµm hµng øng PCR nµy ph¶i dß t×m, nÕu m¸y PCR cã tuÇn. ch−¬ng tr×nh Gradient th× viÖc t×m kiÕm c¸c ®iÒu Cã nhiÒu kü thuËt gi¶i tr×nh tù gen, sau ®©y kiÖn nhiÖt ®é tèi −u sÏ thuËn lîi h¬n nhiÒu. xin giíi thiÖu mét kü thuËt hiÖn nay ®ang ®−îc ¸p B−íc thø t− lµ tinh s¹ch s¶n phÈm cña ph¶n dông phæ biÕn th«ng qua mét vÝ dô cô thÓ, gi¶i øng PCR nãi trªn. Cã thÓ dïng ph−¬ng ph¸p t¸ch m· gen FliC. b¨ng ADN ®Æc hiÖu ngay trªn th¹ch ®iÖn di (rÎ Gen FliC lµ gen m· ho¸ cho kh¸ng nguyªn tiÒn) hoÆc dïng KIT th−¬ng m¹i (®¾t h¬n). l«ng (protein) pha I cña vi khuÈn Salmonella. C¸c B−íc thø n¨m lµ ch¹y PCR lÇn hai. Kh¸c víi Salmonella cã l«ng th× ®Òu cã kh¸ng nguyªn nµy, PCR lÇn 1, lÇn nµy trong hçn hîp ph¶n øng, nh−ng tÝnh ®Æc hiÖu th× kh¸c nhau ë mçi loµi. Sù ng−êi ta cho thªm dideoxynucleoside kh¸c nhau nµy lµ do m· ho¸ kh¸c nhau (tr×nh tù triphosphate (hai vÞ trÝ, trong ®ã cã vÞ trÝ 3’, c¸c nucleotides kh¸c nhau) ë gen FliC quy ®Þnh. kh«ng cã nhãm OH - ) cã g¾n chÊt mµu huónh ChÝnh v× vËy, gi¶i ®−îc tr×nh tù gen FliC sÏ cho quang. HiÖn nay, kü thuËt ®· cho phÐp g¾n c¸c phÐp thiÕt kÕ ®−îc c¸c gen måi ®Æc hiÖu cho tõng chÊt mµu huónh quang kh¸c nhau trªn 4 lo¹i loµi Salmonella nh»m ph¸t triÓn c¸c kü thuËt sinh nucleotide nµy, v× vËy, chØ cÇn lµm mét ph¶n øng häc ph©n tö (ch¼ng h¹n PCR) ®Ó chÈn ®o¸n ®Æc PCR trong mét èng duy nhÊt chung cho c¶ 4 lo¹i hiÖu cho tõng loµi hoÆc phôc vô cho c¸c nghiªn nucleotide (A, C, G vµ T); so víi tr−íc ®©y ph¶i cøu t×m kiÕm vaccine cã ®é ®Æc hiÖu vµ c«ng hiÖu lµm 4 ph¶n øng riªng rÏ ë 4 èng. cao. * PGS. TS. Tr−ëng Labo trung t©m, Phã chñ nhiÖm Bé m«n Vi sinh vËt - Tr−êng §¹i häc Y Hµ Néi. 26
  2. TCNCYH phô b¶n 32 (6) - 2004 B−íc thø s¸u lµ lµm tinh s¹ch s¶n phÈm KÕt qu¶ cña qu¸ tr×nh gi¶i tr×nh tù gen FliC (ADN) cña ph¶n øng PCR 2 vµ lµm biÕn tÝnh ®−îc l−u trong m¸y d−íi hai d¹ng (h×nh ¶nh vµ chóng ®Ó t¹o ra ADN sîi ®¬n duçi th¼ng. ch÷). KÕt qu¶ nµy ®· ®−îc so s¸nh víi c¸c d÷ liÖu B−íc thø b¶y lµ ®−a ADN ®· ®−îc xö lý vµo cïng lo¹i cã trong ng©n hµng gen (GenBank, m¸y gi¶i tr×nh tù gen ®Ó ®äc tù ®éng tr×nh tù c¸c www. ncbi. nlm. nih. gov) vµ ®· ®−îc ®¨ng ký vµ nucleotide trªn FliC. Cã thÓ chØ ®äc mét sîi hoÆc c«ng bè chÝnh thøc víi sè truy cËp lµ AY657000 ®äc ®ång thêi c¶ hai sîi ®Ó t¨ng ®é chÝnh x¸c cña vµ AY657001. Sau ®©y xin giíi thiÖu gen FliC c¸c tr×nh tù ®−îc ®äc ra. cña Salmonella paratyphi B (H×nh 1). H×nh 1. Gen FliC - b cña Salmonella paratyphi B trªn GenBank (http: //www. ncbi. nlm. nih. gov) 27
