intTypePromotion=1
ADSENSE

Giáo trình CÔNG NGHỆ DNA TÁI TỔ HỢP - Chương 4

Chia sẻ: Doc Tai | Ngày: | Loại File: PDF | Số trang:30

243
lượt xem
85
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Chương 4 Các hệ thống Vector Có 3 nhóm vector chính tế bào vật chủ (E. coli hoặc nấm men), bao gồm: 1) Nhóm plasmid, 2) Nhóm phage/phagemid, và 3) Nhóm nhiễm sắc thể nhân tạo (artificial chromosome: BAC và YAC). Chương này giới thiệu sáu loại vector phổ biến (thuộc ba nhóm vector: plasmid, phage/phagemid và nhiễm sắc thể nhân tạo) dùng trong tạo dòng gen (gene cloning): plasmid, bacteriophage λ, cosmid, bacteriophage M13, BAC và YAC. I. Plasmid vector 1. Một số kiểu hình khác nhau của plasmid như: độc tố đường ruột enterotoxin - Sản xuất chất diệt khuẩn bacteriocin chất chất...

Chủ đề:
Lưu

Nội dung Text: Giáo trình CÔNG NGHỆ DNA TÁI TỔ HỢP - Chương 4

  1. Chương 4 C nhóm vector chính tế bào vật chủ (E. coli hoặc nấm men), bao gồm: 1) Nhóm plasmid, 2) Nhóm phage/phagemid, và 3) Nhóm nhiễm sắc thể nhân tạo (artificial chromosome: BAC và YAC). : - (ori) . - - khởi đầu . (promoter) để tiến hành - lai. - . chỉ thị thể tái tổ - hợp. như là: được - . - tách goại lai. - : RBS (ribosome binding sites-vùng ). Công nghệ DNA tái tổ hợp 72
  2. mục đích và của năm : - ). - Nghiên . - Đưa gen - . - . - . Chương này giới thiệu sáu loại vector phổ biến (thuộc ba nhóm vector: plasmid, phage/phagemid và nhiễm sắc thể nhân tạo) dùng trong tạo dòng gen (gene cloning): plasmid, bacteriophage λ, cosmid, bacteriophage M13, BAC và YAC. I. Plasmid vector 1- . Một số kiểu hình khác nhau của plasmid như: chất - - Kháng kim loại nặng chất - - độc tố đường ruột enterotoxin - - Sản xuất chất diệt khuẩn bacteriocin Công nghệ DNA tái tổ hợp 73
  3. 1 - - Sản xuất haemolysin2 3 4 - . Một loại vi khuẩn vật chủ thường chứa hai hoặc nhiều loại plasmid cùng tồn tại. Chúng có thể là các plasmid tương hợp (compatible plasmid) hoặc không tương hợp (incompatible plasmid). Người ta có thể chia plasmid làm hai loại dựa trên đặc điểm sinh sản và phương thức sống của chúng, đó là: plasmid tiếp hợp (conjugative plasmid) và plasmid không tiếp hợp (non- conjugative plasmid). nhờ . Một trước đây trong các vector hay pBR 322 mang hai (Ampr (Tetr hai vector 3. làm mất (multiple cloning sites, MCS . Bal Ava 153). ,v : 1 Colicin: . Haemolysin: dung huyết tố, chất gây tan máu, chất tiêu hồng cầu. 2 (modification enzymes): là các enzyme tác động qua lại với 3 DNA để sửa đổi cấu trúc hoặc sửa chữa các tổn thương đã xảy ra với phân tử DNA. 4 (restriction enzymes hay restriction endonuclease, RE): xem chương 1. Công nghệ DNA tái tổ hợp 74
  4. - pMK 16 Sma Xho amycin. - pKC 7 pACYC 184 . - pCR1 pSC 101 ( . control5 6 - : - plasmid. - (selectable marker) . - . Đến nay, c , trải qua ba : - .L . - .L thường 4.1 Stringent control: Còn gọi là kiểm soát sao chép c 5 . ể 6 Relaxed control: . Công nghệ DNA tái tổ hợp 75
  5. ColE1. (Ampr Tetr (ori Ampr như EcoRI, HindIII, BamHI, SalI, bốn Tetr tám . Tetr BamHI (375) , vì thế chèn E. coli - 1. . 4.1. Plasmid vector pBR 322. Apr (hay Ampr)và Tetr: gen kháng ampicillin và tetracycline, ori: trình tự khởi đầu sao chép, và một số vị trí nhận biết cho các RE. - .L .Đ Công nghệ DNA tái tổ hợp 76
