Phần III: Nghiên cứu vai trò của các gien liên quan đến khả năng chống chịu lạnh ở ngô: Quá trình biểu hiện và trình tự vùng promoter của các gien này

Chia sẻ: Lê Na | Ngày: | Loại File: PDF | Số trang:10

Thêm vào BST

Báo xấu

61
lượt xem 3
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bằng kỹ thuật PVR-CDNA Select Subtraction (hay còn có tên gọi khác là SSH- Supperssion Subtractive Hybridization) tác giả đã phân lập được 18 gien có biểu hiện cao trong điều kiện lạnh 6 độ C và 13 độ C. trong số 18 gien này, gien ZmCO16.1 có tần số xuất hiện rất cao (49%) trong thư viện cDNA.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Phần III: Nghiên cứu vai trò của các gien liên quan đến khả năng chống chịu lạnh ở ngô: Quá trình biểu hiện và trình tự vùng promoter của các gien này

31(3): 71-80 Tap chf SINH HOC 9-2009 ARTICLE 3: CHARACTERIZATION OF THE STRESS-INDUCED GENE ZMCOI6.1 IN MAIZE: EXPRESSION AND PROMOTER SEQUENCES THUY HA NGUYEN Institute of Agricultural Genetics, Hanoi,Vietnam JORGLEIPNER ' Institute of Plant Sciences, Zyiich, Switzerland ORLENE GUERRA-PERAZA University of Guelph, Ontario. Canada PETER STAMP Institute of Plant Sciences, Zyrlcli, Switzerland ABSTRACT: Using cDNA subtraction technique, 18 cold stress responsive-genes were identified, among them a novel gene, ZmC016.1, whose function is still unknown. Analysis of the ZmC0I6.1 promoter sequence revealed several conserved stress-responsive cis-acting elements. Further expression characterization shows that ZmCOId.l is induced, in addition by cold, by other abiotic stresses such as drought and NaCI as well as by signalling molecules such as ABA and SA. The results indicate that ZmC0I6.1 is a general stress responsive gene. A possible regulation mechanism is presented where ZmC0I6.1 is alternatively spliced yielding two transcripts whose levels are changed upon different stress treatments. Furthermore the predicted ZmC0I6.1 amino acid sequence and its homologue show high similarity with proteins in rice and Arabidopsis suggesting that it belongs to a conserved protein in plants. Cold-acclimation in plants involves multiple tolerance [8]. These results suggest that this changes in morphology, metabolism such as transcriptional regulation mechanism is accumulation of abscisic acid (ABA) and conserved among several plant species. In salicylic acid (SA), changes in membrane lipid addition, CBF type transcription factors have composition, formation of compatible osmolytes been found in other plants although the function and production of antioxidants. These processes remains to be evaluated. However, there are also are accompanied by notable changes in the level indications of the existence of CBF- of various gene transcripts and proteins [16]. independent cold acclimaction [5]. Gene Our understanding of the molecular pathways in expression is regulated not only at the cold acclimation has changed dramatically with transcriptional level but can also be regulated by the discovery of the C-repeat post-transcriptional events such as alternative (CRT)/dehydration-responsive element (DRE) splicing, translational and post-translational binding transcription factors (CBF) in the model modifications like phosphorylation [2]. organism Arabidopsis thaliana. The CBFs bind Whilst the molecular pathways of to CRT/DRE elements present in the promoter acclimation to low temperature are well regions of many cold- and dehydration- understood for the model plant Arabidopsis [1, responsive genes such as cold-regulated (COR) 16], the knowledge about the molecular basis of genes [4, 17]. In these hnes, over-expression of cold-acclimation in maize is still rudimentary. Arabidopsis CBF induces COR gene expression Furthermore, low , temperature stress in in the chilling-sensitive tomato (Lycoperslcon Arabidopsis occurs at subzero temperatures