intTypePromotion=1
ADSENSE

Ảnh hưởng của một số yếu tố lâm sàng và di truyền lên liều thuốc acenocoumarol ở bệnh nhân thay van tim cơ học

Chia sẻ: Nguyễn Tuấn Anh | Ngày: | Loại File: PDF | Số trang:7

73
lượt xem
2
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nghiên cứu này được thực hiện nhằm mục tiêu xác định mối liên quan giữa một số yếu tố lâm sàng và đa hình gen CYP2C9*3, VKORC1 - 1639G > A với liều thuốc acenocoumarol. Phương pháp: Xác định tỷ lệ kiểu gen CYP2C9*3 và VKORC - 1639G > A bằng phương pháp giải trình tự gen, đánh giá mối liên quan giữa một sô yếu tố lâm sàng và các kiểu gen này với liều thuốc acenocoumarol. Kết quả nghiên cứu cho thấy, tỷ lệ kiểu gen CYP2C9*1*3 là 5,75%, VKORC1 - 1639AA là 86,2%

Chủ đề:
Lưu

Nội dung Text: Ảnh hưởng của một số yếu tố lâm sàng và di truyền lên liều thuốc acenocoumarol ở bệnh nhân thay van tim cơ học

TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> ẢNH HƯỞNG CỦA MỘT SỐ YẾU TỐ LÂM SÀNG<br /> VÀ DI TRUYỀN LÊN LIỀU THUỐC ACENOCOUMAROL<br /> Ở BỆNH NHÂN THAY VAN TIM CƠ HỌC<br /> Phạm Thị Thùy1, Vũ Thị Thơm2, Đỗ Thị Lệ Hằng2,<br /> Phạm Hồng Nhung2, Phạm Trung Kiên2, Tạ Thành Văn3<br /> 1<br /> <br /> Đại học Y Dược Thái Nguyên; 2Đại học Quốc gia Hà Nội; 3Trường Đại học Y Hà Nội<br /> <br /> Acenocoumarol là thuốc chống đông kháng vitamin K đường uống được sử dụng khá phổ biến. Thuốc có<br /> hiệu quả chống đông cao, giá thành rẻ nhưng giới hạn điều trị hẹp và bị ảnh hưởng bởi các yếu tố như môi<br /> trường, di truyền. Các nghiên cứu trên thế giới đã chỉ ra rằng biến liều acenocoumarol phụ thuốc rất lớn vào<br /> đa hình gen CYP2C9*3 và VKORC1 - 1639G > A. Nghiên cứu này được thực hiện nhằm mục tiêu xác định mối<br /> liên quan giữa một số yếu tố lâm sàng và đa hình gen CYP2C9*3, VKORC1 - 1639G > A với liều thuốc<br /> acenocoumarol. Phương pháp: Xác định tỷ lệ kiểu gen CYP2C9*3 và VKORC - 1639G > A bằng phương<br /> pháp giải trình tự gen, đánh giá mối liên quan giữa một sô yếu tố lâm sàng và các kiểu gen này với liều<br /> thuốc acenocoumarol. Kết quả nghiên cứu cho thấy, tỷ lệ kiểu gen CYP2C9*1*3 là 5,75%, VKORC1 1639AA là 86,2%. Bệnh nhân trên 50 tuổi có liều thuốc chống đông thấp hơn có ý nghĩa so với những bệnh<br /> nhân dưới 50 tuổi. Người mang kiểu gen VKORC1 - 1639AA có liều thuốc thấp hơn so với người mang kiểu<br /> gen GG và GA với sự khác biệt có ý nghĩa thống kê.