  6. polylinkers (vùng - như: + . 2.600 bp, mang gen r lacZ’ a gen lacZ’ Ap 4.2 :  . lacZ’ 7  tiện . 400 420 440 460 AGTGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCATAATCATGGTCAT EcoRI SacI KpnI BamHI XbaI HincII PstI SphI HindIII SmaI AccI 1 XmaI lacZ’ SalI ThrIleMetThr(Met) 4.2. Plasmid vector pUC19. Vị trí tạo dòng (từ 396-447) được gắn vào gen lacZ’, nhưng không can thiệp vào chức năng của gen. Gen lacZ’: gen của E. coli mã hóa -galactosidase thích hợp cho chọn lọc thể 7 biến nạp bằng khuẩn lạc xanh ( -galactosidase sẽ kết hợp với IPTG và X-gal được bổ sung trong môi trường nuôi cấy) và khuẩn lạc trắng (đoạn DNA ngoại lai xen vào giữa gen lacZ’ làm cho gen này mất hoạt tính vì thế không sản xuất được - galactosidase). Công nghệ DNA tái tổ hợp 77
  7.  . + plasmid pGEM 3.000 bp, mang gen r Amp , gen lacZ . 4.3. Plasmid vector pGEM. Nhóm vector này được mở vòng sẵn mang 2 đầu T ở vùng MCS, đặc trưng cho việc gắn các sản phẩm PCR mang 2 đầu A. +N 3. ứng dụng 4.4). in vitro - Công nghệ DNA tái tổ hợp 78
  8. : Vùng tạo dòng MCS của pBluescript II SK (+/-) (từ vị trí 598 đến 826) ApaI Eco01091 BssHII T7 Promoter KpnI DraII XhoI SalI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC… KS primer binding site… M13-20 primer binding site T7 primer binding site Bsp1061 NotI ClaI HindIII EcoRV EcoRI PstI SmaI BamHI SpeI XbaI EagI BstXI SacII SacI …GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC… …KS primer binding site… SK primer binding site β-gal α-fragment T3 Promoter BssHII …CAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCC T3 primer binding site M13 reverse primer binding site 4.4. Plasmid vector pBluescript II SK (+/-). Vector này mang vùng tạo dòng ở vị trí từ 598-826 trên gen lacZ’, gen kháng ampicillin, các promoter T3 và T7, và các vị trí gắn cho các cặp primer khác nhau dùng trong phân tích trình tự đoạn DNA ngoại lai. (insertional inactivation) (ví dụ: Ampr, lacZ Công nghệ DNA tái tổ hợp 79
  9. E. coli m -galactosidase của ư gen lacZ -thiogalactoside (IPTG) cùng vớ -gal sẽ có màu trắng do đoạn DNA ngoại lai xen vào giữa gen lacZ làm gen này mất hoạt tính. Trong khi đ lacZ không bị mất hoạt tính (Hình 4.5 và 4.6). H N Br CH2OH O Cl HO X-gal OH OH Galactose β-galactosidase Cl OH H Br N Indoxyl N Br H OH Cl Nhị trùng hóa và oxy hóa Cl H H Br O N Kết tủa màu xanh N O Br H H Cl Hình 4.5. Cơ chế tác dụng của -galactosidase 2.2. (directional cloning) iết đơn Hin Bam Công nghệ DNA tái tổ hợp 80
  10. Bam Hin E. coli Hin Bam E. coli - (Hình 4.7). BamHI Amp r BamHI BamHI BamHI lacZ Plasmid vector DNA ngoại lai BamHI Amp r Gen lacZ mất hoạt tính T4 DNA ligase Đoạn DNA Amp r Amp r ngoại lai chèn giữa lacZ gen lacZ làm gen lacZ mất hoạt tính Biến nạp vào E. coli và cho sinh trưởng ở 37oC trên môi trường có Amp và IPTG+X-gal Vi khuẩn E. coli chứa vector tái tạo Vi khuẩn E. coli chứa vector tái tổ vòng phát triển thành khuẩn lạc có hợp phát triển thành khuẩn lạc có màu xanh màu trắng Hình 4.6. Tạo dòng theo phương thức khử hoạt tính bằng chèn đoạn. Ampr: gen kháng ampicillin, lacZ: gen mã hóa enzyme β-galactosidase. Công nghệ DNA tái tổ hợp 81