esculentum), resulting in protection against while maize growth is challenged already at chilling stress at 0°C and improved freezing temperatures below 20°C suggesting that 71 divergent acclimation pathways might be separated by electrophoresis, using 2.0% M employed. In order to characterize the molecular agarose gel, and monitored using Gel Doc 2000 pathways induced in maize in response to cold (Bio-Rad Company, USA). stress, a previous study [12-14] identified The cDNA from the PCR amplification was several nsovel genes, including ZmC016.1, cloned into the pDrive vector (Qiagen AG, whose transcript level increases after exposure Switzerland) and transformed into E. coli DH5D to low non-freezing temperature. The aim of this cells. Clones were sequenced by MWG (MWG- study was to characterize this novel gene for a Biotech AG, Ebersberg, Germany). better insight into its role during cold response. We show that ZmC0I6.1 is in addition to cold 3. Abiotic stress and signalling molecule also highly induced under drought and salt treatments stress and by signalling molecules like salicylic Abiotic stress or signalling molecules were acid and abscicic acid suggesting ZmC0I6.l as applied to maize plants when the third leaf was being a conserved general stress response gene. fully developed. The plants were cold-stressed Furthermore, the expression of ZmC0I6.1 is by decreasing the temperature to 6°C or 13°C. modified by alternative splicing in response to For the drought stress, maize plants were abiotic stress. removed from the hydroponic culture and were I. MATERIAL AND METHODS left to dry in the growth chamber. The salt treatment was induced by adding NaCI to the 1. Plant material and growth conditions Hoagland solution to obtain a concentration of Maize seeds of the genotype ETH-DH7 150 mM. Stress signalhng molecules were were grown in half Hoagland solution (H2395, applied to the hydroponic culture at a final Sigma Chemical Co., USA) supplemented with concentration of 100 pM salicylic acid (SA) or 0.5% Fe-sequestrene, 6 mM K"" and 4 mM Ca^"". 100 pM abscisic acid (ABA). All the treatments Before treatment, plants were grown until the were imposed in the dark. Control plants thud leaf was fully developed at 25/22°C (unstressed) were collected prior applying the (day/night) in growth chambers (Conviron selected stress treatments. The middle part of PGW36, Winnipeg, Canada) at a 12-hour third leaves were harvested, frozen in liquid photoperiod, a light intensity of 300 pmol m"^ s ' nitrogen and stored at -80°C until assay. and a relative humidity df 60/70% (day/night). 4. Bioinformatics 2. Reverse transcriptase (RT)-PCR, cloning A similarity search was performed using the and analysis of cDNA basic local alignment search tool (BLAST) Total RNA was extracted from maize leaf (National Centre for Biotechnology Information samples using Tri Reagent according to Sigma's (NIH, Bethesda, MD, USA) (http://www.ncbi. protocol for RNA isolation. 1.5 pg total RNA of nlm.nih.gov/BLAST/) and the NCBI BLAST2 each sample was reverse transcribed to first- service maintained by the Swiss Institute of strand cDNAs using oligo (dT)23 primer in a Bioinformatics (http://au.expasy.org/tools/blast/). total volume of 20 pi, according to the supplier's PLACE (http://www.dna.affrc.go.jp/PLACE/), a instructions (Advantage RT-for-PCR Kits, DB database of motifs found in plant cii'-acting Biosciences, Clontech, USA). Synthesized regulatory DNA elements was used to scan the cDNAs were diluted in 100 pi H2O and then 4 promoter of the ZmC0I6.1 gene. Splicing pi diluted cDNAs were used as templates for prediction was realized using the Genscan PCR amplification in a volume of 20 pi as program (http://genes.mit.edu/GENSCAN.html). follows: 25 cucles at 95°C for 30s, 57°C for 30 Phylogenetic tree was made using the s and 72°C for 60 s