intTypePromotion=4
Array
(
    [0] => Array
        (
            [banner_id] => 142
            [banner_name] => KM3 - Tặng đến 150%
            [banner_picture] => 412_1568183214.jpg
            [banner_picture2] => 986_1568183214.jpg
            [banner_picture3] => 458_1568183214.jpg
            [banner_picture4] => 436_1568779919.jpg
            [banner_picture5] => 
            [banner_type] => 9
            [banner_link] => https://tailieu.vn/nang-cap-tai-khoan-vip.html
            [banner_status] => 1
            [banner_priority] => 0
            [banner_lastmodify] => 2019-09-18 11:12:29
            [banner_startdate] => 2019-09-12 00:00:00
            [banner_enddate] => 2019-09-12 23:59:59
            [banner_isauto_active] => 0
            [banner_timeautoactive] => 
            [user_username] => minhduy
        )

)

Khảo sát đặc điểm thực vật và mã vạch ADN của cây An xoa (Helicteres hirsute L., Sterculiaceae) ở Bình Phước, Việt Nam

Chia sẻ: ViEdison2711 ViEdison2711 | Ngày: | Loại File: PDF | Số trang:10

0
3
lượt xem
0
download

Khảo sát đặc điểm thực vật và mã vạch ADN của cây An xoa (Helicteres hirsute L., Sterculiaceae) ở Bình Phước, Việt Nam

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Đề tài khảo sát đặc điểm thực vật và mã vạch ADN của cây An xoa (Helicteres hirsute L., Sterculiaceae) nhằm hỗ trợ cho việc định danh loài An xoa phân bố ở Bình Phước.

Chủ đề:
Lưu

Nội dung Text: Khảo sát đặc điểm thực vật và mã vạch ADN của cây An xoa (Helicteres hirsute L., Sterculiaceae) ở Bình Phước, Việt Nam

  1. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 KHẢO SÁT ĐẶC ĐIỂM THỰC VẬT VÀ MÃ VẠCH ADN CỦA CÂY AN XOA (HELICTERES HIRSUTE L., STERCULIACEAE) Ở BÌNH PHƯỚC, VIỆT NAM Trương Thị Bảy*, Trương Thị Đẹp**, Đỗ Thị Hồng Tươi** TÓMTẮT Mục tiêu: Đề tài khảo sát đặc điểm thực vật và mã vạch ADN của cây An xoa (Helicteres hirsute L., Sterculiaceae) nhằm hỗ trợ cho việc định danh loài An xoa phân bố ở Bình Phước. Phương pháp: Đề tài đã mô tả đặc điểm hình thái của mẫu An xoa thu thập trong tự nhiên ở huyện Lộc Ninh, tỉnh Bình Phước. Mẫu lá non được sử dụng để phân tích mã mạch ADN dựa trên vùng gen rbcL trong ADN lục lạp cloropast ADN (cpDNA) được khuyếch đại bằng phản ứng PCR từ ADN toàn phần tách chiết từ mẫu lá An xoa non. Sản phẩm PCR được giải trình tự bằng phương pháp Sanger, dùng phần mềm BioEdit 7.0.5. So sánh với trình tự tương ứng công bố trên GenBank bằng phương pháp BLAST để định danh loài dựa trên mã vạch ADN. Kết quả: Quan sát và mô tả đặc điểm thực vật, đặc điểm vi phẫu, bột dược liệu của thân và lá An xoa. Giải trình tự đoạn rbcL của mẫu lá An xoa non thu hái ở tỉnh Bình Phước cho thấy mẫu có độ tương đồng 100% so với trình tự ADN của mẫu đối chứng Helicteres hirsuta L. được công bố trên Genbank. Kết luận: Kết quả của nghiên cứu cung cấp thông tin về đặc điểm thực vật và mã vạch ADN của loài An xoa ở tỉnh Bình Phước góp phần trong công tác