<br /> Từ khóa: Acenocoumarol, đa hình gen CYP2C9*3, VKORC1 - 1639G > A<br /> <br /> I. ĐẶT VẤN ĐỀ<br /> Acenocoumarol là một trong những thuốc<br /> chống đông kháng vitamin K đường uống<br /> được sử dụng khá phổ biến với ưu điểm như<br /> hiệu quả chống đông cao, giá thành rẻ. Tuy<br /> nhiên, thuốc lại có nhược điểm là giới hạn<br /> điều trị hẹp, bị ảnh hưởng bởi nhiều yếu tố<br /> của môi trường và di truyền nên phải thường<br /> xuyên theo dõi các chỉ số đông máu như INR<br /> (International normalized ratio) [1]. Một số<br /> nghiên cứu trên thế giới đã chứng minh sự<br /> ảnh hưởng của các yếu tố lâm sàng và di<br /> truyền như đa hình gen CYP2C9, VKORC1<br /> đến hiệu quả chống đông của acenocoumarol<br /> [2].<br /> Địa chỉ liên hệ: Phạm Thị Thủy, Trường Đại học Y Dược<br /> Thái Nguyên<br /> Email: phamthuydhy2612@gmail.com<br /> Ngày nhận: 05/12/2018<br /> Ngày được chấp thuận: 31/12/2018<br /> <br /> 136<br /> <br /> Gen CYP2C9 mã hóa enzym CYP2C9 là<br /> một enzym thuộc họ Cytochrome P450, đóng<br /> vai trò quan trọng trong việc oxy hóa các hợp<br /> chất nội sinh và ngoại sinh ở gan. Giống như<br /> các thành viên CYP2C khác, CYP2C9 có tính<br /> đa hình cao, trong đó đa hình CYP2C9*3 làm<br /> thay đổi acid amin Ile359Leu, đã được xác<br /> định là nguyên nhân gây chuyển hóa kém<br /> thuốc acenocoumarol. Gen VKORC1 mã hóa<br /> cho enzym Vitamin K epoxide reductase là<br /> enzyme đích của acenocoumarol chịu trách<br /> nhiệm chuyển hóa vitamin K dạng oxy hóa<br /> thành vitamin K dạng khử tham gia vào quá<br /> trình đông máu. Sự xuất hiện đa hình<br /> VKORC1 - 1639G > A sẽ làm giảm hoạt động<br /> của enzym Vitamin K epoxide reductase, do<br /> vậy cần liều thuốc acenocoumarol thấp hơn<br /> bình thường đã đạt được hiệu quả điều trị [3].<br /> Hiện nay, y học cá thể hóa trong liệu pháp<br /> điều trị đang trở thành mối quan tâm lớn đối<br /> <br /> TCNCYH 117 (1) - 2019<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> với các nhà lâm sàng nhằm đưa ra liều điều trị<br /> <br /> thuốc chống đông acenocoumarol cho vào<br /> <br /> tối ưu cho mỗi cá thể người bệnh dựa trên<br /> <br /> ống chứa chất chống đông EDTA, bảo quản ở<br /> <br /> đặc điểm thông tin di truyền của họ, mang lại<br /> <br /> nhiệt độ -200C cho đến khi phân tích.<br /> <br /> hiệu quả điều trị cũng như hạn chế các biến<br /> <br /> Tách chiết DNA từ máu ngoại vi: Sử dụng<br /> <br /> chứng. Chính vì vậy nghiên cứu này được<br /> <br /> Kit Omega-Biotek. Kiểm tra nồng độ và độ tinh<br /> <br /> thực hiện nhằm mục tiêu xác định mối liên<br /> <br /> sạch của DNA tách chiết bằng phương pháp<br /> <br /> quan giữa một số yếu tố lâm sàng và đa hình<br /> <br /> đo quang, dựa vào tỷ lệ A260nm/A280nm =<br /> <br /> gen CYP2C9*3, VKORC1 - 1639G > A với liều<br /> <br /> 1,8 - 2,0<br /> <br /> thuốc acenocoumarol ở bệnh nhân thay van<br /> tim cơ học.