  3. TCNCYH phô b¶n 32 (6) - 2004 C¸c gen FliC cña 5 Salmonella kh¸c nhau ®· ®−îc gi¶i tr×nh tù vµ so s¸nh víi nhau ®Ó t×m ra vïng ®Æc tr−ng cho mçi loµi, trong ®ã FliC - a lµ gen FliC cña Salmonella paratyphi A, FliC - b lµ cña Salmonella paratyphi B, FliC - c lµ cña Salmonella paratyphi C, FliC - d lµ cña Salmonella typhi vµ FliC - i lµ cña Salmonella typhimurium; dÊu “*” lµ biÓu diÔn c¸c vÞ trÝ gièng nhau vµ dÊu “.” lµ biÓu hiÖn c¸c vÞ trÝ kh¸c nhau. FliC - a 1: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAA 60 FliC - b 1: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAA 60 FliC - c 1: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAA 60 FliC - d 1: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAA 60 FliC - i 1: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAA 60 ************************************************************ FliC - a 61: TCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGC 120 FliC - b 61: TCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCTGGTCTGCGTATCAACAGC 120 FliC - c 61: TCCCAGTCTGCTCTGGGTACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGC 120 FliC - d 61: TCCCAGTCCGCACTGGGCACTGCTATCGAGCGTTTGTCTTCCGGTCTGCGTATCAACAGC 120 FliC - i 61: TCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGC 120 ********.**.*****.**.************.*******.****************** FliC - a 121: GCGAAAGACGATGCGGCAGGTCAGGCAATTGCTAACCGTTTCACCGCGAACATCAAAGGT 180 FliC - b 121: GCGAAAGACGATGCGGCAGGTCAGGCGATTGCTAACCGTTTTACCGCGAACATCAAAGGT 180 FliC - c 121: GCGAAAGACGATGCGGCAGGTCAGGCGATTGCTAACCGTTTCACCGCGAACATCAAAGGT 180 FliC - d 121: GCGAAAGACGATGCGGCAGGACAGGCGATTGCTAACCGTTTTACCGCGAACATCAAAGGT 180 FliC - i 121: GCGAAAGACGATGCGGCAGGTCAGGCGATTGCTAACCGTTTTACCGCGAACATCAAAGGT 180 ********************.*****.**************.****************** FliC - a 181: CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGC 240 FliC - b 181: CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGC 240 FliC - c 181: CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATTTCTATTGCGCAGACCACTGAAGGC 240 FliC - d 181: CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGC 240 FliC - i 181: CTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGC 240 ***********************************.**.********************* FliC - a 241: GCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCT 300 FliC - b 241: GCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCT 300 FliC - c 241: GCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCT 300 FliC - d 241: GCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCG 300 FliC - i 241: GCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCT 300 ***********************************************************. FliC - a 301: AACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTG 360 FliC - b 301: AACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTG 360 FliC - c 301: AACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGTCTG 360 FliC - d 301: AATGGTACTAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTG 360 FliC - i 301: AACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTG 360 **..