định danh loài làm nguyên liệu cho các nghiên cứu về hóa thực vật hoặc tác dụng sinh học của dược liệu này. Từ khóa: An xoa, đặc điểm thực vật, mã vạch ADN, rbcL ABSTRACT STUDY ON BOTANICAL CHARACTERISTICS AND DNA BARCODES OF HELICTERES HIRSUTE L., STERCULIACEAE IN BINH PHUOC PROVINCE, VIETNAM Truong Thi Bay, Truong Thi Dep, Do Thi Hong Tuoi * Ho Chi Minh City Journal of Medicine * Supplement of Vol. 23 - No 2- 2019: 670 – 679 Objectives: This work studied on botanical characteristics and DNA barcodes of Helicteres hirsute L., Sterculiaceae to help identification of this plant in Binh Phuoc province. Methods: This study described morphological characteristics of H. hirsute L. collected naturally in Loc Ninh district, Binh Phuoc province. Fresh leaf was used to analyze DNA barcodes based on rbcL region of chloroplast DNA. Total DNA from leaf were amplified by PCR using rbcL primers. DNA products were identified the sequences by Sanger method, using BioEdit 7.0.5 software. Comparison to rbcL sequences of control published in GenBank by BLAST will help to identify H. hirsuta. Results: The study observed, described botanical and microscopic characteristics of H. hirsute steam and leaf. Results of rbcL sequences of H. hirsute leaf collected in Binh Phuoc province showed that its similarity in comparison with H. hirsute control published in Genbank is 100%. Conclusion: Results of this study provided information about botanical characteristics and DNA barcodes of * Khoa Dược, Trường Cao đẳng Y tế Bình Phước ** Khoa Dược, Đại học Y Dược Thành phố Hồ Chí Minh Tác giả liên lạc: PGS. TS. Đỗ Thị Hồng Tươi ĐT: 0908683080 Email: hongtuoi@ump.edu.vn 670 Chuyên Đề Dược
  2. Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Nghiên cứu Y học H. hirsute in Binh Phuoc province. This could be useful for identify this medicinal plant to research its chemical components as well as biological effects. Key words: Helicteres hirsute L., botanical characteristics, DNA barcodes, rbcL ĐẶTVẤNĐỀ Thực vật, Khoa Dược, Đại học Y dược Tp. Hồ Chí Minh. Vật liệu phân tích mã vạch ADN là An xoa (Helicteres hirsuta L.) có nguồn gốc từ mẫu lá non, tươi thu thập từ cây An xoa trong tự Campuchia được sử dụng trong dân gian để nhiên ở tỉnh Bình Phước. điều trị các bệnh về gan. Ở Việt Nam, An xoa Hóa chất được tìm thấy ở khắp các tỉnh từ Bắc vào Nam. Đệm CTAB (CTAB 2%, Tris-HCl 100 An xoa còn được gọi là Dó lông, dùng làm mM pH 8,0, EDTA 20 mM pH 8,0, NaCl 1,4 M), thuốc chữa ung nhọt; rễ làm thuốc giảm đau, β-mercaptoethanol, cloroform : isoamyl alcohol tiêu độc, kiết lị, cảm cúm, đậu, sởi, sốt rét và rắn (24:1), enzym Rnase và agarose từ Bio Basic, độc cắn; vỏ thân dùng dệt bao tải(8). Gần đây, An Canada; isopropanol, ethanol 70%, PCR Mix do xoa được người Việt Nam truyền miệng như NEXpro, Korea; thuốc nhuộm GelRed, đệm TAE “thần dược” đối các bệnh gan, đặc biệt là ung 1X, loading dye 6x, Ladder 1 kb plus, TE pH 8,0, thư