intTypePromotion=1
ADSENSE

Kết quả xác định bệnh đốm chết hoại hình nhẫn gây hại thuốc lá

Chia sẻ: Quenchua5 Quenchua5 | Ngày: | Loại File: PDF | Số trang:7

28
lượt xem
1
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết nghiên cứu dựa trên cây thuốc lá đã thu thập được 15 mẫu bệnh với đầu bị vẹo sang một bên và vòng tròn hoại tử trên lá ở cây thuốc lá đang phát triển ở Bắc Giang; triệu chứng tại chỗ hoại tử ở Bắc Kạn và Cao Bằng; cong lá và vẹo đầu sang một bên ở Tây Ninh để chẩn đoán tại Trung tâm nghiên cứu bệnh lý thực vật nhiệt đới - Đại học Nông nghiệp quốc gia Việt Nam.

Chủ đề:
Lưu

Nội dung Text: Kết quả xác định bệnh đốm chết hoại hình nhẫn gây hại thuốc lá

  1. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 (2) Ti ng Anh anthracis" [Investigations into bacteria: V. The etiology 4. Ahmed D.B, Chaieb I., Salah K.B., Boukamcha of anthrax, based on the ontogenesis of Bacillus H., Jannet H.B., Mighri Z. and Daami-Remadi M.,2012. anthracis] (PDF). Cohns Beitrage zur Biologie der Antibacterial and antifungal activities of Cestrum parqui Pflanzen (in German), 2 (2): 277–310. saponins: possible interaction with membrane sterols, 9. Krishna Kumar; Singh, D. R.; Natarajan International Research Journal of Plant Science, 3 (1): Amaresan; Kuttum Madhuri, 2012. Isolation and 001-007. pathogenicity of Colletotrichum spp. causing 5. Banett H.L and Hunter B.B., 1998. Illustrated anthracnose of Indian mulberry (Morinda citrifolia) in genera of imperfect fungi. The American tropical islands of Andaman and Nicobar, India, Phytopathological Society, St.Paul, Minnesota. 218. Phytoparasitica, 40 (5): 485-491. 6. Burgess L.W., Knight T.E., Tesoriero L. and 10. Shi Xuerong, Chi Peikun, 1988. Identification of Phan H. T., 2008. Diagnostic manual for plant the pathogen causing wild disease of the medicinal diseases in Vietnam. ACIAR Monograph, 129: 210. herb Indian mulberry (Morinda officinalis How.), Acta 7. Firdousi, S. A. and Khan, T. A.,2015. Two new Phytopathologica Sinica. 04. fungal diseases of trees of manudevi forest of Jalgaon, 11. Sneh B, Burpee L. Ogoshi A.,1991. district. Flora and Fauna (Jhansi), 21( 2): 158-160. Identification of Rhizoctonia species. St Paul, Mn, 8. Koch, R.,1876. Untersuchungen über Bakterien: USA: APS press. V. Die Ätiologie der Milzbrand-Krankheit, begründet auf die Entwicklungsgeschichte des Bacillus Phản biện: TS. Trịnh Xuân Hoạt KẾT QUẢ XÁC ĐỊNH BỆNH ĐỐM CHẾT HOẠI HÌNH NHẪN GÂY HẠI THUỐC LÁ Results of Diagnotic Necrotic Ring Spot Disease on Tobacco plant 1 2 Nguyễn Văn Chín và Hà Vi t Cƣờng Ngày nhận bài: 06.9.2019 Ngày chấp nhận 26.9.2019 Abstract In 2019, Tobacco instutute