<br /> <br /> -1639G > A bằng kỹ thuật PCR và giải trình tự<br /> <br /> II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP<br /> <br /> dụng<br /> <br /> gen<br /> <br /> chứa<br /> <br /> SNP<br /> <br /> CYP2C9*3<br /> <br /> (rs1057910) và VKORC1 - 1639G > A<br /> <br /> Gồm 174 bệnh nhân thay van tim cơ học<br /> sử<br /> <br /> gen:<br /> Vùng<br /> <br /> 1. Đối tượng<br /> <br /> đang<br /> <br /> Xác định kiểu gen CYP2C9*3 và VKORC1<br /> <br /> thuốc<br /> <br /> chống<br /> <br /> đông<br /> <br /> acenocoumarol được theo dõi và quản lý tại<br /> Bệnh viện Tim Hà Nội.<br /> Tiêu chuẩn lựa chọn bệnh nhân: Bệnh<br /> nhân thay van tim cơ học đang dùng thuốc<br /> chống đông acenocoumarol đạt đích điều trị<br /> (INR từ 2,0 - 3,5), liều thuốc chống đông thay<br /> đổi không quá 20% trong 3 tháng liên tiếp.<br /> <br /> (rs9923231) được khếch đại bằng cặp mồi<br /> đặc hiệu có trình tự lần lượt là:<br /> Mồi xuôi: 5’ TACACTCCCATCATGCCTG 3’.<br /> Mồi ngược: 5’ GACCATCGTCAATCTCTACC 3’.<br /> Mồi xuôi: 5’ GCATCTGTAACCATCCTCTC 3’.<br /> Mồi ngược: 5’ GTGTCAAGATTCAGTTCTTTCC 3’.<br /> <br /> - Thành phần phản ứng PCR: dNTP Mix:<br /> 0,2mM; Q5 Hingh-Fidelity DNA polymerase:<br /> 0,02u/µl; mồi xuôi và mồi ngược: 0,5uM; DNA:<br /> <br /> Tiêu chuẩn loại trừ: Bệnh nhân mắc bệnh<br /> lý về thận, gan, tuyến giáp, nghiện rượu, đang<br /> <br /> 50ng/µl.<br /> <br /> bị nhiễm trùng cấp, phụ nữ có thai, đang dùng<br /> thuốc điều trị bệnh lý dạ dày.<br /> <br /> trong 3 phút; 35chu kỳ, 95oC trong 10 giây;<br /> <br /> 2. Phương pháp<br /> - Thiết kế nghiên cứu: Nghiên cứu mô tả<br /> cắt ngang.<br /> - Thời gian thực hiện nghiên cứu: Từ tháng<br /> 5/2017-8/2018.<br /> - Địa điểm: Khoa Y Dược Đại học Quốc gia<br /> Hà Nội, Bệnh viện Tim Hà Nội, Bộ môn Hóa<br /> sinh Trường Đại học Y Hà Nội.<br /> Các bước tiến hành<br /> Lấy mẫu: Lấy 2ml máu tĩnh mạch ngoại vi<br /> của bệnh nhân thay van tim cơ học dùng<br /> <br /> TCNCYH 117 (1) - 2019<br /> <br /> - Chu trình nhiệt của phản ứng PCR: 98oC<br /> gắn mồi 63oC trong 30 giây, tiếp theo là 72oC<br /> trong 30 giây và cuối cùng là 72oC trong 5<br /> phút.<br /> - Sản phẩm PCR được điện di kiểm tra<br /> trên gel agarose 1,5%, sau đó được tinh sạch<br /> để giải trình tự.<br /> - Giải trình tự trên hệ thống 3500<br /> Automatic<br /> (Applied<br /> <br /> DNA<br /> <br /> Segmentation<br /> <br /> Biosystems)<br /> <br /> và<br /> <br /> Analyzer<br /> <br /> BigDye<br /> <br /> Kit<br /> <br /> Terminator v3.1 cycle sequencing. Các kết<br /> quả trình tự được phân tích trên phần mềm<br /> BioEdit 7.1.9.