gan nhờ khả năng ức chế sự phân chia của tế nước cất 2 lần vô trùng. bào ung thư gan. Vì vậy, An xoa đang bị khai thác ráo riết làm cho nguồn dược liệu này trong Phương pháp nghiên cứu tự nhiên ngày càng cạn kiệt. Việc định danh An Khảo sát đặc điểm hình thái xoa có thể gặp khó khăn do có sự tương đồng Mô tả phân tích đặc điểm hình thái của thân, cao về đặc điểm hình thái của thân, lá với các lá, hoa, quả. loài thuộc chi Helicteres như H. angustifolia, H. Khảo sát đặc điểm vi phẫu hirsuta, H. viscida, H. glabriuscula, H. lanceolata, H. Cắt thân, lá thành các mảnh mỏng, nhuộm isora. Để khắc phục nhược điểm của việc định và làm tiêu bản vi phẫu. Quan sát, mô tả và chụp danh dựa trên đặc điểm hình thái, phương pháp ảnh các đặc điểm vi phẫu qua kính hiển vi. định danh dựa trên đặc điểm di truyền được nghiên cứu và phát triển. Trên thực vật, mã vạch Khảo sát đặc điểm vi học ADN là phương pháp phổ biến nhất dựa trên Thân, lá được phơi khô, nghiền mịn và làm những đoạn ADN ngắn, kém được bảo tồn, thay tiêu bản bột. Quan sát, mô tả và chụp ảnh các đổi nhiều trong tiến hóa, thường là trình tự đặc điểm qua kính hiển vi. thuộc hệ gen lục lạp như matK, rbcL, rpoC1,... Khảo sát đặc điểm mã vạch ADN Hiện nay, ở Việt Nam chưa có công trình nào Thực hiện phản ứng PCR khuyếch đại vùng nghiên cứu đặc điểm mã vạch ADN của cây An trình tự rbcL trong ADN lục lạp cloropast ADN xoa. Do đó, đề tài này tiến hành khảo sát đặc (cpDNA) của mẫu An xoa. điểm thực vật và mã vạch ADN của cây An xoa phân bố ở tỉnh Bình Phước nhằm hỗ trợ định Tách chiết ADN toàn phần danh loài dược liệu này. ADN toàn phần từ mô lá được tách chiết ĐỐITƯỢNG-PHƯƠNGPHÁPNGHIÊNCỨU theo phương pháp của Doyle và Doyle (1990)(1) tóm tắt như sau: Nghiền lá non, phá màng tế bào Vật liệu trong đệm CTAB 2X, ủ ở 65 oC 15 phút. Bổ sung Vật liệu khảo sát đặc điểm thực vật là mẫu cây An xoa được thu thập trong tự nhiên tại CTAB, trộn đều, ly tâm 13000 rpm 10 phút, loại huyện Lộc Ninh, tỉnh Bình Phước vào tháng 9- cắn tế bào. Chiết ADN bằng β-mercaptoethanol 10/2017. Tiêu bản mẫu được lưu tại Bộ môn ở 65 oC 60 phút, thêm 500 µl cloroform, trộn đều, Chuyên Đề Dược 671
  3. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 ly tâm 13000 rpm 10 phút. Rửa ADN bằng Phân tích số liệu cloroform (2 lần, ly tâm 13000 rpm 10 phút/lần). Trọng lượng phân tử được tính toán bằng Hút lấy 350 µl lớp dịch bên trên, thêm 5 µl phần mềm GelAnalyzer(4). Kết quả giải trình tự RNase, lắc đều, ủ 37 oC 2 giờ. Sau đó, thêm được lưu trữ ở dạng FASTA và phân tích bằng phần mềm BioEdit phiên bản 7.0.5(3). Trình tự CTAB 2X và 500 µl cloroform, ly tâm 13000 rpm được so sánh với trình tự tương ứng đã được 10 phút. Hút 400 µl lớp dịch, thêm 400 µl công bố trên GenBank bằng phương pháp isopropanol, trộn đều, ủ ở -20 oC 30 phút, ly tâm BLAST, từ đó kết luận mã vạch phân tử để định 13000 rpm 10 phút. Thu tủa ADN, rửa 2 lần bằng danh loài. ethanol 70%, làm khô trong 1 giờ, hòa tan