collected 15 disease samples with crooked tip to the side and necrotic ringspot on leaves in growing tobacco Bac Giang; necrotic spot symptom in Bac Kan and Cao Bang; leaf curl and crooked tip to the side in Tay Ninh to diagnose in Research centre for Tropical plant pathology – Vietnam national university of Agriculture. Results of diagnosis showed that all disease samples in Bac Giang were caused by Tomato necrotic ringspot virus (TNRV). Virus belong to Tospovirus genus and is spread by insect – thrips. TNRV is a virus species that is detected the first times on tobacco plant in Vietnam. Other disease samples of Bac Kan, Cao Bang and Tay Ninh provinces didn‟t infected with Tospovirus. Keywords: Tobacco, virus, Tospovirus, Tomato necrotic ringspot virus, TNRV. * 1. ĐẶT VẤN ĐỀ tăng dần ở các tỉnh phía Bắc, đặc biệt gây hại nặng tại Chi nhánh Viện Thuốc lá Bắc Giang Trong 3 năm gần đây, cây thuốc lá có triệu trong vụ xuân 2019. Như năm 2017, chúng xuất chứng đốm chết hoại hình nhẫn có chiều hướng hiện rải rác trên đồng ruộng với mức độ gây hại không đáng kể; Đến năm 2018, bệnh xuất hiện 1. Viện Thuốc lá phổ biến với tỷ lệ bệnh 12,5%; Và năm 2019, 2. Học Viện Nông nghiệp Việt Nam chúng gây hại rất nặng với tỷ lệ bệnh dao động 39
  2. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 60 - 100% và nhiều ruộng thuốc lá bị tiêu hủy nhân gây bệnh và phương thức lan truyền của hoàn toàn. Kết quả điều tra tại Chi nhánh Viện chúng là rất cần thiết trong sản xuất thuốc lá ở Thuốc lá tại Bắc Giang cho thấy bệnh lây lan rất Việt Nam, là cơ sở để đưa ra các biện pháp nhanh, từ thời điểm điều tra với tỷ lệ bệnh 10% phòng trừ bệnh hiệu quả và an toàn. đến giai đoạn ruộng bị nhiễm bệnh 80 - 100% chỉ 2. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU diễn ra khoảng 20 - 25 ngày, mặc dù đã sử dụng tất cả các biện pháp phòng trừ như vệ sinh tiêu - Thu thập mẫu bệnh: Mẫu cây bệnh được hủy cây bệnh, phun phòng trừ môi giới,… đánh cả gốc đem về trồng trong nhà lưới của (Nguyễn Văn Chín, 2019) Trung tâm nghiên cứu Bệnh cây nhiệt đới - Học Để xác định nguyên nhân gây bệnh, Viện Viện Nông nghiệp Việt Nam làm nguồn bệnh Thuốc lá đã kết hợp với Trung tâm nghiên cứu chẩn đoán. Bệnh cây nhiệt đới - Học Viện Nông nghiệp Việt - AND tổng số được chiết tách từ mô lá bằng Nam tiến hành kiểm tra đồng ruộng thuốc lá, phương pháp CTAB (Cetyl trimethyl ammonium bước đầu dựa trên triệu chứng đốm chết hoại bromide) theo mô tả của Doyle & Doyle (1987). hình nhẫn đã nghi ngờ bệnh có thể do Sau đó, sản phẩm chiết tách được kiểm tra bằng Tospovirus gây ra. Khi kiểm tra trên cây thuốc lá, điện di trên gel agarose 1%. bọ trĩ xuất hiện khá nhiều. - Cặp mồi