<br /> 137<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> 3. Xử lý số liệu<br /> <br /> tham gia nghiên cứu. Các thông tin liên quan<br /> <br /> Phương pháp thống kê, kiểm định ChiSquare và ANOVA trên phần mềm SPSS20.0<br /> được sử dụng để đánh giá tỷ lệ các alen, kiểu<br /> gen và mối liên quan giữa chúng với liều<br /> <br /> đến bệnh nhân được đảm bảo bí mật.<br /> <br /> III. KẾT QUẢ<br /> 1. Đặc điểm chung của nhóm nghiên<br /> cứu<br /> <br /> thuốc acenocoumarol.<br /> 4. Đạo đức nghiên cứu<br /> <br /> Tuổi trung bình của nhóm nghiên cứu là<br /> <br /> Nghiên cứu được thông qua bởi Hội đồng<br /> đạo đức Trường Đại học Y Hà Nội. Các đối<br /> tượng tham gia nghiên cứu là hoàn toàn tự<br /> nguyện và có quyền rút lui khi không muốn<br /> <br /> 50,53 ± 9,07. Chỉ số BMI trung bình là 21,33 ±<br /> 2,73. Bệnh nhân nữ chiếm đa số với 58,62%.<br /> Liều thuốc chống đông trung bình ở nhóm<br /> nghiên cứu là 12,10 ± 4,46 mg/tuần (bảng 1).<br /> <br /> Bảng 1. Một số đặc điểm ở nhóm nghiên cứu<br /> Nhóm<br /> Tuổi<br /> <br /> BMI<br /> <br /> Giới<br /> <br /> n<br /> <br /> %<br /> <br /> ≤ 50<br /> <br /> 75<br /> <br /> 43,10<br /> <br /> > 50<br /> <br /> 99<br /> <br /> 56,90<br /> <br /> < 23<br /> <br /> 131<br /> <br /> 75,29<br /> <br /> ≥ 23<br /> <br /> 43<br /> <br /> 24,71<br /> <br /> Nam<br /> <br /> 72<br /> <br /> 41,38<br /> <br /> Nữ<br /> <br /> 102<br /> <br /> 58,62<br /> <br /> X ± SD<br /> 50,53 ± 9,07<br /> <br /> 21,33 ± 2,73<br /> <br /> Liều thuốc acenocoumarol trung bình: 12,10 ± 4,46 mg/tuần<br /> 2. Mối liên quan giữa một số đặc điểm lâm sàng và liều thuốc acenocoumarol<br /> Bảng 2. Mối liên quan giữa một số đặc điểm lâm sàng và liều thuốc acenocoumarol<br /> ở nhóm nghiên cứu<br /> Nhóm<br /> Tuổi<br /> <br /> BMI<br /> <br /> Giới<br /> <br /> 138<br /> <br /> Liều thuốc acenocoumarol (mg/tuần)<br /> ≤ 50<br /> <br /> 13,23 ± 4,74<br /> <br /> > 50<br /> <br /> 11,25 ± 4,07<br /> <br /> < 23<br /> <br /> 11,96 ± 4,56<br /> <br /> ≥ 23<br /> <br /> 12,55 ± 4,19<br /> <br /> Nam<br /> <br /> 12,00 ± 4,60<br /> <br /> Nữ<br /> <br /> 12,17 ± 4,39<br /> <br /> X ± SD<br /> <br /> p<br /> < 0,05<br /> <br /> > 0,05<br /> <br /> > 0,05<br /> <br /> TCNCYH 117 (1) - 2019<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> Liều thuốc trung bình ở bệnh nhân trên 50 tuổi là 11,25 ± 4,07 mg/tuần thấp hơn có ý nghĩa so<br /> với nhóm bệnh nhân dưới 50 tuổi là 13,23 ± 4,74 mg/tuần với p < 0,05. Không có sự khác biệt về<br /> liều thuốc theo chỉ số BMI và giới tính ở nhóm nghiên cứu.