intTypePromotion=1
ADSENSE

Khả năng đối kháng của nấm Trichoderma với nấm Corticium salmonicolor gây bệnh nấm hồng trên cây cao su

Chia sẻ: Đặng Thị Tràn | Ngày: | Loại File: PDF | Số trang:6

28
lượt xem
2
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết Khả năng đối kháng của nấm Trichoderma với nấm Corticium salmonicolor gây bệnh nấm hồng trên cây cao su trình bày Kết quả thí nghiệm cho thấy khả năng đối kháng mạnh của các chủng nấm Trichoderma với nấm C. salmonicolor khi hiệu suất đối kháng đạt 100% chỉ sau 7 ngày nuôi cấy,... Mời các bạn cùng tham khảo.

Chủ đề:
Lưu

Nội dung Text: Khả năng đối kháng của nấm Trichoderma với nấm Corticium salmonicolor gây bệnh nấm hồng trên cây cao su

TDMU,<br /> số 2 (27)<br /> 2016<br /> T p ch Khoa<br /> h c–TDMU<br /> ISSN: 1859 - 4433<br /> <br /> Khả năng đốiốkháng<br /> nấmTháng<br /> Trichoderma...<br /> 2(27) của<br /> – 2016,<br /> 4 – 2016<br /> <br /> TRÊN CÂY CAO SU<br /> Tr<br /> <br /> ng<br /> <br /> i h c Thủ D u M t<br /> <br /> Ó<br /> Ắ<br /> Tr n m i tr ng<br /> , khảo sát khả năng đối kháng của 14 chủng nấm Trichoderma<br /> đ c ph n p t i nh ng v ng n ng nghi p t nh<br /> nh D ng v i nấm orticium<br /> sa monico or g<br /> nh nấm h ng tr n c cao su. K t quả th nghi m cho thấ khả năng<br /> đối kháng m nh của các chủng nấm Trichoderma v i nấm . sa monico or khi hi u suất<br /> đối kháng đ t 100 ch sau 7 ng nu i cấ . Chủng Tr12 s phong ph trong c ch đối<br /> kháng nấm nh đ đ c ch n đ đ nh danh ng ph ng pháp sinh h c ph n t . K t quả<br /> chủng Tr12 c tr nh t 28 rRNA t ng đ ng v i tr nh t 28 r<br /> của chủng<br /> Trichoderma har ianum K 01 99 .<br /> : đối kháng, ph n p, nấm h ng, cao su<br /> 1. MỞ Ầ<br /> Trichoderma<br /> b<br /> ơ<br /> :<br /> ỡ<br /> à<br /> [4][10]<br /> cao su (Hevea brasilensis)<br /> Corti[12][14]<br /> cium salmonicolor<br /> là b<br /> à b<br /> q<br /> ứ<br /> là l<br /> là<br /> ,<br /> ă<br /> Trichoderma<br /> l<br /> –<br /> C. salmonicolor<br /> b<br /> – 70%,<br /> ơ<br /> b<br /> là<br /> ề<br /> l<br /> ,<br /> 2. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN<br /> à<br /> V<br /> CỨU<br /> ử<br /> l<br /> à l<br /> ỉ<br /> ở<br /> x<br /> 2.1. Đối tượng ng iên cứu<br /> ứ<br /> ỏ<br /> −1<br /> Tricoderma<br /> à<br /> là<br /> l<br /> ơ<br /> b<br /> [1 ].<br /> −<br /> Corticium salmonicolor<br /> Sử<br /> Trichoderma<br /> b<br /> l<br /> b<br /> ự<br /> là<br /> ầ<br /> b<br /> à à<br /> q Trichoderma<br /> 2.2. P ương p áp ng iên cứu<br /> là<br /> ề<br /> h ng pháp ph n<br /> p nấm<br /> l<br /> b<br /> ũ<br /> Trichoderma:<br /> Phytophthora, Fusarium,<br /> −<br /> l<br /> Trichoderma spp. bằ<br /> Rhizoctonia, Colletotrichum, Corticium…<br /> ẫ<br /> l à<br /> Q<br /> ứ<br /> ữ<br /> ă ầ<br /> 56<br /> <br /> TDMU, số 2 (27) – 2016<br /> <br /> gu ễn nh Dũng<br /> <br /> ẫ<br /> ở ỉ<br /> <br /> ơ<br /> <br /> kháng. Vị<br /> 1<br /> à<br /> xứ<br /> q<br /> −<br /> x<br /> ị<br /> Trichoderma<br /> salmonicolor bằ c<br /> ứ<br /> :<br /> <br /> l ã<br /> S<br /> <br /> ẫ l<br /> [5][6][7][9][10].