    [0] => Array
            [banner_id] => 140
            [banner_name] => KM1 - nhân đôi thời gian
            [banner_picture] => 964_1568020473.jpg
            [banner_picture2] => 839_1568020473.jpg
            [banner_picture3] => 620_1568020473.jpg
            [banner_picture4] => 994_1568779877.jpg
            [banner_picture5] => 
            [banner_type] => 8
            [banner_link] =>
            [banner_status] => 1
            [banner_priority] => 0
            [banner_lastmodify] => 2019-09-18 11:11:47
            [banner_startdate] => 2019-09-11 00:00:00
            [banner_enddate] => 2019-09-11 23:59:59
            [banner_isauto_active] => 0
            [banner_timeautoactive] => 
            [user_username] => sonpham


Công nghệ DNA tái tổ hợp

Chia sẻ: Xuan Khuong | Ngày: | Loại File: PDF | Số trang:28

lượt xem

Công nghệ DNA tái tổ hợp

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Công nghệ DNA tái tổ hợp được hình thành từ những năm 1970 nhờ sự phát triển của các phương pháp và kỹ thuật dùng trong nghiên cứu các quá trình sinh học ở mức độ phân tử. Từ đó, cho phép phân lập, phân tích và thao tác trên các nucleic acid theo nhiều phương thức khác nhau, giúp hiểu biết sâu sắc các lĩnh vực mới của sinh học như công nghệ sinh học, bào chế các loại thuốc mới, y học phân tử và liệu pháp gen....

Chủ đề:

Nội dung Text: Công nghệ DNA tái tổ hợp

  1. Chương 2 Công nghệ DNA tái tổ hợp I. Mở đầu Công nghệ DNA tái tổ hợp được hình thành từ những năm 1970 nhờ sự phát triển của các phương pháp và kỹ thuật dùng trong nghiên cứu các quá trình sinh học ở mức độ phân tử. Từ đó, cho phép phân lập, phân tích và thao tác trên các nucleic acid theo nhiều phương thức khác nhau, giúp hiểu biết sâu sắc các lĩnh vực mới của sinh học nh ư công nghệ sinh học, bào chế các loại thuốc mới, y học phân tử và liệu pháp gen. Sự khám phá ra các enzyme hạn chế (restriction endonuclease) trong những năm đầu 1970 là sự phát triển then chốt (key development) không chỉ cho khả năng phân tích DNA hiệu quả hơn, mà còn cung cấp khả năng cắt các phân tử DNA để tạo ra các đoạn DNA tái tổ hợp mới, một quá trình mà ngày nay được gọi là tạo dòng gen (gene cloning). Phương thức tạo dòng này đã báo hiệu một kỷ nguyên mới trong thao tác, phân tích và khai thác các phân tử nucleic acid. Tạo dòng gen đã cho ra nhiều phát minh quan trọng và cung cấp những hiểu biết giá trị trong cấu trúc, chức năng và sự điều hòa hoạt động của gen. Từ những ứng dụng đầu tiên của chúng, các phương pháp xây dựng thư viện gen (gene library) được hình thành và phát triển, và hiện nay được xem như là nền tảng cơ sở cho nhiều thí nghiệm hóa sinh và sinh học phân tử. Mặc dù phản ứng chuỗi polymerase (polymerase chain reaction-PCR) để khuếch đại gen cho phép phân tích gen nhanh hơn nhưng trong nhiều trường hợp kỹ thuật tạo dòng gen vẫn còn hữu ích và là một yêu cầu tuyệt đối. Những phần dưới đây cung cấp một bức tranh tổng quát về các quá trình cơ bản của công nghệ DNA tái tổ hợp. II. Phân lập đoạn DNA/gen Một số phương pháp phân lập gen để thực hiện kỹ thuật tái tổ hợp DNA đã được sử dụng là: Nhập môn Công nghệ sinh học 31
  2. 1. Tách các đoạn DNA từ genome Phương pháp này được thực hiện như sau: DNA hệ gen (genomic DNA) của một sinh vật được cắt thành các đoạn nhỏ dài khoảng 20 kb (kích thước thích hợp tùy thuộc vào loại vector nhận chúng) bằng enzyme hạn chế rồi gắn vào vector để xây dựng thư viện genome (genomic library). Escherichia coli Saccharomyces cerevisiae . Thông thư 4 bp, ví dụ như Mbo - - . (clone). . Nhập môn Công nghệ sinh học 32
  3. (physical mapping). 2. Sinh tổng hợp cDNA từ mRNA Đoạn DNA được tổng hợp dựa trên khuôn mẫu mRNA được gọi là cDNA (complementary DNA). ba như sau: - . 2 (Mg2+ -- . - . mRNA-cDNA (khi tổng hợp sợi th E. coli (đ E. coli 5 . - 1. . Sợi đ bacteriophage (cDNA library). 3. Phân lập đoạn DNA bằng phương pháp PCR Ngoài hai phương pháp trên, hiện nay người ta sử dụng rất phổ biến phương pháp PCR để phân lập một trình tự nucleotide (gen) từ genome của Nhập môn Công nghệ sinh học 33
  4. sinh vật dựa trên các primer đặc hiệu cho trình tự đó. Phương pháp PCR đơn giản và ít tốn thời gian hơn hai phương pháp trên, mà hiệu quả vẫn rất cao. Sinh tan tế bào và tinh sạch mRNA Mô (ví dụ: não) 5’ AAAAAA 3’ mRNA Gắn oligo(dT) primer 5’ AAAAAA 3’ mRNA Tổng hợp sợi cDNA thứ TTTTTT nhất trên khuôn mẫu Reverse transcriptase mRNA 5’ AAAAAA 3’ mRNA 3’ TTTTTT 5’ sợi cDNA thứ nhất Biến tính nhiệt và xử lý RNase H để phá hủy sợi mRNA TTTTTT 5’ Đầu 3’ của cDNA tạo thành vòng cặp tóc DNA polymerase I Tổng hợp sợi cDNA thứ hai AAAAAA 3’ TTTTTT 5’ Nuclease S1 5’ AAAAAA 3’ 3’ TTTTTT 5’ cDNA sợi đôi 2.1. PCR là một kỹ thuật được sử dụng phổ biến trong công nghệ sinh học hiện đại và đã đóng góp rất lớn cho những tiến bộ về sinh học phân tử, đánh dấu một bư các enzyme hạn chế và kỹ thuật Southern blot (phân tích DNA). Nhập môn Công nghệ sinh học 34
  5. đ in vitro đ - 20 nucleotide. ▪ Nguyên tắc của PCR Taq polymerase là một loại enzyme DNA polymerase chịu nhiệt (có ở vi khuẩn chịu nhiệt độ cao Thermus aquaticus tide (dATP, dCTP, dGTP và dTTP) và hai primer, trên cơ sở khuôn mẫu của một đoạn DNA nhất , nhờ vậy có thể đủ số lượng để tách ra, phân tích trình tự hoặc tạo dòng. P DNA 3’ - 5’ - ). Nguyên tắc của PCR được trình đầu tạo ra các đoạn DNA có chiều dài xác định. Nếu biết trình tự của đoạn gen cần khuếch đại thì có thể tổng hợp nhân tạo các primer tương ứng để thực hiện PCR và tách chúng ra bằng kỹ thu , qua đó từ 10-6 g - DNA ban đầu có thể khuếch đại lên tới trên 1 PCR bao gồm ba giai đoạn có nhiệt độ khác nhau: - Gây biến tính (denaturation) ở 90-95oC. Trong giai đoạn biến tính, phân tử DNA khuôn mẫu ở dạng xoắn kép được tách thành hai sợi đơn (single strands). Tất cả các phản ứng enzyme trong giai đoạn này đều bị dừng lại (ví dụ: phản ứng tổng hợp DNA từ chu kỳ trước đó). - Gắn primer (annealing) ở 40-65oC. Trong giai đoạn này các primer gắn vào các vị trí có trình tự tương đồng ở DNA khuôn mẫu. Các primer bị lắc nhẹ chung quanh do chuyển động Brown vì thế các liên kết ion được tạo thành và bị đứt gãy liên tục giữa primer sợi đơn và DNA khuôn mẫu sợi đơn. Các liên kết ion ổn định hơ đoạn nhỏ (các primer đ Nhập môn Công nghệ sinh học 35
  6. ) và trên các đ đôi đó (khuôn mẫu và primer) enzyme Taq polymerase có thể bắt đầu quá trình sao chép khuôn mẫu. Khuếch đại theo hàm mũ Gen đích Chu kỳ 35 DNA khuôn mẫu 22 = 4 23 = 8 2 4 = 16 236 = 68 tỷ bản sao bản sao bản sao bản sao Hình 2.2. Sơ đ phản ứng chuỗi polymerase (PCR) - Kéo dài phân tử (extension) ở 70-72oC. Đây là khoảng nhiệt độ tối thích cho Taq polymerase tiến hành tổng hợp DNA bắt đầu từ các vị trí có primer theo chiều 5’ 3’. Các primer có mối liên kết ion mạnh hơn các lực phá v . Các primer ở các vị trí không bắt cặp chính xác lại bị rời ra (do nhiệt đ . Enzyme Taq polymerase bổ sung các dNTP từ 5’ 3’. III. Tạo dòng (gắn) đoạn DNA/gen vào vector 1. Enzyme hạn chế Việc phát hiện ra các enzyme hạn chế (restriction enzyme) của vi khuẩn cắt DNA ở những trình tự đặc trưng, đã giúp cho việc thao tác gen dễ dàng hơn, vì nó có thể giảm chiều dài của các phân tử DNA thành một tập hợp bao gồm các đoạn ngắn hơn. Các enzyme hạn chế hiện diện trong hầu hết các tế bào vi khuẩn để ngăn cản DNA ngoại lai (của bacteriophage) tiếp quản bộ máy tổng hợp Nhập môn Công nghệ sinh học 36
  7. protein của tế bào. DNA của chính chúng sẽ được bảo vệ khỏi tác dụng của enzyme hạn chế, nhờ sự có mặt của các enzyme nội bào có thể methyl hóa (methylation) các nucleotide đặc biệt, vì thế các nucleotide này không thể bị nhận biết bởi các enzyme hạn chế. Mỗi enzyme hạn chế nhận biết và cắt một trình tự DNA đặc trưng chứa 4 hoặc 6 cặp nucleotide. Ví dụ: enzyme EcoRI chiết từ E. coli cắt trình tự GAATTC, enzyme TaqI của Thermus aquaticus cắt trình tự TCGA (Hình 2.3). Hiện nay, có trên 900 enzyme hạn chế khác nhau đã được tinh sạch từ hơn 230 chủng vi khuẩn. Các enzyme hạn chế cắt gãy các phân tử DNA sợi đôi theo hai cách khác nhau như trình bày ở hình 2.3: PvuII (Proteus vulgaris) EcoRI (Escherichia coli) (A1) (A2) RsAI (Rhodopseudomonas sphaeroides) TaqI (Thermus aquaticus) (B1) (B2) Hình 2.3. Các kiểu cắt và nhận biết trình tự nucleotide của enzyme hạn chế. (A1): tạo ra đầu bằng và (A2): tạo ra đầu so le với trình tự 6 nucleotide. (B1): tạo ra đầu bằng và (B2): tạo ra đầu so le với trình tự 4 nucleotide. - Cắt trên một đường thẳng đối xứng để tạo ra các phân tử đầu bằng (Hình 2.3, A1 và B1). Nhập môn Công nghệ sinh học 37
  8. - Cắt trên những vị trí nằm đối xứng quanh một đường thẳng đối xứng để tạo ra những phân tử đầu so le (đầu dính) (Hình 2.3, A2 và B2). Vì một enzyme hạn chế nhận biết một trình tự duy nhất, cho nên số vị trí cắt trên một phân tử DNA đặc biệt thường là nhỏ. Các đoạn DNA được cắt bởi enzyme hạn chế có thể được phân tách theo kích thước bằng điện di agarose gel để nghiên cứu. Do sự tương tự của tổ chức phân tử trong tất cả các cơ thể, cho nên DNA vi khuẩn, DNA thực vật và DNA động vật có vú tương hợp nhau về cấu trúc. Vì thế, một đoạn DNA từ một dạng sống này có thể dễ dàng được pha trộn với DNA của một dạng sống khác. Sự tương tự này cũng phù hợp đối với plasmid, nhân tố di truyền ngoài nhân được tìm thấy trong nhiều loài vi khuẩn khác nhau. Chúng là những phân tử DNA mạch vòng đóng-sợi đôi được dùng làm vector mang các đoạn DNA ngoại lai (foreign DNA) dùng trong kỹ thuật tái tổ hợp DNA. 2. Các vector được dùng để tạo dòng các đoạn DNA in vitro 5’-PO4 . . Trong thực tế, các đoạn DNA được gắn với nhau để tạo ra phân tử DNA tái tổ hợp thường không phải là các đoạn ngẫu nhiên của DNA hệ gen, mà thay vào đó là một trong các đoạn DNA mang một gen từ sinh vật eukaryote hoặc vi khuẩn và một đoạn DNA khác thường là một phân tử vector (vector molecule) hoạt động như là một vật truyền để chuyển gen quan tâm vào trong một vi khuẩn hoặc một tế bào eukaryote. Hai loại vector được sử dụng phổ biến nhất là một loại có nguồn gốc từ các plasmid của vi Nhập môn Công nghệ sinh học 38
  9. khuẩn và một loại khác có nguồn gốc virus xâm nhiễm vào tế bào vi khuẩn (bacteriophage, viết tắt là phage). 2.1. Plasmid vector 1- . đặc đ . đư i) hay multiple cloning sites (vùng 3- : - . 2.600 bp, mang gen r Amp và gen lacZ’ lacZ’ . có ưu điểm k N lacZ’ . - . 3.000 bp, mang gen r Amp , gen lacZ . - . 2.6). Nhập môn Công nghệ sinh học 39
  10. 400 420 440 460 AGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCATAATCATGGTCAT EcoRI SacI KpnI BamHI XbaI HincII PstI SphI HindIII SmaI AccI 1 XmaI lacZ’ SalI ThrIleMetThr(Met) 2.4. Plasmid vector pUC19. Vùng tạo dòng (từ 396-447) được gắn vào gen lacZ’, nhưng không can thiệp vào chức năng của gen. 2.5. Plasmid vector pGEM -T Easy. Loại vector này đã được mở sẵn ở vùng tạo dòng trên gen lacZ mang hai đầu T, thích hợp cho việc gắn các sản phẩm PCR do chúng có mang hai đầu A. Nhập môn Công nghệ sinh học 40
  11. ApaI EcoO1091 BssHII T7 Promoter KpnI DraII XhoI SalI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC… KS primer binding site… M13-20 primer binding site T7 primer binding site Bsp1061 NotI ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI BstXI SacII SacI …GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC… …KS primer binding site… SK primer binding s ite β-gal α-fragment T3 Promoter BssHII …CAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCC T3 primer binding site M13 reverse primer binding site 2.6. Plasmid vector pBluescript II SK (+/-). Vector này mang vùng tạo dòng (multiple cloning sites-MCS) ở vị trí từ 598-826 trên gen lacZ’, và các vị trí gắn primer khác nhau dùng cho phân tích trình tự đoạn DNA ngoại lai. , DNA của plasmid được in vitro - ( của plasmid (ligation). Nhập môn Công nghệ sinh học 41
  12. 2.2. Bacteriophage vector Có hai loại bacteriophage thường được sử dụng là và M13, tuy nhiên chương này chỉ trình bày loại phổ biến hơn là bacteriophage . Bacteriophage cos cos (R-cos và L-cos) (lysis) ). Vùng điều hòa chức năng muộn Các gen hình thành đầu, Vùng sao Vùng điều hòa và Vùng phân Vùng hợp nhất và tái tổ đuôi và phát chép DNA giải vật chủ miễn dịch hợp (vùng đệm) sinh hình thái A…………J b att int xis red gam cIII N cI cro cII O P Q S R R-cos L-cos PL PR ori A W B C D E FI FII Z U V G T H M L K I J Đầu Đuôi λ genome. Các gen liên quan đến 2.7. các chức năng khác nhau đã được trình bày trên sơ đồ. cIII, N, cI, cro và cII: các gen liên quan đến hoạt động điều hòa, miễn dịch tiền phage, siêu nhiễm. O và P: các gen tổng hợp DNA. Q: gen điều hòa chức năng muộn. S và R: các gen phân giải tế bào vật chủ. PL: promoter bên trái, PR: promoter bên phải, L-cos: đầu dính bên trái, R-cos: đầu dính bên phải. (recipient). Phage vector Nhập môn Công nghệ sinh học 42
  13. - . khoảng 1/3 chiều dài của phage phage . Trên phage vector in vitro (in vitro (Hình 2.8). BamHI BamHI EcoRI EcoRI SalI SalI Nhánh trái (20 kb) Vùng đệm (14 kb) Nhánh phải (9 kb) 5’…GGATC TGGGT CGACG GATCC GGGGA ATTCC CAGAT CC…3’ SalI BamHI EcoRI Hình 2.8. Vector EMBL 3. Vector này được thiết kế từ phage mang các vị trí nhận biết cho ba enzyme SalI, BamHI và EcoRI. 3. Gắn đoạn DNA vào vector 3.1. Gắn các đoạn cDNA đư , chẳng hạn như: b Nhập môn Công nghệ sinh học 43
  14. (homopolymetric tailing) (linkers và adapter) . vector. Sợi đ (ví dụ: đoạn Klenow của DNA polymerase I của E. coli ase 3’ - (polymerase 5’ 3’ . . 3.1.2. Các adapter vector DNA . Nhập môn Công nghệ sinh học 44
  15. cDNA sợi đôi Sửa chữa bằng cách xử lý với đoạn Klenow Bổ sung linker thứ nhất Cắt bằng nuclease S1 Sửa chữa bằng cách xử lý với đoạn Klenow hoặc bằng DNA polymerase của bacteriophage T4 Bổ sung linker thứ hai Cắt bằng enzyme hạn chế Gắn với plasmid vector Biến nạp vào tế bào khả biến E. coli 2.9. . Đoạn Klenow tạo đầu bằng cho cDNA sợi đôi và enzyme nuclease S1 cắt vòng cặp tóc. Các linker thứ nhất và thứ hai được gắn tuần tự vào hai đầu của cDNA, sau đó đoạn cDNA này sẽ được cắt cùng enzyme hạn chế với vector tạo dòng có vị trí nhận biết trên hai linker nhân tạo. Cuối cùng đoạn cDNA có hai đầu tương đồng được gắn với vector và biến nạp vào E. coli. Nhập môn Công nghệ sinh học 45
  16. 3.2. Gắn các sản phẩm PCR Trong một số trường hợp nhất định có thể thay thế phương pháp tạo dòng truyền thống bằng phương pháp PCR, vì PCR cho phép sản xuất ra một lượng lớn đoạn DNA mong muốn và sau đó có thể tạo dòng đoạn DNA này trong các vector plasmid hoặc phage thích hợp. Phương thức tạo dòng cho các sản phẩm PCR hoàn toàn giống tạo dòng các đoạn DNA thu được từ những thao tác DNA truyền thống, và có thể được tạo dòng với đầu bằng hoặc đầu kết dính (so le). DNA polymerase ổn nhiệt như Taq polymerase đã khuếch đại các sản phẩm PCR có gốc A lồi ra ở đầu 3’. Như vậy, có thể tạo dòng sản phẩm PCR vào trong các dT vector (được gọi là tạo dòng dA:dT). Điều này cho thấy việc bổ sung các gốc A vào đầu cuối có thể giúp gắn thành công sản phẩm PCR với vector đã được chuẩn bị các gốc T lồi ra (Hình 2.10). Phản ứng được xúc tác bởi DNA ligase, như trong một phản ứng gắn truyền thống. A A Sản phẩm PCR được khuếch đại bằng Taq polymerase T T Vector (dT) Phản ứng gắn T4 DNA ligase Vector (dT) + đoạn chèn PCR Hình 2.10. Tạo dòng các sản phẩm PCR bằng phương thức tạo dòng dA:dT Người ta cũng có thể tạo dòng đầu dính với các sản phẩm PCR. Trong trường hợp này các oligonucleotide primer được thiết kế với một vị trí cắt hạn chế được kết hợp chặt chẽ trong chúng. Do sự bổ trợ của các primer cần thiết là tuyệt đối ở đầu 3’, nên thông thường đầu 5’ của primer là vùng định Nhập môn Công nghệ sinh học 46
  17. vị của vị trí cắt hạn chế. Điều này cần phải được thiết kế với sự chú ý thận trọng do hiệu suất cắt DNA bằng một enzyme hạn chế nhất định sẽ giảm nếu các nucleotide bổ sung thêm cho sự nhận biết của enzyme lại thiếu ở đầu 5’. Trong trường hợp này các phản ứng cắt và gắn giống như các phản ứng truyền thống. 4. Biến nạp vector tái tổ hợp vào vi khuẩn/tế bào vật chủ Sau khi tạo được vector tái tổ hợp mang gen ngoại lai, việc tiếp theo là biến nạp nó vào tế bào vật chủ. Trong trường hợp này tế bào vật chủ thường được sử dụng là vi khuẩn E. coli để khuếch đại một lượng lớn DNA của plasmid tái tổ hợp dùng cho các phân tích về sau. Hai phương pháp được dùng để biến nạp vector tái tổ hợp vào E. coli là điện biến nạp (electroporation transformation) và hóa biến nạp (chemical transformation). 4.1. Điện biến nạp Đây là kỹ thuật hiệu quả nhất để biến nạp vi khuẩn. Hai thông số quan trọng của phương thức này là loại tế bào vi khuẩn và tần số xung điện cần thiết. Thể tích của dung dịch tế bào thường được dùng là 30 µL (tương ứng với nồng độ 1010 tế bào E. coli/mL) có bổ sung 5 ng plasmid trong một cuvette có khoảng trống điện cực (electrode gap) 0,1 cm. Hiệu suất biến nạp của phương thức này lớn hơn 1 109 thể biến nạp/µg plasmid siêu xoắn và khoảng 1 108 thể biến nạp/µg plasmid được dùng trong phản ứng gắn. Tần số biến nạp khoảng 0,02 cho cả hai loại plasmid. Tần số biến nạp thấp đã ngăn cản được sự đồng biến nạp (co-transformation) vào vi khuẩn của hai hoặc nhiều phân tử plasmid. Phương pháp điện biến nạp có một số ưu điểm sau: - Hiệu suất biến nạp cao. - Có thể dùng một thể tích dịch tế bào nhỏ. Thể tích dịch tế bào khoảng 20 µL có thể cho hiệu suất khoảng 109 thể biến nạp. - Phương pháp chuẩn bị tế bào biến nạp rất đơn giản, không sử dụng các kỹ thuật phức tạp và tốn thời gian. Hơn nữa, các tế bào dùng để biến nạp có thể được chuẩn bị trước và bảo quản vô hạn định mà không mất tính khả biến. Nhập môn Công nghệ sinh học 47
  18. - Tần số điện biến nạp với DNA siêu xoắn và DNA mạch vòng là giống nhau. Do đó, không cần thiết phải dùng vector được tinh sạch cao trong các phản ứng gắn. - Hiệu suất biến nạp phân tử cho DNA mạch vòng rất cao đối với các plasmid có kích thước lên đến 50 kb. Nhược điểm của phương pháp này là đòi hỏi thiết bị biến nạp đắt tiền. 4.2. Hóa biến nạp Đây là phương thức kinh điển để biến nạp plasmid vào tế bào E. coli. Các tế bào được ủ trong dung dịch CaCl2 để trở thành tế bào khả biến giúp cho chúng dễ tiếp nhận plasmid. Plasmid được đưa vào bằng cách shock nhiệt nhanh (40-50 giây), các tế bào biến nạp sau đó được chọn lọc bằng phương pháp chọn lọc dương tính trên đĩa agar chứa môi trường LB với kháng sinh thích hợp. Mỗi khuẩn lạc trên đĩa kháng sinh đại diện cho một thể biến nạp đơn. Các tế bào chứa plasmid mang DNA ngoại lai có thể xác định bằng mắt trên đĩa môi trường có bổ sung thêm cơ chất nhiễm sắc thể cho β-galactosidase (X-gal) vì chúng là các khuẩn lạc không màu do sự khử hoạt tính của enzyme bằng cách chèn đoạn DNA ngoại lai. Phương pháp chuẩn bị và bảo quản tế bào khả biến trong hóa biến nạp cũng rất đơn giản. Hiệu suất biến nạp của phương pháp này trong khoảng 104-106 thể biến nạp/µg plasmid, tùy thuộc vào kích thước của đoạn DNA chèn (DNA ngoại lai) và chủng vi khuẩn được sử dụng. Hiệu suất này thích hợp cho các phương thức tạo dòng truyền thống. Đối với các phương thức cần hiệu suất biến nạp cao hơn (ví dụ: xây dựng thư viện cDNA, xây dựng thư viện phân tích trình tự DNA...) thì tốt hơn hết là dùng phương pháp điện biến nạp. Tuy nhiên, nếu không có sẵn thiết bị biến nạp bằng điện thì vẫn có thể thu được hiệu suất biến nạp cao bằng cách dùng các chủng vi khuẩn thích hợp hơn cho mục đích này và có thể thu được hiệu suất 109 thể biến nạp/µg plasmid. IV. Chọn dòng mang DNA tái tổ hợp Trong thí nghiệm tạo vector tái tổ hợp, hỗn hợp vector và một lượng lớn phân tử DNA cắt cùng một enzyme hạn chế được gắn lại với nhau bằng enzyme DNA ligase. Kết quả, hỗn hợp này có plasmid tái tổ hợp lẫn các Nhập môn Công nghệ sinh học 48
  19. plasmid không có gen ngoại lai chèn vào và chúng được trộn lẫn với các tế bào vi khuẩn để thực hiện biến nạp. Sau đó, người ta chuyển tất cả lên môi trường dinh dưỡng chọn lọc để chúng phát triển thành các dòng tức các khuẩn lạc vi khuẩn. Do cách tiến hành thí nghiệm trong một hỗn hợp không đồng nhất như vậy nên các dòng vi khuẩn mọc lên có ba loại như sau: - Tế bào vi khuẩn không nhận plasmid. - Tế bào vi khuẩn nhận plasmid không có gen ngoại lai chèn vào. - Tế bào vi khuẩn nhận đúng plasmid tái tổ hợp. Vì vậy, việc xác định đúng các dòng vi khuẩn chứa plasmid tái tổ hợp phải mất nhiều công sức. Có ba phương thức chính để xác định các dòng DNA tái tổ hợp là lai khuẩn lạc và vết tan, khử hoạt tính bằng chèn đoạn, và tạo dòng định hướng. 1. Lai khuẩn lạc và vết tan DNA được tạo dòng trong plasmid sản xuất ra các khuẩn lạc khi các nuôi cấy biến nạp được dàn mỏng trên đĩa agar chứa môi trường si nh trưởng và nuôi cấy dưới những điều kiện thích hợp. Các bacteriophage sinh tan tế bào bị chúng xâm nhiễm và sản xuất ra các plaque (vết tan) có dạng hình tròn chu vi khoảng 2-3 mm có màu sáng trên thảm vi khuẩn (bacterial lawn) của lớp agar đỉnh [trong trường hợp này người ta chuẩn bị đĩa agar có hai lớp: lớp agar đỉnh (top agar) có nồng độ agar thấp để bacteriophage dễ sinh tan tế bào vi khuẩn, và lớp agar đáy (bottom agar) có nồng độ agar cao hơn]. Các vector, như mô tả ở trên, thường chứa gen chỉ thị cho phép chọn lọc những tế bào vật chủ mang vector (thể biến nạp). Các chỉ thị này th ường là gen kháng kháng sinh và các tế bào biến nạp sinh trưởng trên môi trường chứa kháng sinh tương ứng. Ngoài ra, các vector còn chứa các gen chỉ thị bổ sung để phân biệt các tế bào biến nạp chứa đoạn chèn của DNA ngoại lai với các tế bào chứa các vector tự tái tạo lại vòng. Ví dụ: gen lacZ mã hóa enzyme β-galactosidase. Một dòng chứa các chuỗi DNA quan tâm đặc biệt có thể được xác định bởi lai khuẩn lạc hoặc vết tan. Một lượng nhỏ khuẩn lạc biến nạp hoặc vết tan được chuyển lên màng nitrocellulose hoặc nylon bằng cách phủ (overlay) màng này lên trên đĩa agar. DNA được biến tính và cố định trên màng bằng cách đun nóng (baking) hoặc chiếu tia tử ngoại (UV- Nhập môn Công nghệ sinh học 49
  20. crosslinking), và sau đó được lai trong đệm chứa probe đánh dấu đồng vị phóng xạ có trình tự bổ trợ một phần hoặc toàn bộ của chuỗi được xác định. Ví dụ: có thể một oligonucleotide tổng hợp nhân tạo, có nguồn gốc từ DNA hệ gen từng phần, cDNA hoặc trình tự protein hoặc sản phẩm PCR. Một đôi khi probe có thể được thiết kế dựa trên trình tự bắt nguồn từ gen tương đồng của các loài khác và thường được lai với cường lực thấp. Các probe thừa được rửa khỏi màng để ủ với phim X-quang. Theo hướng của phim (sau khi rửa) so sánh với đĩa agar gốc, chúng ta có thể đối chiếu các khuẩn lạc/vết tan thực tế với các khuẩn lạc/vết tan lai dương tính (positive clones) tương ứng trên phim X-quang. (ví dụ: Ampr, lacZ của cắt bởi E. coli -galactosidase của gen lacZ - -gal sẽ có màu trắng do đoạn DNA ngoại lai chèn vào giữa gen lacZ lacZ không bị mất hoạt tính (Hình 2.11). Hin Bam của vector Bam Hin đ E. coli (protruding ends) Hin Bam E. coli Nhập môn Công nghệ sinh học 50


Đồng bộ tài khoản