and finally with an CLUSTAL W program. extension at 72°C for 5 minutes. The maize coding genes ubiquitin, ZmUBI (accession II. RESULTS number S94466), was used as an internal 1. A novel cold induced gene, ZmCOI6.1 is standard. Amplified PCR products (15 pi) were conserved in plant species 72 A previous study using the chilling tolerant indicates that the novel cold-induced gene maize genotype ETH-DH7 identified several ZmC016.1 is conserved in plant species. novel cold-induced genes [12-14]. From this Gene homologues and orthologs share study, one gene, ZmC0I6.1, represented by four identity on the amino acid level where similarity different cloned fragments was sorted out for in particular regions might be indicative of further characterization based on the high level domains or motifs important for function. To of occurrence in the screening. To determine the identify putative domains, a comparison of the complete sequence of ZmC 016.1, ten amino acid sequences mentioned above with oligonucleotides, which covered the the ZmCOId.l predicted protein sequence was AZM4_69676 sequence from the maize performed and the results obtained revealed genotype B73 (tgi_maize/) and which showed similar domains specifically at the N- and C- 96 % homology with ZmC0I6.1 detected terminals (data not shown). The most conserved fragment, were designed to amplify this region was the C-terminus with the putative sequence, only, but not AZM4_12960 homolog motif L-P-[FY]-[TV]-V-P-F. • Furthermore, a sequence, which shows 81 % homology with lysine-rich region was identified at the N- ZmC0I6.1 fragments. Overlapping regions of terminal of all the sequences. The function of the corresponding gene in the ETH-DH7 these motifs has not been described previously, genotype were amplified. The overlapping suggesting that they are novel. Analysis of the fragments were sequenced, assembled and amino acid sequence for transmembrane regions annotated in the Genbank (accession number by TMpred [6] did not reveal the presence of DQ060243) [12-14]. transmembrane domains, thus, predicting that To investigate the possible existence of ZmC0I6.1 is a soluble protein. This result homologues and/or orthologues of the suggests that ZmCOI6.1 and its maize homolog ZmC0I6.1 predicted amino acid sequence, a are conserved in plant species sharing high database search was carried out. The database similarity at least for two domains at the amino analysis identified nine amino acid sequences, acid level. similar to the ZmC0I6.1 sequence: one maize a. ZmC016.1 gene Is alternatively spliced homologue, two from Oriza sativa (rice) (Os03gl3810 and OslOg03550 in the TIGR rice To better understand the time course of cold genome annotation database, induction ofthe ZmC 016.1 gene, an experiment was conducted, in which seedlings were http://www.tigr.org) and six from Arabidopsis exposed to 6°C for 24 hours and samples were thaliana (Atlg20100, Atlg75860, At2gl7787, collected after one, two, four, six, 12 and 24 At3g07280, At4g35940 and At5g48610) (figure hours to analyze early and later response. The 1). ZmC0I6.1 also shares nucleotide sequence expression of ZmC0I6.1 increased with time of similarity with ESTs from wheat (Tritlciim exposure to cold confirming its regulation by aestivum L.), barley (Hordeum vulgare L.), cold. Upon analysis by RT-PCR, ZmC0I6.1 sugarcane (Saccharum ojfidnarum L.) and obtained two fragments, referred as sfl and sf2. sorghum (Sorghum bicolor L.) (data not shown). To determine whether the fragments sfl and sf2 Using the amino acid sequences, the were indeed transcripts from the ZmC016.1 phylogenetic relationship between sequences gene and not the expression product of another derived from maize, rice and Arabidopsis were gene(s), both forms were cloned using the analysed excluding the ESTs coding for an oligonucleotides 6551-2 