*.**.***********************************************.*** 28
  4. TCNCYH phô b¶n 32 (6) - 2004 FliC - a 361: AACGAAATCGACCGTGTATCCGGTCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAG 420 FliC - b 361: AACGAAATCGACCGTGTATCCGGCCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAG 420 FliC - c 361: AACGAAATCGACCGTGTATCCGGTCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAG 420 FliC - d 361: AACGAAATCGACCGTGTATCCGGCCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAG 420 FliC - i 361: AACGAAATCGACCGTGTATCCGGCCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAG 420 ***********************.************************************ FliC - a 421: GACAACACCCTGACCATCCAGGTTGGTGCCAACGACGGTGAAACCATTGATATCGATCTG 480 FliC - b 421: GACAACACCCTGACCATCCAGGTTGGCGCGAACGACGGTGAAACTATCGATATCGATCTG 480 FliC - c 421: GACAACACTCTGACCATCCAGGTTGGTGCCAACGACGGTGAAACTATCGATATCGATCTG 480 FliC - d 421: GACAACACCCTGACCATCCAGGTTGGTGCCAACGACGGTGAAACTATCGATATTGATTTA 480 FliC - i 421: GACAACACCCTGACCATCCAGGTTGGTGCCAACGACGGTGAAACTATCGATATCGATCTG 480 ********.*****************.**.**************.**.*****.***.*. FliC - a 481: AAACAGATCAACTCTCAGACCCTGGGTCTGGATACGCTGAATGTGCAGAAAAAATATGAT 540 FliC - b 481: AAGCAGATCAACTCTCAGACCCTGGGTCTGGATACTTTAAGTGTACAGGATGCCTATACG 540 FliC - c 481: AAGCAGATCAACTCTCAGACCCTGGGCCTAGATACGCTGAATGTGCAGAAAAAATATGAT 540 FliC - d 481: AAAGAAATCAGCTCTAAAACACTGGGACTTGATAAGCTTAATGTCCAAGATGCCTACACC 540 FliC - i 481: AAGCAGATCAACTCTCAGACCCTGGGTCTGGATACGCTGAATGTGCAACAAAAATATAAG 540 **..*.****.****.*.**.*****.**.****...*.*.***.**. *....**... FliC - a 541: GTGAAGAGCGAAGCGGTCACGCCTTC - GGCTA - - CATTAAGCACTACTGCACTTGATGGT 597 FliC - b 541: CCAAAAGGTACCGCTGTTACCAGAGA - TGTTA - - CCACCTATAAAAATGGTGGTACTACT 597 FliC - c 541: GTGAGCGATACTGCTGTAGCTGCTTC - - - CTATTCCGACTCGAAACAGAATATTGCTGTT 597 FliC - d 541: CCGAAAGAAACTGCTGTAACCGTTGA - TAAAA - - CTACCTATAAAAATGGTACAGATCCT 597 FliC - i 541: GTCAGCGATACGGCTGCAACTGTTACAGGATATGCCGATACTACGATTGCTTTAGACAAT 600 ...*...... **.*...*.....* *....*............ * FliC - a 598: GCTGGCCTCAAAACCGGAACCGGTTCTACAACTGATACTGGTTCAATTAAGGATGGTAAG 657 FliC - b 598: CTTACAGCACCTAACGCAGCAGCAATTGATACCGCTTTAGGTACGACTGGTGCGGCGGGT 657 FliC - c 598: CCTGA - - - TAAAACAGCTATTACTGCAAAAATTGGTGCAGCAACCAGTGGTGGTGCTGGT 654 FliC - d 598: ATTACAGCCCAGAGCAATACTGATATCCAAACTGCAATTGGCGGTGGTGCAACGGGGGTT 657 FliC - i 601: AGTACTTTTAAAGCCTCGGCTACTGGTCTTGGTGGTACTGACCAGAAAATTGATGGCGAT 660 ..*.. ....................*....*........*... FliC - a 658: GTTTACTATAACAGCACCTCTAAA - - - - - - AATTATTATGTTGAAGTAGAATTTACCGAT 711 FliC - b 658: ACTGCGGCTG - - - TGAAATTTAAAGACGGTAACTACTTCGTTGAGGTGACCGGTACAACT 714 FliC - c 655: ATAAAAGCAGATATTAGCTTTAAAGATGGCAAGTATTACGCGACTGTCAGTGGATACGAT 714 FliC - d 658: ACTGGGGCTGATATCAAATTTAAAGATGGTCAATACTATTTAGATGTTAAAGGCGGTGCT 717 FliC - i 661: TTAAAATTTGATGATACGACTGGA - - - - - - AAATATTACGCCAAAGTTACCGTTACGGGG 714 ............ * ..*..*.....* **.*...... **........ 29
  5. TCNCYH phô b¶n 32 (6) - 2004 FliC - a 712: GCGACCGATC - - - AAACCAACGAAGGCGGATTCTATAAAGTTAATGTTGCTGATGATGGT 768 FliC - b 715: AAAGATGGTCTGTATGAAGCGACAGTTGATGCAGCTG - - - - GCGCGGTGACAATGA - - CC 768 FliC - c 715: GATGCCGCAG - - - ATACAGATAAAAATGGAACCTATGAAGTCACTGTTGCCGCAGA - - - T 768 FliC - d 718: TCTGCTGGTGTTTATAAAGCCACTTATGATGAAACTACAAAGAAAGTTAATATTGATACG 777 FliC - i 715: GGAACTGGTA - - - AAGATGGCTATTATGAAGTTTCCGTTGATAAGACGAACGGTGA - GGT 770 ....*.. *...........*...................** . FliC - a 769: GCAGTCACAATGAC - - T - GCGGCTACCAC - CAAAGAGGCT - ACAAC - TCCTACAGGTATT 822 FliC - b 769: GCAAATAAAGCAACAGT - - - AACTGGGGCTAGT - - - - - - - - - - - - - - - - - - - - - ACAGTT 804 FliC - c 769: ACAGGAGCAGTTACTTTTGCGACTACACC - AACAGTGGTTGACTTA - - CCAACTGATGCA 825 FliC - d 778: ACTGATAAAACTCCGTTGGCAACTGCGGAAGCTACAGCTATTCGGGGAACGGCCACTATA 837 FliC - i 771: G - ACTCTTGCTGGCGGT - GCGACTTCCCCGCTTACAGGTGGACTACCTGCGACAGCAACT 828 ........* *....**.. ........ ......... FliC - a 823: ACTGAAGTTACTCAAGTCCAAA - - - AACCTGTGGCTGCTC - - - CAGCTGCTAT - - - - CCA 872 FliC - b 805: ACTGAAAACCAAATTGTAGACGCTGTTACACCGACGCCAGTTGATACAGTCGCAGCAGCT 864 FliC - c 826: AAAGCAGTTTCAAAAGTTCAAC - - - AGAATGATACTGAAATAGCAGCAACAAATGCGAAA 882 FliC - d 838: ACCCACAACCAAATTGCTGAAG - - - TAACAAAAGAGGGTGTTGATACGACCACAGTTGCG 894 FliC - i 829: GAGGATGTGAAAAATGTACAAG - - - TTGCAAATGCTGATTTGACAGAGGCTAA - - - - - - A 879 ............*..*.. .................... .. FliC - a 873: GGCTCAGTTGACTGCTGCCCATGTGACCGGCGCTGATACTG - - - - - - CTGAAATGGTTAA 926 FliC - b 865: ACTGCA - TTGACCAATGCAGGTGTGACAGGTGC - GACAGGTA - - ATACCAGCTTGGTTAA 920 FliC - c 883: GCTGCA - TTAAAAGCTGCAGGAGTTGCAGATGCAGAAGCTGATACAGCTACTTTAGTGAA 941 FliC - d 895: GCTCAA - CTTGCTGCAGCAGGGGTTACTGGCGCCGATAAGGACAATACTAGCCTTGTAAA 953 FliC - i 880: GCCGCA - TTGACAGCAGCAGGTGTTACCGGCACAGCATCTG - - - - - - TTG - - - - - - TTAA 926 .....