  11. Amp r HindIII HindIII BamHI HindIII r Tet BamHI Plasmid vector DNA ngoại lai BamHI + HindIII Amp r H Tet s H B H B B HB Điện di agarose gel Amp r H Tet s B T4 DNA ligase Amp r Amp r H H Các thể biến nạp được s Tet Tet s dàn mỏng trên môi B B trường có Amp Hiệu suất biến nạp cao Hiệu suất biến nạp thấp Hình 4.7. Tạo dòng định hướng. Tetr: gen kháng tetracycline, Tets: gen kháng tetracycline bị khuyết đoạn và mất hoạt tính. 2.3. Biến nạp vector tái tổ hợp vào vi khuẩn/tế bào vật chủ Sau khi tạo được vector tái tổ hợp mang gen ngoại lai, việc tiếp theo là biến nạp nó vào tế bào vật chủ. Trong trường hợp này tế bào vật chủ thường Công nghệ DNA tái tổ hợp 82
  12. được sử dụng là vi khuẩn E. coli để khuếch đại một lượng lớn DNA plasmid tái tổ hợp dùng cho các phân tích về sau. Hai phương pháp được dùng để biến nạp vector tái tổ hợp vào E. coli là điện biến nạp (electroporation transformantion) và hóa biến nạp (chemical transformation). 2.3.1. Điện biến nạp Đây là kỹ thuật hiệu quả nhất để biến nạp vi khuẩn. Hai thông số quan trọng của phương thức này là loại tế bào vi khuẩn và tần số xung điện cần thiết. Thể tích của dung dịch tế bào thường được dùng là 30 µL (tương ứng với nồng độ 1010 tế bào E. coli/mL) có bổ sung 5 ng plasmid trong một cuvette có khoảng trống điện cực (electrode gap) 0,1 cm. Hiệu suất biến nạp của phương thức này lớn hơn 1×109 thể biến nạp/µg plasmid siêu xoắn và khoảng 1×108 thể biến nạp/µg plasmid được dùng trong phản ứng gắn. Tần số biến nạp khoảng 0,02 cho cả hai loại plasmid. Tần số biến nạp thấp đã ngăn cản được sự đồng biến nạp (co-transformation) vào vi khuẩn của hai hoặc nhiều phân tử plasmid. Phương pháp điện biến nạp có một số ưu điểm sau: - Hiệu suất biến nạp cao. - Có thể dùng một thể tích dịch tế bào nhỏ. Thể tích dịch tế bào khoảng 20 µL có thể cho hiệu suất khoảng 109 thể biến nạp. - Phương pháp chuẩn bị tế bào biến nạp rất đơn giản, không sử dụng các kỹ thuật phức tạp và tốn thời gian. Hơn nữa, các tế bào dùng để biến nạp có thể được chuẩn bị trước và bảo quản vô hạn định mà không mất tính khả biến. - Tần số điện biến nạp với DNA siêu xoắn và DNA mạch vòng là giống nhau. Do đó, không cần thiết phải dùng vector được tinh sạch cao trong các phản ứng gắn. - Hiệu suất biến nạp phân tử cho DNA mạch vòng rất cao đối với các plasmid có kích thước lên đến 50 kb. Tuy nhiên, nhược điểm của phương pháp này là đòi hỏi thiết bị biến nạp đắt tiền. Công nghệ DNA tái tổ hợp 83
  13. 2.3.2. Hóa biến nạp Đây là phương thức kinh điển để biến nạp DNA plasmid vào tế bào E. coli. Các tế bào được ủ trong dung dịch CaCl2 để trở thành tế bào khả biến giúp cho chúng dễ tiếp nhận DNA plasmid. DNA plasmid đưa vào bằng cách shock nhiệt nhanh (40-50 giây), các tế bào biến nạp sau đó được chọn lọc bằng phương pháp chọn lọc dương tính trên đĩa agar chứa môi trường LB với kháng sinh thích hợp. Mỗi khuẩn lạc trên đĩa kháng sinh đại diện cho một thể biến nạp đơn. Các tế bào chứa plasmid mang DNA ngoại lai có thể xác định bằng mắt trên đĩa môi trường có bổ sung thêm cơ chất nhiễm sắc thể cho β-galactosidase (X-gal) vì chúng là các khuẩn lạc không màu do sự khử hoạt tính của enzyme bằng cách chèn đoạn DNA ngoại lai. Phương pháp chuẩn bị và bảo quản tế bào khả biến trong hóa biến nạp cũng rất đơn giản. Hiệu suất biến nạp của phương pháp này trong khoảng 104-106 thể biến nạp/µg plasmid, tùy thuộc vào kích thước của đoạn DNA chèn (insert DNA) và chủng vi khuẩn được sử dụng. Hiệu suất này thích hợp cho các phương thức tạo dòng truyền thống. Đối với các phương thức cần hiệu suất biến nạp cao hơn (ví dụ: xây dựng thư viện cDNA, xây dựng thư viện phân tích trình tự DNA...) thì tốt hơn hết là dùng phương pháp điện biến nạp. Tuy nhiên, nếu không có sẵn thiết bị biến nạp bằng điện thì vẫn có thể thu được hiệu suất biến nạp cao bằng cách dùng các chủng vi khuẩn thích hợp hơn cho mục đích này và có thể thu được hiệu suất 109 thể biến nạp/µg plasmid. II. Bacteriophage vector Phage 50 kb, DNA cos cos enzyme DNA lig 4.8 (lysis) (lysogeny) (trong giai ). (recipient). Vector phage Công nghệ DNA tái tổ hợp 84
  14. - . Vùng điều hòa chức năng muộn Các gen hình thành đầu, Vùng sao Vùng điều hòa và Vùng phân Vùng hợp nhất và tái tổ đuôi và phát chép DNA giải vật chủ miễn dịch hợp (vùng đệm) sinh hình thái A…………J b att int xis red gam cIII N cI cro cII O P Q S R R-cos L-cos PL PR ori A W B C D E FI FII Z U V G T H M L K I J Đầu Đuôi λ genome. Các gen liên quan đến 4.8. các chức năng khác nhau đã được trình bày trên sơ đồ. cIII, N, cI, cro và cII: các gen liên quan đến hoạt động điều hòa, miễn dịch tiền phage, siêu nhiễm. O và P: các gen tổng hợp DNA. Q: gen điều hòa chức năng muộn. S và R: các gen phân giải tế bào vật chủ. PL: promoter bên trái, PR: promoter bên phải, L-cos: đầu kết dính bên trái, R-cos: đầu kết dính bên phải. , phage bằng khoảng 1/3 chiều dài của phage . Do DNA phage Công nghệ DNA tái tổ hợp 85
  15. 78% c lắp gắn . Trên vector phage in vitro (in vitro . Bacteriophage được tóm tắt như sau (Hình 4.9 và 4.10): - . - . - in vitro . - . - (E. coli . . Ch Công nghệ DNA tái tổ hợp 86
  16. . Bacteriophage λ DNA DNA nguồn BamHI BamHI Vùng đệm Đầu cos L R Đầu cos Phân lập theo kích thước bằng BamHI BamHI Cắt DNA bằng BamHI L R (dài khoảng 20 kb) T4 DNA ligase 20 kb L R L R Đóng gói in vitro phage Biến nạp vào P2 E. coli Không tạo vết tan Tạo vết tan Hình 4.9. Các bước tạo dòng trong bacteriophage . DNA nguồn được cắt bằng BamHI và được phân đoạn theo kích thước (khoảng 20 kb). Bacteriophage cũng được phân cắt bằng BamHI. Hai mẫu này được trộn vào nhau và xử lý bằng T4 DNA ligase. Phản ứng gắn xảy ra tạo một bacteriophage mới (tái tổ hợp): đoạn stuffer được thay bằng đoạn DNA ngoại lai. Những phân tử này đóng gói in vitro trong đầu của phage , và chúng có thể gây nhiễm sau khi được thêm phần đuôi. Công nghệ DNA tái tổ hợp 87
  17. A B λ DNA DNA Đuôi Đầu cos Hình 4.10. Phân tử DNA của phage . A: Tự tái bản DNA từ dạng vòng của làm cho nó trở thành dạng dây thẳng, hình thành các đoạn chồng lấp lên nhau, với độ dài khoảng 50 kb. B: Mỗi đầu đều chứa đầy 50 kb đơn vị của DNA, trước khi đuôi được tổng hợp gắn vào sau. Spi+ trong E. coli (red gam - Spi chi (chi recA). L47.1, red gam - Spi 2 recA+ E. coli . loại bỏ. gam recA+. Phage - red gam phenotype Spi+ recA-. Công nghệ DNA tái tổ hợp 88
  18. 2.2. Những vector được cải tiến Những vector thường được cải tiến nhằm mục đích: - Tăng khả năng thích ứng của các đoạn DNA ngoại lai khác nhau với các RE. - Cho phép chọn lựa phương thức tái tổ hợp mong muốn. - Cho phép có được các RNA probe sẵn sàng cho việc chuyển mã của DNA ngoại lai gắn vào vector. Điều này giúp chúng ta dễ dàng sàng lọc các thư viện trong quá trình chromosome walking, ví dụ như ZAP. - Phát triển các vector trong quá trình gắn vào cDNA của sinh vật bậc cao, dưới hình thức một polypeptide dung hợp với β-galactosidase. Hình thức này rất hữu ích trong việc chọn lọc kháng thể, ví dụ như vector gt11. BamHI BamHI EcoRI EcoRI EMBL3 SalI SalI Vùng đệm (14 kb) Nhánh phải (9 kb) Nhánh trái (20 kb) BamHI BamHI EcoRI EcoRI SalI SalI EMBL4 Vùng đệm (14 kb) Nhánh phải (9 kb) Nhánh trái (20 kb) 5’…GGATC TGGGT CGACG GATCC GGGGA ATTCC CAGAT CC…3’ SalI BamHI EcoRI Hình 4.11. Vector EMBL3 và EMBL4 được thiết kế từ phage mang các vị trí nhận biết cho các enzyme SalI, BamHI và EcoRI Thế hệ gần đây nhất của vector là EMBL3 và EMBL4 (Hình 4.11), chúng mang các trình tự có tính chất polylinker nằm gần đoạn có thể thay thế được. Các phage với những thể insert đính bên trong nó có thể được chọn lọc bằng kiểu hình Spi -, chính là chi+. Thể cải tiến từ EMBL3 có Công nghệ DNA tái tổ hợp 89
  19. những đột biến EMBL3 Sam, EMBL3 Aam Sam. Những đột biến trong vector không chỉ làm gia tăng khả năng chứa của nó, mà còn được sử dụng trong hệ thống chọn lọc những trình tự DNA được phân lập, liên kết với các gen ức chế (suppressor). III. Cosmid vector 1. Đặc điểm của cosmid + đầu cos vector : - Các ori . - cos . i khoảng - . BamHI (44) BamHI (36) SmaI (42) EcoRI (82) EcoRI (1) NotI (75) NotI (8) M13 Forward T7 Promoter Primer Binding Primer Binding Site Site cos r Amp cos TM pWEB-TNC 5812 bp colE1 ori r Chl pWEB-TNC Sequencing Primer Hình 4.12. Bản đồ và vùng tạo dòng của vector cosmid pWEB-TNC. Vị trí tạo dòng SmaI nằm bên cạnh các cặp BamHI, NotI và EcoRI. Chlr: gen kháng chloramphenicol. Công nghệ DNA tái tổ hợp 90
  20. 2. Tạo dòng trong cosmid 4.13. Trước hết cosmid được cắt với RE thứ nhất (ScaI) để tạo thành mạch thẳng, sau đó phân tử mạch thẳng được cắt tiếp với RE thứ hai (BamHI) để làm thành hai nhánh (nhánh lớn và nhánh nhỏ). Một nhánh chứa đầu cos, gen kháng kháng sinh và vùng ori; nhánh còn lại chỉ chứa đầu cos thứ hai. Hai nhánh này kết hợp với genomic DNA đã được cắt với RE (cùng loại với RE thứ hai cắt cosmid thành hai nhánh) nhờ DNA ligase, cuối cùng tất cả chúng được đóng gói in vitro trong đầu của các tiểu thể phage trưởng thành. - - 45 kb. : : sự - . - (scrambling): (original genome). - . . gen dùng cosmid vector . Hình 4.13 cho thấy cosmid có chứa vị trí ori của E. coli (cho phép cosmid được duy trì như một plasmid trong E. coli). Hai đầu cos gần vị trí cắt hạn chế ScaI và BamHI. DNA nguồn được cắt bởi BamHI để phân đoạn có kích thước khoảng 40 kb. Gen kháng Tet (Tetr) định vị gần cos. Phân tử dạng plasmid được cắt bởi BamHI và ScaI. Ba mẫu DNA này được trộn vào nhau và được gắn bằng T4 DNA ligase. Sau khi gắn xong, những phân tử Công nghệ DNA tái tổ hợp 91
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2