<br /> −<br /> ẫ<br /> là<br /> Trichodema<br /> à<br /> à<br /> ị<br /> bằ<br /> ơ<br /> à<br /> l<br /> Trichoderma<br /> à<br /> ứ<br /> [1][2][3][6][14].<br /> h ng pháp khảo sát khả năng đối<br /> kháng của nấm Trichoderma v i nấm<br /> Corticium salmonocolor:<br /> −<br /> bị<br /> Trichoderma<br /> t<br /> bằ<br /> 1 l<br /> ị<br /> ứ<br /> 8<br /> bà ử<br /> 1<br /> ll<br /> ị<br /> q<br /> ề<br /> ở<br /> à<br /> −<br /> nicolor bằ<br /> <br /> bị<br /> <br /> à<br /> −<br /> <br /> à<br /> Trichoderma<br /> <br /> [14].<br /> q<br /> ứ<br /> <br /> Corticium<br /> q<br /> <br /> , H:<br /> q ứ<br /> ,<br /> :<br /> b<br /> l<br /> b<br /> ứ<br /> : b<br /> l<br /> b<br /> ử<br /> V q<br /> :<br /> +++ : H ≥<br /> trung bìn ++ :<br /> ≤ H ≤ 9<br /> +:<br /> ≤H≤ 9 ,k<br /> kháng (- : H ≤ 19<br /> nh danh ng ph ng pháp sinh h c<br /> ph n t : ẫ<br /> Trichoderma<br /> ă<br /> ử ị<br /> bằ<br /> ử bằ<br /> ơ<br /> ự<br /> S<br /> à<br /> ứ trên<br /> BLAST SEARCH.<br /> 2.2.4. h ng pháp<br /> số i u<br /> l<br /> ứ<br /> à xử l bằ<br /> ầ<br /> ề<br /> x l<br /> 1 à ầ<br /> ề<br /> S<br /> centurion XV.<br /> <br /> C. salmol<br /> à<br /> ở<br /> <br /> q<br /> <br /> é<br /> <br /> ă<br /> <br /> C. salmonicolor<br /> bằ<br /> ắ<br /> ữ<br /> bằ<br /> ứ<br /> C. salmonicolor<br /> C.<br /> salmonicolor<br /> l<br /> 1<br /> petri) và Trichoderma<br /> trung gian ã<br /> bị<br /> ắ l<br /> ứ<br /> à<br /> q<br /> <br /> 3.<br /> <br /> Ế Q<br /> <br /> Ê<br /> <br /> Ứ<br /> <br /> 3. .<br /> derma<br /> <br /> Trichoẫ<br /> <br /> l<br /> (b g 1).<br /> <br /> ng 1. Thống k các chủng Trichoderma ph n<br /> <br /> l<br /> <br /> à<br /> ã<br /> Trichoderma<br /> <br /> 1<br /> pt i<br /> <br /> nh D<br /> <br /> ng<br /> <br /> Stt<br /> 1<br /> <br /> Tr1, Tr3<br /> <br /> ân Uyên<br /> <br /> 2<br /> <br /> 2<br /> <br /> Tr2, Tr11<br /> <br /> 2<br /> <br /> 3<br /> <br /> Tr4<br /> <br /> 1<br /> <br /> 4<br /> <br /> Tr5<br /> <br /> 5<br /> <br /> Tr8, Tr12<br /> <br /> 1<br /> su<br /> <br /> 57<br /> <br /> 2<br /> <br /> TDMU, số 2 (27) – 2016<br /> <br /> Khả năng đối kháng của nấm Trichoderma...<br /> <br /> 6<br /> <br /> Tr9<br /> <br /> 7<br /> <br /> Tr6, Tr14<br /> <br /> 1<br /> <br /> 8<br /> <br /> Tr7, Tr10<br /> <br /> 2<br /> <br /> 9<br /> <br /> Tr13<br /> <br /> 1<br /> <br /> An Linh ,<br /> <br /> 3.2.