*.*......**....**..* *...* *...... ... ..*.** FliC - a 927: GATGTCTTATACGGATAAAAACGGTAAGACTATTGATGGCGGTTTCGGTGTTAAAGTTGG 986 FliC - b 921: AATGTCATTTGAAGATAAAAATGGCAAAGTTACTGATGCGGGTTACGCGCTTAAAGTTGG 980 FliC - c 942: AATGTCTTATACAGATAATAATGGCAAAGTTATTGATGGTGGGTTCGCATTTAAGACCTC 1001 FliC - d 954: ACTATCGTTTGAGGATAAAAACGGTAAGGTTATTGATGGTGGCTATGCAGTGAAAATGGG 1013 FliC - i 927: GATGTCTTATACTGATAATAACGGTAAAACTATTGATGGTGGTTTAGCAGTTAAGGTAGG 986 ..*.**.*.*.. *****.**.**.**...**.*****..**.*..*...*.**..... FliC - a 987: GGCTGATATTTATGCTGCAACAAAAAAT - - - AAAGATGGATCGTTCAGCATTAACACCAC 1043 FliC - b 981: AAATGATTATTATGCCGCTGATTACGATGAAAAAACTGGTGAGATAAAAGCTAAAACTGT 1040 FliC - c 1002: CGGTGGTTATTATGCAGCATCTGTTGAT - - - AAATCTGGCGCAGCTAGCTTGAAAGTTAC 1058 FliC - d 1014: CGACGATTTCTATGCCGCTACATATGATGAGAAAACAGGTGCAATTACTGCTAAAACCAC 1073 FliC - i 987: CGATGATTACTATTCTGCAACTCAAAAT - - - AAAGATGGTTCCATAAGTATTAATACTAC 1043 ....*.*...***.* **......** ***..**..... *...**...... 30
  6. TCNCYH phô b¶n 32 (6) - 2004 FliC - a 1044: TGAATATACCGATA - - AAGAC - GGCAACACTAAAACTGCACTAAACCAACTGGGTGGCGC 1100 FliC - b 1041: AAATTATACTGACG - - - CTACTGGTGCGACAAAAACCGGTGCTGTGAAATTTGGCGGTGC 1097 FliC - c 1059: TAGCTACGTTGACGCTACCACTGGTACCGAAAAAACTGCTGCGAATAAATTAGGTGGCGC 1118 FliC - d 1074: TACTTATACAGATG - - - GTACTGGCGTTGCTCAAACTGGAGCTGTGAAATTTGGTGGCGC 1130 FliC - i 1044: GAAATACACTGCAG - - ATGAC - GGTACATCCAAAACTGCACTAAACAAACTGGGTGGCGC 1100 ... **....*... **.**.....****.*.......**.* **.**.** FliC - a 1101: AGACGGTAAAACTGAAGTTGTTTCTA - - - TCGACGGTAAAACCTACAATGCCAGCAAAGC 1157 FliC - b 1098: GAATGGTAAAACTGAAGTTGTGACCACCGTTGATGGTAATACTTATCAGGCTAGTGATGT 1157 FliC - c 1119: AGACGGTAAAACCGAAGTTGTTACTA - - - TCGACGGTAAAACCTACAATGCCAGCAAAGC 1175 FliC - d 1131: AAATGGTAAATCTGAAGTTGTTACTGCTACCGATGGTAAGACTTACTTAGCAAGCGACCT 1190 FliC - i 1101: AGACGGCAAAACCGAAGTTGTTTCTA - - - TTGGTGGTAAAACTTACGCTGCAAGTAAAGC 1157 ..*.**.***.*.********..*.. ..*..*****.**.**...** **..*... FliC - a 1158: CGCTGGTCACAACTTTAAAGCACAGCCAGAGCTGGCTGAAGCGGCTGCTGCAACCACCGA 1217 FliC - b 1158: AAAAGGGCATAATTTCCAGAGTGGTGGCGCTTTAAGCGAGGCTGTAACCACTAAAACTGA 1217 FliC - c 1176: CGCTGGGCACAACTTCAAAGCACAGCCAGAGCTGGCGGAAGCGGCTGCTACAACCACTGA 1235 FliC - d 1191: TGACAAACATAACTTCAGAACAGGCGGTGAGCTTAAAGAGGTTAATACAGATAAGACTGA 1250 FliC - i 1158: CGAAGGTCACAACTTTAAAGCACAGCCTGATCTGGCGGAAGCGGCTGCTACAACCACCGA 1217 ..... **.**.**............ *...*... **.*......*....*..**.