and ZmC0I6.1h_R and incomplete protein (figure 1). This analysis subsequently sequenced. The sequence analysis revealed three main groups: one consisted of revealed that both cDNA forms were identical ZMC0I6.1 and a maize homologue with the specific parts of the ZmC016.1 gene AZM4_12960 sequence together with the rice (data not shown).At normal growth condition sequences, the second group accommodated the (non-stress condition), both fragments sfl and Arabidopsis sequences At4g35940, At2gl7787, sf2 have 3 exons and 2 introns. Under stress At3g07280 and At5g48610 and the third dne treatments, the intron II is splice out in sfl and Atlg75860 and Atlg20100. This analysis the intron 12 in both sfl and sf2 (figure 2). 73 • ZmC 016.1 ^AZM4_12960 •0s03g13810 •0s10g03550 I—AT1G20100 •AT1C75860 r-AT4G35940 •AT2G17787 •At3g07280 ^—At5g48G10 Figure 1. ZmC0I6.1 is conserved in plants as shown by phylogenetic analysis of the deduced ZmC0I6.1 amino acid sequence, homolog and ortholog sequences. The phylogenetic tree of the amino acid sequences of ZmC0I6.1, maize homologue and orthologues in rice and Arabidopsis were constructed using the CLUSTAL W program Figure 2. The splicing structure of ZmC0I6.1 to yield sfl and sf2, as predicted from gene analysis. Thick lines represent exons (El, E2 and E3) and thin lines introns II (nucleotide position from 744 and 1866) and 12 (nucleotide position from 2180 and 2280). Angled lines represent fragments spliced out to yield sfl and sf2 respectively. Triangles indicate the position of the start ( T ) and stop (A) codon. The predicted alternative splicing transcripts are sfl containing El, II, E2 and E3 and sf2 containing E l , E2 and E3 Interestingly, we found that sfl and sf2 were 13"C. The data shown that, at 13°C treatment, amplified from the samples taken at 0 hour the sf2 transcript was also present and remained (control) as well as under cold treatment (figure stable over time, while the levels of sfl 3). A lower level of sfl was found under control increased rapidly (figure 3). These results show conditions, but the levels increased with the that ZmC016.1 is induced at short exposure to length of time exposed to cold stress. The cold and increases with time. The RT-PCR smaller cDNA fragment, sf2, decreased during suggests that the expression is characterized by exposure to 6°C from 1 to 12 hours but started the appearance of two fragments. to increase at 24 hours. To test the effect of The presence of two fragments in the suboptimal temperature 13°C on the expression analysis of ZmC016.1 expression pointed to the of ZmC016.1 and the expression of the two possibility that alternative splicing is taking fragments, the similar experimental set-up at place. Analysis of the putative spliced forms of 74 ZinC016.1, sfl and sf2, revealed that sfl but was less obvious in the second. For further expanded from nucleotide 640 to nucleotide analysis of the gene, the splicing predictor 3196 with 101 nucleotides missing between the GENSCAN program [3] was used to verify the positions 2179 and 2281 (12) (Figure 3). In the results described above. This program predicted sf2 transcript, the regions between 744 and 1867 the donor sites of the first and second introns, (11) and between 2179 and 2281 were missing. the acceptor site of the second intron as well as To identify the positions of the introns and the branch point region of the second intron but exons as well as the splicing points, the not of the first one. Other splicing regions in the Z111COI6.I sequence was analyzed to determine first intron were predicted by GENSCAN, which the splicing consensus sequence, AG/GTAAGT, corresponded neither to the two spliced forms of the introns 5'-splice donor site and TGCAG/G found in this study nor to any of the other of the 3'-splice acceptor site as well as the expressed sequence