trong KẾTQUẢ 30 µl TE và bảo quản ở -20 oC. Đặc điểm hình thái Kiểm tra ADN Cây bụi cao 1-3 m, nhánh hình trụ, có Bằng cách điện di trên gel agarose 1% trong lông. Lá: Lá hình trái xoan, dài 5 - 17 cm, TAE 1X. Trộn mẫu với 1 µl loading dye 6X, 1 µl rộng 2,5 - 7,5 cm. Gốc cụt hay hình tim, đầu thon ADN, 1 µl GelRed, 3 µl nước cất, bơm mẫu vào thành mũi nhọn. Mép có răng không đều. Mặt giếng, chạy điện di ở 85V 30 phút. Sau đó, chụp dưới màu trắng, cả hai măt phủ đầy lông hình ảnh với máy đọc gel bằng UV. sao; gân gốc 5, cuống lá dài 0,8 - 4 cm, lá kèm Khuếch đại AND hình dải, có lông, dễ rụng. Hoa: Cụm hoa là Sử dụng PCR Kit (NEXproTM Diagnostics) những bông ngắn, đơn hay xếp đôi ở nách lá. gồm 10X e-Taq Buffer, 10 mM dNTP, e-Taq Hoa màu hồng hay đỏ, cuống hoa có khớp và có DNA polymerase, thêm nước cất, cặp mồi rbcL lá bắc dễ rụng, đài hình ống phủ lông hình sao, và ADN để có thể tích 50 µl. Trộn đều, cho vào màu đo đỏ, chia 5 răng. Cánh hoa 5, cuống bộ máy GeneAmp PCR System 2700, thực hiện PCR nhị có vân đỏ, nhị 10, nhị lép bằng chỉ nhị, bầu với chu trình nhiệt như sau: 5 phút - 95 oC; (30 có nhiều gợn, chứa 25-30 màu trong mỗi lá noãn. giây - 95 oC, 30 giây - 60 oC, 30 giây - 72 oC) x 35 Quả: Quả nang hình trụ nhọn đầy lông xám, hạt chu kỳ; 5 phút - 72 oC, sau đó giữ ở 10 oC 20 phút. nhiều, hình lăng trụ. Sản phẩm PCR được điện di kiểm tra trên gel Đặc điểm vi phẫu agarose 1%. Đặc điểm vi phẫu của thân Bảng 1: Trình tự cặp mồi rbcL sử dụng trong phản Mặt cắt ngang gần như tròn, biểu bì là 1 lớp ứng PCR tế bào có nhiều lông che chở đa bào, phân 3 - 4 Tên Trình tự (5’-3’) Tm Tác giả nhánh. Biểu bì lồi chỗ chân lông, có nhiều lông o mồi ( C) che chở đa bào hình sao, lông tiết chân đơn bào, rbcL.F ATGTCACCACAAACAGAGACT Levin et al., AAAGC 2003 (5) đầu đa bào. Bần ở thân già 3 - 4 lớp tế bào hình 60 rbcL.R GTAAAATCAAGTCCACCRCG Fazekas et (2) chữ nhật, bên dưới là lục bì gồm 2 - 3 lớp tế bào al., 2008 xếp xuyên tâm. Bên dưới biểu bì là 4 – 5 lớp mô Tinh sạch sản phẩm PCR và giải trình tự dày góc liên tục, tế bào hình đa giác. Mô mềm vỏ đoạn AND đạo, 5 – 6 lớp tế bào mô mềm hình bầu dục, nằm Sản phẩm PCR được tinh sạch bằng kit ngang, kích thước không đều, chứa nhiều tinh Wizard SV Gel và PCR Clean-up System thể calci oxalat hình cầu gai. Trụ bì có 5 - 7 lớp tế (Promega), xác định trình tự bằng phường pháp bào hóa mô cứng rải rác thành cụm. Libe 1 xếp Sanger (Sanger et al., 1977) tại Công ty Phù Sa thành từng cụm bên dưới trụ bì, chứa nhiều tinh Biochem, TP. Vĩnh Long, tỉnh Vĩnh Long(6). thể calci oxalat hình cầu gai. Sợi libe kết thành 2 tầng gồm 1 - 2 lớp tế bào hóa mô cứng không 672 Chuyên Đề Dược