<br /> o sá k<br /> của Trichoderma đ<br /> C. salmonicolor<br /> −B<br /> <br /> là<br /> à<br /> <br /> −Q<br /> <br /> l<br /> <br /> ă<br /> <br /> ứ<br /> <br /> đối k áng<br /> đ c i<br /> <br /> 2<br /> <br /> à<br /> Trichoderma<br /> <br /> color<br /> ngày… à<br /> kháng 100%<br /> l<br /> ứ<br /> <br /> 2.2.2.<br /> C. salmonicolor.<br /> l b<br /> b<br /> ở<br /> <br /> C. salmonià<br /> à 7<br /> <br /> ứ<br /> Trichoderma<br /> C. salmonicolor trong<br /> <br /> ng 2. Khả năng đối kháng của nấm Trichoderma v i nấm C. salmonicolor<br /> 3 ngày<br /> t ứ<br /> <br /> Dtt<br /> (Tb, cm)<br /> <br /> NT-Tr1<br /> <br /> 1.38 ± 0.28cde<br /> de<br /> <br /> NT-Tr2<br /> NT-Tr3<br /> NT-Tr4<br /> NT-Tr5<br /> NT-Tr6<br /> NT-Tr7<br /> NT-Tr8<br /> NT-Tr9<br /> NT-Tr10<br /> NT-Tr11<br /> NT-Tr12<br /> NT-Tr13<br /> NT-Tr14<br /> Dđ<br /> <br /> 1.48 ± 0.13<br /> 1.5 ± 0.1e<br /> 1.1 ± 0.1ab<br /> 1.25 ± 0.09bcd<br /> 1.21± 0.2bc<br /> 1.42± 0.1cde<br /> 1.28 ± 0.14bcde<br /> 1.39 ± 0.08cde<br /> 1.47 ± 0.16de<br /> 0.97 ± 0.06a<br /> 0.9 ± 0.17a<br /> 0.93 ± 0.12a<br /> 1.37 ± 0.15cde<br /> 2.22 ± 0.13f<br /> <br /> 5 ngày<br /> <br /> H<br /> (Tb, %)<br /> 38.03 ±<br /> 12.52bcd<br /> 33.49 ± 5.72b<br /> 32.73 ± 4.55b<br /> 50.91 ± 4.55ef<br /> 44.09 ± 3.93cde<br /> 45.76 ± 9.15de<br /> 36.52 ± 4.73bcd<br /> 42.88 ± 6.21bcde<br /> 37.88 ± 3.53bcd<br /> 33.94 ± 7.06bc<br /> 56.97 ± 2.63f<br /> 60 ± 7.88f<br /> 58.48 ± 5.25f<br /> 38.64 ± 6.99bcd<br /> 0.00a<br /> <br /> Dtt<br /> (Tb, cm)<br /> <br /> 7 ngày<br /> H%<br /> (Tb, %)<br /> <br /> 1.5 ± 0.26cde<br /> <br /> 47.37 ± 9.28cde<br /> <br /> e<br /> <br /> c<br /> <br /> 1.59 ± 0.13<br /> 1.84 ± 0.06f<br /> 1.23 ± 0.06b<br /> 1.38 ± 0.08bcd<br /> 1.33 ± 0.15bc<br /> 1.47 ± 0.06cde<br /> 1.4 ± 0.1bcde<br /> 1.45 ± 0.05cde<br /> 1.57 ± 0.15de<br /> 1.03 ± 0.11a<br /> 0.9 ± 0.17a<br /> 0.97 ± 0.06a<br /> 1.53 ± 0.06de<br /> 2.85 ± 0.05g<br /> <br /> 44.21 ± 4.48<br /> 35.55 ± 1.93b<br /> 56.72 ± 2.02f<br /> 51.46 ± 2.68def<br /> 53.22 ± 5.36ef<br /> 48.42 ± 2.13cde<br /> 50.88 ± 3.51cdef<br /> 49.12 ± 1.76cde<br /> 45.03 ± 5.36cd<br /> 63.74 ± 4.05g<br /> 68.42 ± 6.07g<br /> 66.08 ± 2.03g<br /> 46.2 ± 2.03cd<br /> 0.00a<br /> <br /> Dtt<br /> (Tb, cm)<br /> <br /> H%<br /> (Tb, %)<br /> <br /> 0a<br /> <br /> 100c<br /> <br /> a<br /> <br /> 0<br /> 2.13 ± 0.15b<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 0a<br /> 4.77 ± 0.25c<br /> <br /> 100c<br /> 57.27 ± 3.2b<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 100c<br /> 0.00a<br /> <br /> * ác ch cái trong c ng 1 c t cho thấ s khác nhau gi a<br /> các nghi m th c th nghi m v i đ tin c 95%.<br /> <br /> q<br /> <br /> à<br /> <br /> q<br /> Trichoderma ã<br /> 1<br /> l<br /> l<br /> C. salmonicolor<br /> q<br /> 1<br /> à<br /> C. salmonicolor<br /> Trichoderma ẫ<br /> b<br /> 11<br /> 1<br /> ữ<br /> ă<br /> à<br /> ơ<br /> ữ<br /> à<br /> ã<br /> 60% à<br /> 7<br /> à<br /> ã<br /> 1<br /> H<br /> 1.