tags (EST) in the database consensus branch point region CUR AY (R, (data not shown). Similar pattern where also purine; Y, pyrimidine) [9]. Both the first and found in the sequence of rice and Arabidopsis second introns had a conserved 5'-splice donor (data not shown). These results show that site. However, the 3'-acceptor site was ZmC 016.1 sequence harbours conserved conserved in the second intron but less splicing points that would give potential conserved in the first. The branch point products of sizes that are in agreement with sfl sequence was well conserved in the first intron and sf2 obtained in the RT-PCR analysis. Time at 6°C Oh lb 2h 12 h 24 h sfl j^is^f^^sm sf2 ZmUBI Time at 13°C Oh 1h 2h sfl w^"-''''f^w>^*w^^m ZmUBI Figure 3. Expression of ZmC0I6.1 gene under abiotic stresses: ZmC0I6.1 is induced by cold, expression increases with time of exposure and is alternatively spliced. The effect of low (6°C) and suboptimal (13°C) temperature (in the dark) on the expression and alternative splicing of the ZmC0I6.1 gene was examined. 0 hour indicates samples taken prior to treatment. RT-PCR was performed with the primers 6551-2 and ZmC0I6.1b_R to analyse the expression of the ZmC0I6.1 transcripts. ZmUBI was used as the internal control. 2. ZmC0I6.1 gene alternative splicing stress. Therefore, the induction ofthe ZmC0I6.1 occurred under different abiotic stresses gene was tested for drought and salt stress and and signalling molecules with signalling molecules known to induce stress responses, for example to abscisic acid In a previous study the expression of (ABA) and salicylic acid (SA). The ZmC0I6.1 ZmC0I6.1 was changed in response to different gene transcript accumulated under drought and abiotic stresses [12]. The question arose whether under salt stress as well as after treatment with the alternative splicing occurs in the same way SA and ABA. The strongest induction was under other abiotic stresses or after treatment obtained during drought and during the ABA with signalling molecules as it did under cold treatment, where the sfl transcript increased but 75 sf2 remained at low levels (figure 4). Under These results show the conser\^.ion of sodium chloride and jasmonic acid treatment the alternative splicing of ZmC0I6.1 gene in expression of the sf2 transcript was suppressed response to abiotic stress other then cold and (figure 4 and data not shown). induction by signaling molecules. Drought NaCI ABA ZmUBI A^ Figure 4. Expression of fragment sfl of ZmC0I6.1 gene: sfl is increased in maize leaves (ETH- DH7) in response to various stress treatments (drought, NaC,SA and ABA). RT-PCR was performed with cDNA produced from RNA extracted from maize seedlings at 0 hour of treatment at 25°C and after 6 and 24 hours of exposure of maize seedlings to stresses. Ubiquitin (ZmUBI) was used as the internal control. 3. The ZmCOI6.I gene promoter contains DRE/CRT-HvCBF2, LTRE-core and LTRE-1. predicted conserved stress cis-acting Other ds-acimg elements were identified, which elements are involved in abiotic and biotic stress: MYBl, ABRE-like G-box, MYB-core and ASFl (Figure Genes that are induced by stress or other 5; Table 1). Some of these cis-acting elements treatments usually harbour short sequences, cis- were also present in some of the promoters of the acting elements, within the promoter that are orthologs of ZmC0I6.1 suggesting that they share identified by transcription factor, thereby a common feature of pxjssible transcriptional regulating gene expression. To analyze the regulation (data not shown). This result shows the ZmC0I6.1 promoter cw-acting elements, the presence of cis-acting element motifs in the search was performed in a database using the promoter of ZmC0l6.1 and the complexity PLACE program (PLACE/). Several cis-acting regulation of ZMC0I6.1 gene expression upon elements