** FliC - a 1218: AAACCCGCTGGCTAAAATTGATGCCGCGCTGGCGCAGGTTGATGCGCTGCGTTCTGACTT 1277 FliC - b 1218: AAACCCGCTGGCTAAAATTGATGCCGCGCTGGCGCAAGTTGATGCGCTGCGTTCTGACTT 1277 FliC - c 1236: AAACCCGCTGCAGAAAATTGATGCTGCTTTGGCGCAGGTGGATGCGCTGCGTTCTGACCT 1295 FliC - d 1251: AAACCCACTGCAGAAAATTGATGCTGCCTTGGCACAGGTTGATACACTTCGTTCTGACCT 1310 FliC - i 1218: AAACCCGCTGCAGAAAATTGATGCTGCTTTGGCACAGGTTGACACGTTACGTTCTGACCT 1277 ******.***...***********.**.****.**.**.**..*..*.*********.* FliC - a 1278: GGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACCGTAAATAA 1337 FliC - b 1278: GGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACCGTAAACAA 1337 FliC - c 1296: GGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACCGTAAATAA 1355 FliC - d 1311: GGGTGCGGTTCAGAACCGTTTCAACTCCGCTATCACCAACCTGGGCAATACCGTAAATAA 1370 FliC - i 1278: GGGTGCGGTACAGAACCGTTTCAACTCCGCTATTACCAACCTGGGCAACACCGTAAACAA 1337 *********.***********************.**************.********.** FliC - a 1338: CCTGTCTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTTTCCAACAT 1397 FliC - b 1338: CCTGTCTGAAGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTCTCCAACAT 1397 FliC - c 1356: CCTGTCTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTTTCCAACAT 1415 FliC - d 1371: CCTGTCTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCAACCGAAGTCTCCAACAT 1430 FliC - i 1338: CCTGACTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTTTCCAACAT 1397 ****.**...********************************.********.******** 31
  7. TCNCYH phô b¶n 32 (6) - 2004 FliC - a 1398: GTCTCGCGCGCAGATCCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGGT 1457 FliC - b 1398: GTCCCGCGCGCAGATTCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGGT 1457 FliC - c 1416: GTCTCGCGCGCAGATTCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGG - 1474 FliC - d 1431: GTCTCGCGCGCAGATTCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGGT 1490 FliC - i 1398: GTCTCGCGCGCAGATTCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGGT 1457 ***.***********.*******************************************. FliC - a 1458: TCCGCAAAACGTCCTCTCTTTACTGCGTTAA 1488 FliC - b 1458: TCCGCAAAACGTCCTCTCTTTACTGCGTTAA 1488 FliC - c 1474: - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 1474 FliC - d 1491: TCCGCAAAACGTCCTCTCTTTACTGCGTTAA 1521 FliC - i 1458: TCCGCAAAACGTCCTCTCTTTACTGCGTTAA 1488 ............................... 2. Kü thuËt Real - Time PCR Trong nhiÒu tr−êng hîp, ng−êi ta cÇn biÕt sè l−îng acid nucleic trong mÉu nghiªn cøu ®Ó phôc vô cho ®iÒu trÞ hoÆc t×m hiÓu c¬ chÕ cña mét qu¸ tr×nh nµo ®ã. VÝ dô nh−, ®Ó ¸p dông ph−¬ng ph¸p ®iÒu trÞ viªm gan B thÝch hîp, ng−êi ta cÇn biÕt sè l−îng c¸c h¹t virus (copy numbers) trong 1 ml m¸u bÖnh nh©n. C¸c nhu cÇu lo¹i nµy ®−îc gi¶i quyÕt nhê kü thuËt Real - Time PCR hay cßn gäi lµ lµ kü thuËt PCR ®Þnh l−îng. Real - Time PCR ®−îc thùc hiÖn dùa trªn kh¸i niÖm “gi¸ trÞ Ct” (Ct value). Ct lµ sè chu kú nhá nhÊt trong ph¶n øng PCR mµ ë ®ã cã sù nh©n lªn cña ADN khu«n (H×nh 2). H×nh 2: S¬ ®å biÓu diÔn gi¸ trÞ Ct (ë ®©y, Ct = 17,5) 32