<br /> <br /> b<br /> ă<br /> Trichoderma<br /> <br /> C.<br /> ă<br /> <br /> salmonicolor<br /> ầ<br /> 71<br /> (<br /> ă<br /> à ỉ<br /> <br /> à<br /> ă<br /> b<br /> 1<br /> <br /> ă<br /> <br /> à<br /> <br /> ă<br /> ă<br /> <br /> 1 1<br /> b<br /> à1<br /> <br /> ă<br /> ă<br /> ă<br /> <br /> Và<br /> <br /> 7<br /> 58<br /> <br /> 1 1<br /> <br /> ă<br /> <br /> 1 là<br /> l<br /> à<br /> H><br /> <br /> TDMU, số 2 (27) – 2016<br /> <br /> gu ễn nh Dũng<br /> ứ<br /> <br /> - 1 là<br /> b<br /> Nguyên nhân<br /> 1 b<br /> ă<br /> b<br /> bằ<br /> ơ<br /> <br /> là<br /> <br /> ỡ<br /> <br /> ă<br /> à<br /> à ở<br /> 1 ã là<br /> C. salmonicolor<br /> ự<br /> bằ<br /> ơ<br /> q<br /> à ũ<br /> à<br /> l<br /> bà<br /> là Th-L-AAO<br /> <br /> l<br /> n 1. Khả năng đối kháng m nh v i nấm<br /> . sa monico or của 3 chủng Tr11, Tr12<br /> v Tr13<br /> <br /> ề<br /> 11<br /> <br /> ỡ<br /> b<br /> <br /> b<br /> 1<br /> <br /> ơ<br /> <br /> à 1<br /> Tuy nhiên,<br /> à à<br /> à<br /> <br /> salmonicolor<br /> Tr11, NT-Tr12, NT-Tr13 ta<br /> <br /> ứ<br /> ỉ<br /> <br /> NT-Tr11<br /> <br /> A<br /> <br /> ă là<br /> Trichoderma harzianum ETS 323<br /> ứ<br /> ă<br /> Botrytis cinerea<br /> ề<br /> vitro.<br /> <br /> Dtt<br /> C.<br /> ở<br /> <br /> NT-Tr12<br /> <br /> B<br /> <br /> A<br /> <br /> à<br /> <br /> NT-Tr13<br /> <br /> B<br /> <br /> A<br /> <br /> B<br /> <br /> n 2. Khả năng đối kháng của a chủng Tr11, Tr12 v Tr13 v i nấm . sa monicolor<br /> sau 7 ng . : V tr đ t nấm Trichoderma; : v tr đ t nấm . sa monico or<br /> <br /> a<br /> á si<br /> V<br /> ữ<br /> q<br /> ơ<br /> salmonicolor<br /> 1<br /> bằ<br /> 3.3.<br /> <br /> c ủ<br /> c<br /> <br /> 2<br /> <br /> GCGGGTATTCCTACCTGATCCGAGGTCAACATTTC<br /> AGAAGTTGGGTGTTTAACGGCTGTGGACGCGCCG<br /> <br /> ề<br /> ng<br /> lự<br /> ử<br /> q<br /> 1 :<br /> <br /> 11 à<br /> ị<br /> <br /> CGCTCCCGATGCGAGTGTGCAAACTACTGCGCAG<br /> <br /> C.<br /> 1<br /> <br /> GAGAGGCTGCGGCGAGACCGCCACTGTATTTCG<br /> GAGACGGCCACCGCCAAGGCAGGGCCGATCCCC<br /> AACGCCGACCCCCCGGAGGGGTTCGAGGGTTGA<br /> <br /> ự<br /> <br /> AATGACGCTCGGACAGGCATGCCCGCCAGAATAC<br /> TGGCGGGCGCAATGTGCGTTCAAAGATTCGATGA<br /> <br /> GTCCCGTTCCAGGGAACTCGGGCGGCACCT<br /> <br /> TTCACTGAATTCTGCAATTCACATTACTTATCGCAT<br /> <br /> CACCAAAAGCATCCTCTACAAATTACAACTCGGGC<br /> <br /> TTCGCTGCGTTCTTCATCGATGCCAGAACCAAGA<br /> <br /> CCTAGGGACCAGATTTCAAATTTGAGCTGTTGCCG<br /> <br /> GATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAAC<br /> <br /> CTTCACTCGCCGTTACTGGGGCAATCCCTGTTGG<br /> <br /> GCCTACGAGAGGCGCCGAGAAGGCTCAGATTATA<br /> <br /> TTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCA<br /> <br /> AAAAAACCCGCGAGGGGGTATACAATAAGAGTTTT<br /> <br /> 59<br /> <br /> TDMU, số 2 (27) – 2016<br /> <br /> Khả năng đối kháng của nấm Trichoderma...