were identified in the ZmC0I6.1 induction by different abiotic stresses. promoter, including the low temperature- responsive elements MYC, DRE/CRT-core, IIL DISCUSSION 1 cgctgtgtcgcctagaaatagcgatgtggtacattccgcaccgcacatcgtcacgacggacgcgccttac ccggcttgcgctggcaacgcgacc|cacgtg[ccggtccgtgattgcgggttg|ccgac|gcttctaggtcggt 71 MYCIG-boxl ABRE-like DRE/CRT-corelLTRE-core tccgggtcgtgggccctcatacacgttgcgtgcgccccgggaacactcaagtactcaaccccggctccga 141 ACGT agt^cgacjtgcaagcggggcccacacgctcttaacctagctgcacccgcgacgcgtagttgcagcgcatc 211 LTRE-core gccattcacagcacccgcatataggt|ctgttg|cactgacatggcgtcccaccacgggcctgtgcc|caact 281 MYB-core MYCIMYB2 gtcagtgaattcgttccggaaacaacgcgtaaccgagactgacgcgctagttgcccgcacgactcggcct 351 DRE1-Rabl7 ASFl cctcgcccccggctttaaatagtggcgtacccccatcccatagaagagactctttcatttccttctaccg 421 Predicted core Promoter INR cagcctcagaattcccccctcccccgtagcgaaaccctagccgccacgccaaaaCcaaatdccgccgagc 491 AGC-boxIGCC-core MYBlpREalpha 76 561 ccgaaa|ttttccggcgggttccttgccgcgaatcgattgatttcgagcgattcgactcctttgtgatctc LTRE-1 IHSE-like 631 tcggcggggtagagcgcggtcgaccgtcggccaigtcgaggtgcttcccctacccgccaccggggt|acgt DRE/CRT-HvCBF2 KBRE-like|lACGT 701 ycggaacccagtggccgtggccgagccggagtcgaccgctaaggtttgttgaaccttcggatttaca- DRE/CRT-HvCBF2 Figure 5. ZmCOI6.1 promoter contains motifs of conserved cis-acting elements involved in stress. The scheme of the ZmCOId.l promoter region and the 5'-end of the transcript showing predicted position of stress-responsive cis-acting elements motifs (for details see Table 1). The sequence is numbered according to the sequence (DQ060243). A hyphen denotes the absence of the corresponding nucleotides residues. The predicted translational start codon is bold and in italics. Capital letters indicate transcribed regions and lower case letters are non-transcribed regions. • : ; • : Table 1 Stress-responsive cis-acting elements present in the ZmCOI6.1 promoter region (see Figure 5), the abiotic/biotic stresses, in which they are involved and the conserved sequences. 'as-1-Iike elements are characterized by two imperfect TGACGTCA motifs, separated by 4 bp, "ll-bp ethylene-responsive element, TAAGAGCCGCC, •'G-box is 5'-C/A- ACACGTGGCA-3'with a CACGTG hexanucleotide core. 'K = G or T; N = A, C, G or T; R = A or G; W = A or T; Y = C or T ''Recognition cis-acting element Involvement Sequence MYC Drought (ABA), cold CANNTG MYB-core Drought stress CNGTTR MYBl Dehydration stress (ABA) WAACCA MYB2 Dehydration stress (ABA) YAACKG ABRE-hke| Drought (etiolation) ACGTG DRE/CRT-core Cold- and dehydration-responsive expression TACCGAC DRE/CRT-HvCBF2 Low temperature GTCGAC DRE1-Rabl7 Drought (ABA) ACCGAGA LTRE-core Low temperature CCGAC LTRE-1 Low temperature CCGAAA ASFL Auxin and/or salicylic acid; perhaps light regulation TGACG INR Light-responsive YTCANTYY AGC-box ,GCC-box Ethylene (=ethylene-inducible defense genes) AGCCGCC GCC-core Defense, jasmonate GCCGCC ACGT Drought (etiolation) ACGT G-box Pathogen, ABA, light CACGTG' Realpha Etiolation AACCAA CNNGAANNNTFC HSE-Uke Heat shock, pathogen NNG 77 In order to get more insight into the response ZmC0I6.1 are all classical sites, witn the of maize to low temperature, we have exception of that at the splice acceptor site in characterized a novel cold-induced gene intron 1 (II). The II of sfl contains several stop ZmC0l6.1. The sequence analysis reveals codons, making it a non-translated transcript, ZmC016 A is a conserved gene in plants showing although h cannot be ruled out that translation high similarity to sequences from rice and takes place by avoiding the II intron code region Arabidopsis and also to ESTs from wheat by means of an unconventional mechanism as (Tiiticum aestivum L.), barley (Hordeum vulgare for example ribosomal shunting or internal L.), sugarcane (Saccharum ojfidnarum L.) and initiation. Assuming that translation starts at the sorghum (Sorghum bicolor