<br /> 3. Kết quả xác định kiểu gen CYP2C9*3 và VKORC1 - 1639G > A bằng kỹ thuật giải trình<br /> tự gen<br /> Đoạn gen chứa các SNPs CYP2C9*3 và VKORC1 - 1639G > A được khuyếch đại bằng cặp<br /> mồi đặc hiệu. Sau khi kiểm tra, sản phẩm PCR được tinh sạch và giải trình tự. Kết quả được<br /> minh họa ở hình 1.<br /> <br /> Đa hình CYP2C9*1*1<br /> <br /> Đa hình VKORC1 - 1639GG<br /> <br /> Đa hình CYP2C9*1*3<br /> <br /> Đa hình VKORC1 - 1639GA<br /> <br /> Đa hình VKORC1 - 1639AA<br /> <br /> Hình 1. Hình ảnh giải trình tự gen CYP2C9*3 và VKORC1 - 1639G > A ở nhóm nghiên cứu<br /> Sản phẩm giải trình tự rõ nét. Các đỉnh màu tương ứng với các nucleotid rõ ràng, không có tín<br /> hiệu nhiễu. Kết quả giải trình tự tại exon 7 của gen CYP2C9 cho phép xác định kiểu gen dị hợp<br /> AC. Tại vùng promorter gen VKORC1 cho phép xác định kiểu gen dị hợp GA và đồng hợp AA.<br /> 4. Tỷ lệ kiểu gen CYP2C9*3, VKORC1 - 1639G > A và mối liên quan với liều thuốc<br /> acenocoumarol<br /> Bảng 3. Tỷ lệ kiểu gen CYP2C9*3, VKORC1 - 1639G > A và mối liên quan với liều thuốc<br /> acenocoumarol ở nhóm nghiên cứu<br /> Kiểu gen<br /> <br /> n (%)<br /> <br /> Liều thuốc acenocoumarol (mg/tuần) X ± SD<br /> <br /> *1*1<br /> <br /> 164 (94,25)<br /> <br /> 12,03 ± 4,34<br /> <br /> *1*3<br /> <br /> 10 (5,75)<br /> <br /> 13,27 ± 6,40<br /> <br /> p<br /> <br /> CYP2C9*3<br /> > 0,05<br /> <br /> VKORC1 - 1639G > A<br /> GG<br /> <br /> 3 (1,7)<br /> <br /> 18,5 ± 2,5<br /> <br /> GA<br /> <br /> 21 (12,1)<br /> <br /> 15,93 ± 5,54<br /> <br /> AA<br /> <br /> 150 (86,2)<br /> <br /> 11,44 ± 3,95<br /> <br /> TCNCYH 117 (1) - 2019<br /> <br /> p(GG-GA) > 0,05<br /> p(GG-AA) < 0,05<br /> P(GA-AA) < 0,05<br /> <br /> 139<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> Tỷ lệ kiểu gen CYP2C9*1*3 là 5,75%, không có sự khác biệt về liều thuốc acenocoumarol<br /> trung bình giữa hai nhóm. Kiểu gen VKORC1 - 1639AA là chủ yếu chiếm 86,2%, liều thuốc trung<br /> bình ở nhóm bệnh nhân mang kiểu gen AA thấp hơn có ý nghĩa so với các kiểu gen GG và GA<br /> với p < 0,05.<br /> 5. Mối liên quan giữa tuổi và kiểu gen VKORC1-1639G > A với liều thuốc acenocoumarol<br /> Bảng 4. Mối liên quan giữa tuổi và kiểu gen VKORC1 - 1639G > A với liều thuốc<br /> acenocoumarol ở nhóm nghiên cứu<br /> Tuổi và<br /> VKORC1 - 1639G > A<br /> <br /> ≤ 50<br /> <br /> > 50<br /> <br /> n(%)<br /> <br /> Liều thuốc acenocoumarol (mg/<br /> tuần) X ± SD<br /> <br /> GG (1)<br /> <br /> 3(1,72)<br /> <br /> 18,5 ± 2,5<br /> <br /> GA (2)<br /> <br /> 9(5,17)<br /> <br /> 18,83 ± 4,96<br /> <br /> AA (3)<br /> <br /> 