  4. Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Nghiên cứu Y học liên tục. Libe 2 gồm 2 - 3 lớp tế bào hình chữ từng cụm 3 - 4 bó, phân hóa ly tâm, mô mềm gỗ nhật, rải rác có các tinh thể calci oxalat hình cầu 1 là những tế bào hình đa giác. Mô mềm tủy đặc, gai. Gỗ 2 liên tục gồm 15 - 18 lớp tế bào mô mềm hình đa giác, rải rác tinh thể calci oxalat hình cầu gỗ xếp xuyên tâm. Mạch gỗ 2 to, rải rác, hình gai và túi tiết. Thân già mô mềm tủy chứa nhiều tròn hoặc đa giác. Gỗ 1 bên dưới gỗ 2 xếp thành tinh bột. Hình 1: Cây An xoa Hình 2: Vi phẫu thân non (trái) và thân già (phải) Chuyên Đề Dược 673
  5. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Tinh thể calci oxalat hình cầu gai Mô dày góc Lông che chở đa bàohình sao Mô mềm vỏ Hình 3 : Đặc thể vi phẫu của thân An xoa Đặc điểm vi phẫu của cuống lá mềm vỏ là mô mềm đạo, tế bào hình đa giác, gần Mặt cắt ngang hình trứng. Biểu bì mang tròn, kích thước không đều, có nhiều túi tiết và nhiều lông che chở phân nhánh như thân non và tinh thể calci oxalat hình cầu gai. Trụ bì hóa mô nhiều lông tiết chân đơn bào, đầu đa bào. Bên cứng thành từng cụm 4 - 5 lớp tế bào. Libe 1 tập dưới biểu bì là mô dày góc liên tục gồm 4 - 5 lớp trung bên dưới đám trụ bì. Gỗ 1 hình vòng tròn. tế bào, nhiều hơn ở phần lồi của cuống lá. Mô Bên trong là mô mềm tủy có nhiều khuyết. Hình 4: Vi phẫu cuống lá An xoa 674 Chuyên Đề Dược
  6. Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Nghiên cứu Y học Đặc điểm vi phẫu của lá calci oxalat hình cầu gai. Trụ bì hóa mô cứng thành từng cụm 3-4 lớp tế bào. Hệ thống mô dẫn Gân giữa lồi ở cả hai mặt. Biểu bì trên và biểu bì dưới mang lông che chở phân nhánh và gồm libe 1 ở ngoài, gỗ 1 ở trong xếp thành vòng lông tiết. Bên dưới biểu bì là mô dày góc, phần bán nguyệt. Mạch gỗ xếp xuyên tâm, mạch to ở biểu bì trên mô dày nhiều lớp tế bào hơn biểu bì ngoài, mạch nhỏ ở trong. Bên trong cùng là mô dưới. Mô mềm đạo, nhiều túi tiết và tinh thể mềm tủy. Hình 5: Vi phẫu phiến lá An xoa Hình 6: Đặc điểm vi phẫu của lá An xoa Đặc điểm vi phẫu của hoa Cánh hoa: 5 cánh hoa rời, không đều. 2 Hoa tự bông ở nách lá, mọc thành cụm 2 - cánh trên to, rộng khoảng 3 mm, có phiến màu 3 bông, mỗi bông có 6 – 12 hoa mọc thành 2 tím, phần gân phớt màu vàng, có ít lông, hơi dãy trên trục mang hoa. Cuống hoa hình trụ, quặp lại phía sau, 3 cánh hoa dưới nhỏ hơn, dài 3 - 4 mm, đường kính khoảng 1 mm, màu rộng khoảng 1,5 - 2 cm, phần gần phiến chia 2 tím nhạt, có nhiều lông. Lá bắc hình vảy nhỏ, thùy màu trắng. Tiền khai hoa vặn. dài khoảng 3 - 4 mm, màu xanh hơi tím, có Bộ nhị có hùng thư đài dài 1,5 cm, màu nhiều lông, rụng sớm. Lá bắc con giống lá trắng, mang 10 nhị rời, chỉ nhị trắng, dài 2 bắc, mọc phía đối diện lá bắc. mm. Bao phấn 2 ô, hình bầu dục, nứt dọc, Định hướng: Cánh hoa giữa ở phía trước, hướng ngoại. Hạt phấn màu trắng, rời, hình lá đài giữa ở phía sau. khối tam giác. Đài hoa: 5 lá đài dính thành ống đài hình Bộ nhụy: Bầu thượng, 5 lá noãn, bầu 5 ô, ống, trên chia 5 thùy hình tam giác dài mỗi ô 1 noãn, đính noãn trung trụ. Bầu hình khoảng 3 mm. Ống đài dài khoảng 1,5 cm, bầu dục, hơi nhọn phần đỉnh, màu xanh, màu tím, có nhiều lông che chở hình sao. mang nhiều lông màu hồng. 1 vòi nhụy màu Tiền khai đài van. trắng đính ở đỉnh bầu, dài khoảng 1,5 mm, 1 đầu nhụy trắng, trên cùng chia 5 gờ nhỏ. Có đĩa mật ở đế hoa. Chuyên Đề Dược 675