phản ứng được sử dụng để phát hiện Các virus thuộc chi Tospovirus gây thiệt hại virus và giải trình tự gen là Tospo-F3 và Tospo-R3. nghiêm trọng cho nhiều loại cây trồng trên thế Nó phát hiện đặc điểm gen N của Tospovirus nhóm giới. Trong đó, tại Mỹ có 5 loài Tospovirus gây I và II với kích thước xấp xỉ 600 bp. hại là Tomato spotted wilt virus (TSWV), - Giải trình tự và phân tích trình tự gen: Impatiens necrotic spot virus (INSV), Iris yellow Sản phẩm PCR, RT-PCR sau khi tinh chiết từ spot virus (IYSV), Groundnut ringspot virus gel agarose được giải trình tự trực tiếp bằng mồi (GRSV) và Tomato chlorotic spot virus (TCSV) PCR, RT-PCR (Tospo-F3 và Tospo-R3). (Scott Adkins et al., 2013). Tại Thái Lan (năm Trình tự gen được phân tích bằng các phần 2008) và Trung Quốc (2014) đã phát hiện virus mềm thông dụng như: BLAST, CLUSTAL 2.0, mới Tospovirus gây hại trên cây cà chua là MEGA7.0. Tomato necrotic ringspot virus (TNRV) (Yueyan 3. KẾT QUẢ NGHIÊN CỨU VÀ THẢO LUẬN Yin et al., 2014). Tospovirus được truyền trên 3.1 K t quả chạy RT-PCR đồng ruộng từ cây này sang cây khác qua một số loài bọ trĩ. Trong đó, ba loài bọ trĩ, Frankliniella Vụ xuân 2019, Viện thuốc lá kết hợp với occidentalis (Western flower thrips), F. fusca Trung tâm nghiên cứu Bệnh cây nhiệt đới – Học (Tobacco thrips) và Thrips tabaci (onion thrips) là viện Nông nghiệp Việt Nam tiến hành kiểm tra những vectơ truyền virus chủ yếu tại Mỹ. Bọ trĩ bệnh gây hại thuốc lá tại Bắc Giang, dựa vào chỉ có thể truyền bệnh nếu chúng hấp thụ virus triệu chứng đốm chết hoại hình nhẫn trên lá và trong các giai đoạn phát triển của ấu trùng. Cả ấu bọ trĩ xuất hiện trên cây (hình 1), bước đầu nghi trùng và trưởng thành đều có thể truyền được ngờ bệnh có thể là do Tospovirus gây ra. Để virus cho cây (Scott Adkins et al., 2013).. xác định có phải Tospovirus hay không, năm Phổ ký chủ của Tospovirus thay đổi tùy theo mẫu thuốc lá thu thập tại Bắc Giang gồm BG1, loài gây hại. Tomato spotted wilt virus (TSWV) có BG6, BG9, BG10 và BG11 với triệu chứng đốm phổ ký chủ rộng nhất, gây hại khoảng 800 loài hình nhẫn chết hoại điển hình được kiểm tra RT cây trồng và trên 80 họ. Trong đó, cây thuộc họ - PCR với cặp mồi đặc hiệu Tospovirus là cà và hoa cúc bị nhiễm nặng nhất. Một số cây bị Tospo-F3 và Tospo-R3. Ngoài ra, chúng tôi nhiễm TSWV nặng như: Cây cà chua, ớt, rau xà cũng kiểm tra các mẫu thuốc lá thu thập tại Cao lách, khoai tây, đu đủ, đậu phụng, thuốc Bằng, Bắc Kạn có triệu chứng vẹo ngọn, khảm lá,…(Scott Adkins et al., 2005). và đốm chết hoại trên lá và Tây Ninh là triệu Như vậy, để phòng trừ bệnh đốm chết hoại chứng ne ngọn (hình 2) có nhiễm Tospovirus hình nhẫn trên cây thuốc lá, việc xác định nguyên hay không, các mẫu này cũng được kiểm tra RT 40