63(36,21)<br /> <br /> 12,18 ± 4,03<br /> <br /> GA (4)<br /> <br /> 12(6,90)<br /> <br /> 13,75 ± 5,08<br /> <br /> AA (5)<br /> <br /> 87(50)<br /> <br /> 10,91 ± 3,82<br /> <br /> p<br /> <br /> p(1-5) < 0,05<br /> p(2-3) < 0,01<br /> p(2-4) < 0,05<br /> p(2-5) < 0,01<br /> <br /> Bệnh nhân trên 50 tuổi có kiểu gen đồng hợp đột biến (AA) chiếm tỷ lệ cao nhất 50%, liều<br /> thuốc acenocoumarol trung bình ở nhóm này thấp hơn có ý nghĩa so với nhóm bệnh nhân dưới<br /> 50 tuổi mang kiểu gen đồng hợp kiểu dại (GG) và dị hợp (GA).<br /> <br /> IV. BÀN LUẬN<br /> Nghiên cứu được tiến hành trên 174 bệnh<br /> <br /> Một số yếu tố lâm sàng và môi trường bao<br /> <br /> nhân sau thay van tim cơ học đang dùng<br /> <br /> gồm tuổi tác, giới tính, chỉ số BMI, lượng<br /> vitamin K có trong thức ăn, thuốc kèm theo và<br /> <br /> thuốc chống đông acenocoumarol có chỉ số<br /> INR từ 2,0 - 3,5, thay đổi liều thuốc chống<br /> <br /> tuân thủ chế độ thuốc của bệnh nhân góp<br /> phần 12 - 20% vào biến liều thuốc chống đông<br /> <br /> đông không quá 20% trong 3 tháng liên tiếp .<br /> Kết quả cho thấy tuổi trung bình của nhóm<br /> <br /> [5]. Khi xét về mối liên quan giữa một số yếu<br /> tố lâm sàng với liều thuốc chống đông chúng<br /> <br /> nghiên cứu là 50,53 ± 9,07, trong đó bệnh<br /> nhân trên 50 tuổi chiếm đa số với 56,9%. Chỉ<br /> <br /> tôi thấy rằng liều thuốc acenocoumarol trung<br /> <br /> số BMI trung bình của nhóm nghiên cứu là<br /> <br /> bình ở bệnh nhân trên 50 tuổi là 11,25 ± 4,07<br /> mg/tuần thấp hơn có ý nghĩa so với nhóm<br /> <br /> 21,33 ± 2,73, trong đó bệnh nhân có thể trạng<br /> béo chiếm 24,71%. Liều thuốc acenocoumarol<br /> <br /> bệnh nhân dưới 50 tuổi là 13,23 ± 4,74 mg/<br /> tuần. Kết quả này phù hợp với một số tác giả<br /> <br /> trung bình của nhóm nghiên cứu là 12,10 ±<br /> 4,46 mg/tuần, kết quả này thấp hơn so với<br /> <br /> khi cho rằng hoạt động của hệ thống enzym<br /> cytochrome (P450) giảm dần theo tuổi dẫn<br /> <br /> một số nghiên cứu trên thế giới như của<br /> <br /> đến sự giảm chuyển hóa và đào thải thuốc ra<br /> <br /> Sahgal tại Ấn Độ năm 2015 với liều thuốc<br /> trung bình là 17,5mg/tuần, sự khác biệt này do<br /> <br /> khỏi cơ thể. Nghiên cứu của tác giả Pop và<br /> cộng sự năm 2013 đã tìm thấy mối tương<br /> <br /> các yếu tố lâm sàng và di truyền ảnh hưởng<br /> tới liều thuốc giữa các chủng tộc [4].<br /> <br /> quan nghịch giữa tuổi và liều thuốc chống<br /> đông acenocoumarol (r = −0.339, p < 0,001)<br /> <br /> 140<br /> <br /> TCNCYH 117 (1) - 2019<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2