<br /> −K<br /> <br /> ă<br /> Trichoderma<br /> salmonicolor<br /> b<br /> cao su (Hevea brasilensis<br /> 1 1<br /> ă<br /> <br /> GGTTGGTCCTCCGGCGGGCGCCTTGGTCCGGGG<br /> TGCGACGCACCCGGGGCAGAGATCCCGCCGAGG<br /> CAACAGTTTGGTAACGTTCACATGGGGTTTGGGA<br /> GTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCA<br /> CCAACGGAGACCTTGTTACGACTTTTACTTCCTCT<br /> AAATGACCGAGTTTGGAGAGCTTTCCGGCCCTGA<br /> <br /> 1<br /> <br /> GTGGTAGTTGCCCACCTC<br /> <br /> q<br /> <br /> à<br /> <br /> ứ<br /> <br /> BLAST SEARCH<br /> 1<br /> ự S<br /> ơ<br /> 99<br /> ự S<br /> Trichoderma harzia-num CKP01.<br /> 4.<br /> <br /> Ế<br /> <br /> (<br /> <br /> l<br /> <br /> q<br /> <br /> là<br /> <br /> ỉ<br /> <br /> 7<br /> 1<br /> <br /> ă<br /> l<br /> − Gử<br /> <br /> 1<br /> <br /> ử<br /> BLAST SEARCH là<br /> 1<br /> ơ<br /> ự S<br /> harzianum CKP01.<br /> <br /> Ậ<br /> <br /> − P<br /> Trichoderma<br /> <br /> 1<br /> C.<br /> <br /> 1<br /> ắ Tân Uyên, Bàu Bàng<br /> ơ ).<br /> <br /> ị<br /> q<br /> <br /> bằ<br /> ứ<br /> ự<br /> S<br /> 99<br /> Trichoderma<br /> <br /> ANTAGONISM OF TRICHODERMA SPP. AGAINST CORTICIUM<br /> SALMONICOLOR OF PINK DISEASE IN RUBBER TREE<br /> Nguyen Anh Dung<br /> ABSTRACT<br /> On the PGA culture medium, the research investigated the antagonism of 14<br /> Trichoderma strains, isolated in agricultural lands of Binh Duong province, against<br /> Corticium salmonicolor of pink disease in rubber tree. The in-vitro essays indicated that<br /> almost Trichoderma strains, especially Tr12 (the 28S rRNA sequence is similar to<br /> Trichoderma harzianum CKP01 at 99%) with various of antagonistic mechanisms, had<br /> strongly antagonised Corticium salmonicolor with 100% of antagonistic efficiency after 7<br /> days of incubation.<br /> À<br /> [1] Nguy<br /> ũ<br /> Vă<br /> ơ Vă H<br /> H<br /> Hằ<br /> à<br /> ị<br /> ơ<br /> ị H à Hà<br /> H à Y<br /> ữ<br /> Vă ắ H à Vă<br /> Vinh (2012), Vi sinh v t h c, ph n 1, th gi i vi sinh v t,<br /> à ỹ<br /> [2]<br /> ũ<br /> à<br /> (1979), M t số ph ng pháp nghi n c u vi sinh, t p 2 & 3,<br /> à ỹ<br /> [3]<br /> H Vă (2000), Vi nấm d ng trong c ng ngh sinh h c,<br /> [4] Nguy Vă<br /> nh và cs (2007), Giáo trình bi n pháp sinh h c bảo v th c v t, NXB Nông Nghi p.<br /> [5] ầ<br /> Hà,<br /> ị<br /> H à (2012), Khả năng đối kháng của nấm Trichoderma v i<br /> nấm nh h i c tr ng c erotium ro fsii trong điều ki n Invitro,<br /> c<br /> H ,<br /> 7<br /> 9 – 55.<br /> [6]<br /> ứ<br /> ịH ề<br /> Á<br /> (2003), Th nghi m c ng ngh sinh<br /> h c (t p 2) – Th nghi m vi sinh v t h c, NXB<br /> Q<br /> TP.HCM.<br /> <br /> 60<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2