L.). The deduced same position in sfl as in sf2, the deduced amino acid sequence indicates that these proteins amino acid sequence of sfl would be only 29 are possibly soluble and they share several motifs amino acids long due to a stop codon at the of high identity whose function still remains to be beginning of exon 1. Start of translation at the characterized. Although preliminary results show ATG in position 2376 (13) would result in a 285 that ZmC016.1 homolog is induced by cold stiess amino acids long protein which would share the it remains to be investigated for response to other C-terminus of sf2 (figure 2). This analysis stresses [12]. suggests sfl as non-functional transcript. The ZmC0I6.1 gene is induced by several The predicted sites for alternative splicing abiotic stresses and signaling molecules were also present in the sequence of rice, as indicating that the ZmC016.1 is probably a shown by the alternative splicing form from the general stress-regulated gene. This is also locus Os03g 13810 (TIGR, rice genome supported by the fact that its promoter contains annotation database) suggesting that the several c/i'-acting elements, suggesting possible orthologs are not only similar on the amino acid regulation by different transcription factors. level but as well share the same alternative The presence of regulative modules within splicing modification. As in the ZmC016.1 the promoter is common in stress-induced genes gene, two mRNA forms are produced from [1, 16]. These elements overlap in function with Os03gl3810, where the first intron is retained in regard to induction in response to stress, as the larger one and the second intron is spliced exemplified by the promoter induction of the out in both of them (unpublished). drought-induced gene RAB17 [7]. However, it The balance between sfl and sf2 of remains to be determined whether all the ZmC016.1 was affected by the low temperature predicted cii'-acting elements are important for and being more stable at 13°C than at 6°C; at the regulation of ZmC0I6.1 gene expression; 6°C there is more sfl than sf2. This difference the induction by different environmental stress in the transcript level at 6°C and 13°C suggests point in this direction. The increased expression that alternative splicing might play an important of ZmC016.1 upon treatment with ABA and SA role in the regulation of ZmC016.1 expression suggests that ZffiC0I6.1 acts downstream of the depending on the strength of the low effector pathways of these signaling molecules. temperature stress. It is possible that sf2 is necessary for normal growth of the plant acting, The results of this study show that the probably as a negative regulator of the stress ZmC0I6.1 gene expression is characterized by response. These results are supported by alternative splicing producing two transcripts, preliminary results showing that a T-DNA sfl and sf2. Alternative splicing, also known as insertion in the Arabidopsis heterolog of differential splicing, is a conserved mechanism ZmC0I6.1 gene (At4G35940) is more tolerant regulating a large part of the expression of many than wilt type plants to cold, drought and salt genes [8]. The modules in ZmC0I6.1 that are stress (resuhs not shown). Under a strong cold involved in splicing were identified by stress (6°C) sf2 was down-regulated or comparing its sequence with conserved splicing remained constant. Therefore, to compensate for motifs and by means of the GENSCAN induction of the gene through the cw-acting program, which corroborated the intron elements in the promoter, alternative splicing retention mechanism. The splicing sites within 78 would be favoured to produce a transcript, sfl, 2. Bade J. et al., 2003: Plant Molecular which is probably non-functional On the other Biology, 52: 53-68. hand, at 13°C the function of ZmC016.1 would 3. Burge C , Karlin S., 1997: lournal of be more important; alternative splicing would be balanced towards the "functional" transcript sf2 Molecular Biology, 268: 78-94. as shown by its increase at 13°C in contrast to 4. Chinnusamy V., Zhu J., Zhu J. K., 2007: 6°C. This would be a link to its possible role as Trends in Plant Science, 12(10): 444-451. a negative regulator. The fact that the sf2 transcript also accumulates in response to 5. Dubouzet J. G. et al., 2003: Plant lournal, signalling molecules, such as abscisid acid and 33:751-63. salicylic acid indicates that sfl probably 6. Hofmann K., Stoffel W., 1993: Biol. regulates the expression of the ZmC016.1 gene Chem. Hoppe-Seyler, 374: 166. and is not an artifact of the abiotic stresses. It is important to mention that 12 is spliced out in 7. Kizis D and Pages M., 2002: Plant lournal, both, sfl and sf2 transcripts; this indicates the 30: 679-689. specifity of intron retention when plants are 8. Lee J. T. et al., 2003: Plant Cell and exposed to adverse conditions or to signalling Environment, 26: 1181-1190. molecules. The retention of unspliced introns in a fraction of the transcripts seems to be common 9. Lorkovic Z. J. et al., 2000: Trends Plant in plants and could either reflect low efficiency Science, 5: 160-167. of splicing or a regulatory process [9]. In 10. Mastrangelo A. M. et al., 2005: Planta, support of the later it was found in Arabidopsis that a high fraction of the alternatively spliced 221:705-715. forms were retained introns [11]. Interestingly, ll.Ner-Gaon H. et al., 2004: The Plant the transcripts with retained introns were for the Journal, 39: 877-885. most part transcripts of stress and external/internal stimuli-related genes. An 12. Nguyen Thuy Ha et al., 2008: Journal of intron retention mechanism has been described Biology, 30(2): 77-87. recently for cold-regulated genes in durum 13. Nguyen H. T. et al., 2009: Plant Physiol. wheat. In this study, genes coding for a putative Biochem., 47: 116-122. ribokinase and a C3H2C3 RING-finger protein were characterized by the stress-induced 14. Orlene Guerra-Peraza, Ha Thuy Nguyen, retention of a subset of introns in the mature Peter Stamp, Jorg Leipner, 2009: Plant mRNA [10]. Science, 176: 783-791 It remains to be characterized how 15. Vanninl C. et al., 2004: Plant Journal, 37: alternative splicing regulates the activity of 115-127. ZmC0I6.1 but most importantly how ZmC0I6.1 16. Thomashow M. F., 1999: Annual Review regulates the stress response in maize. of Plant Physiology & Plant Molecular Biology, 50: 571-599. REFERENCE 17. Zhang F. L. et al., 2008: Plant Science, I. AbeH. etal., 2003: Plant Cell 15: 63-78. 174:510-518. 79 PHAN HI: NGHIEN CUU VAI TRO CUA CAC GIEN LIEN QUAN DEN KHA NANG CHONG CHIU LANH 6 NGO: QUA TRINH BIEU HIEN VA TRINH TU VUNG PROMOTER CUA CAC GIEN NAY N G U Y E N TIHJY HA, JORG LEIPNER, ORLENE GUERRA-PERAZA, PETER STAMP TOMTAT Bang ky thuat PCR-cDNA Select Subtraction (hay con co ten goi khac la SSH- Suppression Subtractive Hybridization) chung toi da phan lap dugc 18 gien co bieu hien cao trong didu kien lanh 6"C va 13"C. Trong sd 18 gien nay, gien ZmC0I6.I co tan sd xua't hien rat cao (49%) trong thu vien cDNA. Qua phan tfch san pham RT- PCR cho thay gien ZniC0I6.I co bieu hien cao khong nhii'ng trong dieu kien nhiet do tha'p ma con CO phan ung vai cac tac nhan khac nhu kho han. mudi man va cac phan tir truyen tin hieu stress nhu ABA va SA nhu vay co the khing dinh ZmC0I6.I co vai tro cua gien chju trach nhiem phan ung lai khi gap di^u kien sdng ba't lgi. Ket qua phan tich cho tha'y, sir bieu hien cua gien ZmC0I6.I do 2 yeu td phien ma quy dinh. Ngoai ra, qua phan tfch virng promoter ciia gien nay cho tha'y, gien co chira nhidu yeu td chiu trach nhiem phan Qng lai khi gap di6u kien sdng ba't lgi gidng nhu d gen liia va Arabidopsis. Ngdy nhdn hdi: 20-4-2008 80