  8. TCNCYH phô b¶n 32 (6) - 2004 §Ó cã thÓ ®Þnh l−îng ®−îc, ph¶i lËp ®−êng chuÈn víi c¸c gi¸ trÞ ®· biÕt cña c¸c nång ®é ADN kh¸c nhau (H×nh 3): 5 4 3 2 1 H×nh 3. §−êng chuÈn víi 5 nång ®é ADN kh¸c nhau C¨n cø vµo gi¸ trÞ Ct, ng−êi ta sÏ tÝnh ®−îc sè l−îng ADN mÉu (copy numbers) ®· ®−a vµo ph¶n øng. B¶ng 1 lµ mét vÝ dô kÕt qu¶ Real - Time PCR cña mét sè mÉu trong sè 110 mÉu huyÕt thanh bÖnh nh©n ®· ®−îc xÐt nghiÖm chÈn ®o¸n HBV, trong ®ã 75% sè mÉu d−¬ng tÝnh víi sè l−îng copies virus HBV kh¸c nhau. Gi¸ trÞ Ct cµng bÐ th× sè copies number cµng lín vµ ng−îc l¹i: B¶ng 1: KÕt qu¶ xÐt nghiÖm HBV (*, E = exponent value; vÝ dô E+11 = 1011) Ký hiÖu mÉu Gi¸ trÞ Ct Copies/ml 83 2,0 7,8E+11* 35 8,2 3,7E+11 13 16,1 7,5E+09 10 17,9 2,8E+09 14 17,4 2,4E+09 6 18,4 7,6E+08 41 20,4 2,7E+08 66 Kh«ng x¸c ®Þnh 0 68 Kh«ng x¸c ®Þnh 0 110 Kh«ng x¸c ®Þnh 0 33
  9. TCNCYH phô b¶n 32 (6) - 2004 Summary Introduction of sequencing and Real - Time PCR techniques DNA sequencing was first introduced in 1975 by Sanger. The sequencing technique was started with the related information on the interested gene in internet. The following steps consisted of: - Design specific primers - Extract and purify DNA templates - Conduct first PCR (PCR - 1) with the specific primers and template - Purify the DNA product from PCR - 1 - Conduct second PCR (PCR - 2) with the addition of dideoxynucleosides triphosphate and only one primer (not pair of the primers) - Purify the PCR - 2 product and denature the DNA to get single - stranded DNA - Read sequences with ABI 3100 avant sequencer - Processing the collected data and publish Real - Time PCR was a quantitative PCR. The principle of the PCR was based on the threshold value (Ct). The Ct value was minimum number of the cycles of a PCR at which the double - stranded DNA was first synthetized. Thus, the smaller Ct value we got, the greater DNA template present at the beginning of the reaction and vise versa. The basic differentiation in Real - Time PCR compared to the normal one was known standards (the DNA template with the defined concentration). The standards were run paralell with the samples. The results of Real - Time PCR will then show exactly the copy numbers of templates in the original samples. 34
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2