  7. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Hùng thư đài Hạt phấn Phiến cánh to (trên) và nhỏ (dưới) Bầu nhụy Quả cắt ngang Hình 7: Cánh, bộ nhị và bộ nhụy của hoa An xoa Đặc điểm bột dược liệu tinh thể calci oxalat hình cầu gai. Mảnh mô mềm có túi tiết. Lông che chở đơn bào hoặc Bột lá đa bào hình sao. Lông tiết chân đơn bào, Bột màu xanh, nhiều xơ, không mùi, vị hơi đầu đa bào. Sợi xếp thành bó. Tinh thể calci đắng. Thành phần gồm mảnh biểu bì dưới, tế oxalat cầu gai đường kính 8-30 µm. Mảnh bào hình đa giác, vách uốn lượn, mang mạch xoắn, mạch mạng. nhiều lỗ khí kiểu dị bào. Mô mềm giậu hình ngang, tế bào hình đa giác chứa tinh bột và Lông che chở đa Lông che chở Lông tiết Mô mềm chứa calci oxalat Mạch điểm bào hình sao đơn bào hình cầu gai Biểu bì diệp lục Lỗ khí nhiều ở Lỗ khí Biểu bì hình đa giác Mạch vòng hình giậu biểu bì dưới (nhìn từ trên xuống) Hình 8: Đặc điểm của bột lá An xoa Bột thân cầu gai, sợi mang tinh thể calci oxalat hình cầu Bột thân màu nâu, nhiều xơ, không mùi. gai, mảnh bần, mạch vòng, mạch xoắn, mạch Thành phần gồm lông che chở đa bào hình điểm, mạch vạch. sao, mô mềm chứa tinh thể calci oxalat hình 676 Chuyên Đề Dược
  8. Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Nghiên cứu Y học Lông che chở đa bào Mô mềm chứa tinh thể calci Sợi Sợi mang tinh thể calci oxalat hình sao oxalat hình cầu gai hình cầu gai Mảnh bần Mạch vòng, mạch xoắn Mạch vạch Mảnh mạch điểm Hình 9: Đặc điểm của bột thân An xoa Đặc điểm mã vạch ADN đoạn rbcL của loài Helicteres hirsuta L. được công Hình ảnh điện di cho thấy ADN của lá bố trên Genbank (https:// www.ncbi.nlm.- An xoa non nguyên vẹn, không bị đứt gãy, nih.gov/nuccore/AB925611.1) mẫu đối chứng, đạt yêu cầu cho thí nghiệm tiếp theo. Cặp kết quả trình bày ở Hình 11. mồi rbcL sử dụng được thiết kế dựa trên Mức độ tương đồng khi so sánh trình tự trình tự báo cáo trước đây giúp khuếch đại đoạn rbcL của mẫu lá An xoa ở Bình Phước thành công đoạn rbcL, sản phẩm PCR có với mẫu đối chứng Helicteres hirsuta L. [mã kích thước 600 bp (Hình 10). số AB925611.1 – tác giả Toyama et al., Trình tự đoạn rbcL của mẫu An xoa được xử 2015(7)] công bố trên Genbank bằng phương lý bằng phần mềm BioEdit 7.0.5. So với trình tự pháp BLAST là 100%. Hình 10: Kết quả điện di ADN của mẫu lá non (trái) và sản phẩm PCR đoạn rbcL (phải) Chuyên Đề Dược 677
  9. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Hình 11: Kết quả so sánh trình tự giữa mẫu lá An xoa (Query) và mẫu đối chứng (Sbjct) BÀNLUẬN trình tự được thiết kế dựa trên trình tự tham khảo từ các báo cáo trước đây(2,5). Kết quả giải Việc định danh đúng nguyên liệu làm thuốc trình tự đoạn rbcL từ mẫu lá An xoa non thu hái là yêu cầu đầu tiên đóng vai trò quan trọng tại tỉnh Bình Phước cho thấy dược liệu khảo sát trong các nghiên cứu về dược liệu. Kiểm