  3. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 - PCR cùng. Kết quả kiểm tra RT - PCR tại bảng gen nhằm xác định chính xác danh tính virus. 1 và hình 1 cho thấy: + 10 mẫu thuốc lá thu tại Tây Ninh, Cao Bằng + Tất cả 5 mẫu thuốc lá thu thập tại Bắc và Bắc Kạn đều phản ứng âm tính với cặp mồi Giang đều nhiễm Tospovirus do chúng dương Tospo-F3 và Tospo-R3. Điều đó chứng tỏ các tính với cặp mồi Tospo-F3 và Tospo-R3. Ba mẫu mẫu bệnh này đều không nhiễm virus thuộc chi BG1, BG9 và BG11 đã được chọn để giải trình tự Tospovirrus. Bảng 1. RT-PCR phát hiện Tospovirus trên thuốc lá năm 2019 Tospo- Giải trình TT Mẫu Địa điểm Thời gian Triệu chứng F3/-R3 tự 1 BG1 Bắc Giang 27/2/2019 Đốm hình nhẫn chết hoại + + 2 BG6 Bắc Giang 27/2/2019 Đốm hình nhẫn chết hoại + 3 BG9 Bắc Giang 27/2/2019 Đốm hình nhẫn chết hoại + + 4 BG10 Bắc Giang 27/2/2019 Đốm hình nhẫn chết hoại + 5 BG11 Bắc Giang 27/2/2019 Đốm hình nhẫn chết hoại + + 6 TN1 Tây Ninh 6/5/2019 Xoăn cuốn lá - 7 TN2 Tây Ninh 6/5/2019 Xoăn cuốn lá - 8 TN3 Tây Ninh 6/5/2019 Xoăn cuốn lá - 9 TN4 Tây Ninh 6/5/2019 Xoăn cuốn lá - 10 TN5 Tây Ninh 6/5/2019 Xoăn cuốn lá - 11 BK6 Bắc Kạn 6/5/2019 Khảm, đốm chết hoại lá - 12 TN7 Tây Ninh 6/5/2019 Xoăn cuốn lá - 13 CB8 Cao Bằng 6/5/2019 Khảm, đốm chết hoại lá - 14 CB9 Cao Bằng 6/5/2019 Khảm, đốm chết hoại lá - 15 TN10 Tây Ninh 6/5/2019 Xoăn cuốn lá - Hình 1. A: Triệu chứng vẹo ngọn và đốm ch t hoại hình nhẫn; B: Bọ trĩ gây hại thuốc lá tại Bắc Giang 41
  4. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 Hình 2. C: Triệu chứng xoăn, khảm và đốm ch t hoại tại Cao Bằng; D: Triệu chứng ne ngọn tại Tây Ninh Hình 3. RT-PCR phát hiện Tospovirrus trên thuốc lá. Danh tính mẫu đƣợc trình bày ở bảng 1 M là thang DNA 1 b (GenRuler 1 b, Fermentas). Băng sản phẩm được chỉ bằng mũi tên 3.2 Định danh Tospovirus bằng giải trình chọn để giải trình tự gen là BG1, BG9 và BG11. tự gen Các mẫu được thực hiện phản ứng RT - PCR với cặp mồi đặc hiệu Tospovirus là Tospo-F3 và - Phản ứng PCR và giải trình tự gen Tospo-R3 (Hình 4). Dựa trên kết quả RT - PCR, 3 mẫu đã được Hình 4. RT-PCR để nhân đoạn gen Tospo-F3/Tospo-R3 để giải trình tự M là thang DNA 1 b (GenRuler 1 b, Fermentas). Băng sản phẩm được chỉ bằng mũi tên 42
  5. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 Sản phẩm PCR được tinh chiết từ agarose gel và giải trình tự trực tiếp. Sau khi loại bỏ trình tự nhiễu 2 đầu, trình tự của 3 mẫu BG1, BG9 và BG11 thu được như sau: >BG1 (568 bp) CTGCTTCTTGACATTCTGaAAATAAGCAAGGGAGAAAGCTATAGGTGCCATTGCAGGGAGACT GGACAATAAAGGTAAAGGTCCACCAACACACAACATCAGCCTGGTTGCACTGGAATCGAAATTGG GAGGTACATTTAACCCATAAGCAATAACCATAGGAAGTGACATAAGTTTTGAATACATGTCTTGCT GGAGTTTTTGAGTTGTGCATTCTTCAACCATCTTTGCCATGAGAACTCTGAGTACAGCTTCAGTTC TCTTAAATGTCCATGTTTTTTCATCAGCATTATCTGAGTTTTGTGCTATCTTTTTGCCGCAAAAAAC AAACTGATTGCTCTTGCAGGCTGCAAATATCTGCTTTCTACTCTTTAGTATAGTTATTCCATTATTG AATGTAAATTTTCCGAAGATGTCCTGTTTGTTTTCATCATAAAATTTAGAAAAGCTGAATCCCGGTG TAGCTTCATCAAGCTCTATTTCAATGTCTGCTTCTCCTCCAGCTAGCAATTCCTTGATTTTCTCGTT TGACAAGTTTTTCCTAACGGTAGACATGGTGTTTACGGGA >BG9 (568 bp) CTGCTTCTTGACATTCTGaAAATAAGCAAGGGAGAAAGCTATAGGTGCCATTGCAGGGAGACT GGACAATAAAGGTAAAGGTCCACCAACACACAACATCAGCCTGGTTGCACTGGAATCGAAATTGG GAGGTACATTTAACCCATAAGCAATAACCATAGGAAGTGACATAAGTTTTGAATACATGTCTTGCT GGAGTTTTTGAGTTGTGCATTCTTCAACCATCTTTGCCATGAGAACTCTGAGTACAGCTTCAGTTC TCTTAAATGTCCATGTTTTTTCATCAGCATTATCTGAGTTTTGTGCTATCTTTTTGCCGCAAAAAAC AAACTGATTGCTCTTGCAGGCTGCAAATATCTGCTTTCTACTCTTTAGTATAGTTATTCCATTATTG AATGTAAATTTTCCGAAGATGTCCTGTTTGTTTTCATCATAAAATTTAGAAAAGCTGAATCCCGGTG TAGCTTCATCAAGCTCTATTTCAATGTCTGCTTCTCCTCCAGCTAGCAATTCCTTGATTTTCTCGTT TGACAAGTTTTTCCTAACGGTAGACATGGTGTTTACGGGA >BG11 (568 bp) CTGCTTCTTGACATTCTGaAAATAAGCAAGGGAGAAAGCTATAGGTGCCATTGCAGGGAGACT GGACAATAAAGGTAAAGGTCCACCAACACACAACATCAGCCTGGTTGCACTGGAATCGAAATTGG GAGGTACATTTAACCCATAAGCAATAACCATAGGAAGTGACATAAGTTTTGAATACATGTCTTGCT GGAGTTTTTGAGTTGTGCATTCTTCAACCATCTTTGCCATGAGAACTCTGAGTACAGCTTCAGTTC TCTTAAATGTCCATGTTTTTTCATCAGCATTATCTGAGTTTTGTGCTATCTTTTTGCCGCAAAAAAC AAACTGATTGCTCTTGCAGGCTGCAAATATCTGCTTTCTACTCTTTAGTATAGTTATTCCATTATTG AATGTAAATTTTCCGAAGATGTCCTGTTTGTTTTCATCATAAAATTTAGAAAAGCTGAATCCCGGTG TAGCTTCATCAAGCTCTATTTCAATGTCTGCTTCTCCTCCAGCTAGCAATTCCTTGATTTTCTCGTT TGACAAGTTTTTCCTAACGGTAGACATGGTGTTTACGGGA - Kết quả phân tích trình tự và cây phả hệ BG9 và BG11 đều là Tomato necrotic ringspot Phân tích trình tự cho thấy cả 3 mẫu BG1, virus (TNRV) với mức đồng nhất trình tự từ BG9 và BG11 đều đồng nhất trình tự 100% 93,3 đến 93,5%. với nhau và điều đó chứng tỏ chúng thuộc 1 Tương tự, phân tích cây phả hệ (Hình 4) loài virus. cho thấy cả 3 mẫu BG1, BG9 và BG11 đều Sử dụng phần mềm BLAST trên NCBI phân nhóm chặt trong cụm loài TNRV. Trong (National Center for Biotechnology cụm này, 3 mẫu virus thuốc lá nằm trong Information), chúng tôi đã tìm kiếm virus gần nhánh gồm các mẫu TNRV được phát hiện gũi trên Genbank đối với 3 mẫu virus BG1, thấy trên cây cà chua và cây ớt tại Việt Nam. BG9 và BG11 dựa trên trình tự thu được. Kết Các mẫu này do Trung tâm nghiên cứu Bệnh quả tìm kiếm tại bảng 2 cho thấy các mẫu virus cây nhiệt đới - Học Viện nông nghiệp Việt Nam trên GenBank gần gũi nhất đối với 3 mẫu BG1, phát hiện và chưa công bố. 43
  6. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 Bảng 2. Các mẫu virus trên GenBank gần gũi nhất đối với 3 mẫu virus BG1, BG9 và BG11 trong tìm ki m BLAST Phần trăm Mức đồng Mã Virus Viết tắt Ký chủ Quốc Gia đoạn so nhất trình tự GenBank sánh (%) (%) Tomato necrotic TNRV Cà chua Thái Lan KM887842 100 93.46 ringspot virus Tomato necrotic TNRV Cà chua Thái Lan FJ946835 100 93.46 ringspot virus Tomato necrotic TNRV Ớt Thái Lan KM887841 100 93.29 ringspot virus Tomato necrotic TNRV Cà chua Thái Lan HM113532 100 93.29 ringspot virus Tomato necrotic TNRV Cà chua Thái Lan FJ489600 100 93.29 ringspot virus thu tại Bắc Giang được đánh dấu. Như vậy, kết quả chẩn đoán đã xác định được triệu chứng đốm chết hoại hình nhẫn trên cây thuốc lá tại Bắc Giang là do Tomato necrotic ringspot virus (TNRV) gây ra. Đây là virus được phát hiện lần đầu tiên tại Thái Lan trên cây cà chua năm 2008 và mới được phát hiện thấy gần đây trên cây cà chua và cây ớt ở Việt Nam. Trên cây thuốc lá, TNRV lần đầu tiên được phát hiện thấy ở Việt Nam. Virus TNRV thuộc chi Tospovirus và được lan truyền trên đồng ruộng từ cây này sang cây khác nhờ côn trùng môi giới là bọ trĩ theo phương thức bền vững tái sinh (Hà Viết Cường, 2011). 4. KẾT LUẬN Kết quả chẩn đoán bệnh thu thập tại các vùng trồng thuốc lá cho thấy các mẫu đốm chết hoại hình nhẫn thu thập tại Bắc Giang đều bị nhiễm Tospovirus, loài gây hại là Tomato necrotic ringspot virus (TNRV). TNRV lần đầu tiên được phát hiện trên cây thuốc lá ở Việt Nam. Các mẫu Hình 5. Cây phả hệ dựa trên đoạn Tospo- đốm chết hoại tại Cao Bằng, Bắc Kạn và ne ngọn F3/Tospo-R3 tại Tây Ninh không nhiễm Tospovirus. Nó được xây dựng bằng phương pháp TÀI LIỆU THAM KHẢO Neighbough Joining (NJ) với khoảng cách di truyền được xác định dựa trên mô hình thay thế 1. Nguyễn Văn Chín, 2017 - 2019. Điều tra tình Kimura 2 tham số. Giá trị bootrap (%) với 1000 hình sâu bệnh hại thuốc lá làm cơ sở dự báo và tư vấn lần lặp lại được chỉ rõ ở gốc các nhánh (chỉ thể biện pháp phòng trừ phục vụ sản xuất nguyên liệu ở hiện các giá trị >50%), Thanh bar thể hiện các tỉnh trồng thuốc lá của Việt Nam. Báo cao tổng kết khoảng cách di truyền. Các mẫu virus thuốc lá đề tài – cấp Tổng công ty Thuốc lá Việt Nam. 44
  7. Kết quả nghiên cứu Khoa học BVTV - Số 6/2019 2. Ha, C., Coombs, S., Revill, P., Harding, R., Vu, 5. Scott Adkins, Tom Zitter and Tim Momol, 2013. M., & Dale, J., 2008. Molecular characterization of Tospoviruses (Family Bunyaviridae, Genus begomoviruses and DNA satellites from Vietnam: Tospovirus). Plant Pathology Department, Florida additional evidence that the New World geminiviruses Cooperative Extension Services, Institute of Food and were present in the Old World prior to continental Agricultural Sciences, University of Florida. Published separation. Journal of General Virology, 89(1), 312-326. October 2005. 3. Hà Viết Cường, 2011. Virus thực vật, 6. Yueyan Yin, Kuanyu Zheng, Jiahong Phytoplasma và Viroid. Bài giảng bệnh hại cây trồng – Dong, Qi Fang, Shiping Wu, Lishuang Wang Học Viện Nông nghiệp Việt Nam. và Zhongkai Zhang, 2014. Identification of a new 4. Revill, P. A., Ha, C. V., Porchun, S. C., Vu, M. T., tospovirus causing necrotic ringspot on tomato in & Dale, J. L., 2003. The complete nucleotide sequence of China. Virology Journal 2014. two distinct geminiviruses infecting cucurbits in Vietnam. Archives of virology, 148(8), 1523-1541. Phản biện: TS. Hà Minh Thanh HIỆU LỰC PHÒNG TRỪ CỦA VI KHUẨN PHÁT HUỲNH QUANG ĐỐI VỚI NHỆN GIÉ HẠI LÚA, Steneotarsonemus spinki Smiley (Acari: Tarsonemidae) Efficacy of Fluorescent Pseudomonas Bacteria Against Panicle Rice Mite, Steneotarsonemus spinki Smiley (Acari: Tarsonemidae) 1 2 1 Lăng Cảnh Phú , Bùi Thị Huyền Trang và Nguyễn Văn Huỳnh Ngày nhận bài: 02.10.2019 Ngày chấp nhận: 29.10.2019 Abstract The research was carried out in laboratory of the Department of Plant Protection, College of Agriculture, Can Tho University in the objectives of (1) finding fluorescent Pseudomonas bacteria isolates in both stem and root zone of rice plants and weeds in order to prevent the panicle rice mite, (2) assessing the controlling effects and (3) the ability of an isolate to produce enzyme and hydrogen cyanine of fluorescent Pseudomonas bacterial isolates against panicle rice mite as a biological agent in controlling the pest in order to reduce the use of chemicals for safe environment. There were 03 (Ps.KG.HĐ-08, Ps.KG.HĐ-12 and Ps.KG.GR-05) per 29 isolates in total with high effect of controlling panicle rice mite in laboratory condition (62.33% to 67.40%) at 3 days after testing (3 DAT). All three of fluorescent Pseudomonas bacterial isolates produced protease and hydrogen cyanine, although only Ps.KG.HĐ-08 and Ps.KG.GR-05 had potential chitinase action. Keywords: Biological control, panicle rice mite, fluorescent Pseudomonas bacteria. * 1. ĐẶT VẤN ĐỀ spinki Smiley (Acari: Tarsonemidae) là loài dịch hại gây hại nguy hiểm tại Nam Mỹ và Trung Quốc Trên thế giới, loài nhện gié Steneotarsonemus (Navia et al., 2005; Xu et al., 2001) đã làm giảm 30-90% năng suất lúa tại Trung Quốc (Xu et al., 1. Bộ môn Bảo vệ Thực vật, Khoa Nông nghiệp, 2001) và tới 70% tại Cu Ba (Navia et al., 2005 Trường Đại học Cần Thơ dẫn). Ở nước ta, loài nhện gié đã được Ngô Đình 2. Học viên cao học ngành Bảo vệ thực vật, Trường Hoà (1992), Nguyễn Văn Đĩnh (1994) ghi nhận Đại học Cần Thơ 45
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2