nghiệm có độ tương đồng là 100% so với trình tự đoạn dược liệu làm thuốc, tránh sai sót và nhầm lẫn rbcL của mẫu đối chứng Helicteres hirsuta L. đã nguồn nguyên liệu sử dụng góp phần quan được nhóm tác giả Toyama và cộng sự công bố trọng ngăn ngừa sự pha trộn dược liệu giả trong trên GenBank năm 2015(7). Từ đó gợi ý kết quả các thuốc từ dược liệu. Hiện nay, việc định danh phân tích mã vạch ADN của đoạn gen rbcL có dược liệu dựa trên đặc điểm thực vật gặp nhiều thể sử dụng để phân biệt loài An xoa với các loài khó khăn, nhất là đối với những loài có sự tương khác thuộc chi Helicteres phân bố nhiều ở các đồng cao về đặc điểm hình thái. Vì vậy, phương tỉnh của Việt Nam. pháp phân tích đặc điểm di truyền dựa trên mã vạch ADN càng ngày càng được quan tâm KẾTLUẬN nghiên cứu, ứng dụng trong định danh thực vật Đề tài đã quan sát và mô tả đặc điểm thực nói chung và dược liệu nói riêng. vật, đặc điểm vi phẫu, bột dược liệu của thân và Đối với An xoa, được sử dụng đầu tiên bởi lá An xoa. Giải trình tự đoạn rbcL của mẫu lá An người dân huyện Lộc Ninh, tỉnh Bình Phước trị xoa non thu hái ở tỉnh Bình Phước cho thấy mẫu các bệnh về gan, kể cả ung thư gan, đề tài này sử có độ tương đồng 100% so với trình tự ADN của dụng đoạn rbcL khuếch đại với cặp đoạn mồi có mẫu đối chứng Helicteres hirsuta L. được công bố 678 Chuyên Đề Dược
  10. Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 2 * 2019 Nghiên cứu Y học trên Genbank. Kết quả thu được góp phần trong 6. Sanger S, Nicklen S, Coulson AR (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA, 74(12): công tác định danh loài làm nguyên liệu cho các pp.5463–5467. nghiên cứu về hóa thực vật hoặc tác dụng sinh 7. Toyama H, Kajisa T, Tagane S, Mase K, Chhang P, Samreth V, Ma V, Sokh H, Ichihashi R, Onoda Y, Mizoue N, Yahara T học của cây An xoa. (2015). Effects of logging and recruitment on community TÀILIỆUTHAMKHẢO phylogenetic structure in 32 permanent forest plots of Kampong Thom, Cambodia. Philos. Trans. R. Soc. Lond., B, Biol. 1. Doyle JJ, Doyle JL (1990). Isolation of plant DNA from fresh Sci., 370 (1662). tissue. Focus, 12: pp.13-15. 8. Võ Văn Chi (2012), Từ điển cây thuốc Việt Nam, 2, Nhà xuất 2. Fazekas AJ, Burgess KS, Kesanakurti PR, et al. (2008). Multiple bản Y học, tr. 1011-1013. multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PLOS One, 7: pp.e2802. 3. Hall TA (1999). BioEdit: a user-friendly biological sequence Ngày nhận bài báo: 18/10/2018 alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser., 41: pp.95-98. Ngày phản biện nhận xét bài báo: 01/11/2018 4. Istvan L (2010). GelAnalyzer version 2010, available at: Ngày bài báo được đăng: 15/03/2019 http://www.gelanalyzer.com. 5. Levin RA, Wagner WL, Hoch PC, et al. (2003). Family-level relationships of onagraceae based on chloroplast rbcL and ndhF data. American Journal of Botany, 90: pp.107-115. Chuyên Đề Dược 679

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản