intTypePromotion=1
ADSENSE

Luận văn : Khuếch đại vùng gen ITS1 - 5,8 S - ITS2 các nguồn nấm Beauveria basiana có tính độc cao part 2

Chia sẻ: Asdfadf Adgsg | Ngày: | Loại File: PDF | Số trang:9

277
lượt xem
45
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Hình 2.3 Sơ đồ nhóm gen rDNA nhân và rDNA ty thể (White và cộng sự, 1989) rDNA 18 S thường được quan tâm nghiên cứu; rDNA 5,8 S có kích thước rất nhỏ và ít có sự biến đổi song rRNA 5 S là thành phần không thể thiếu của nu - LSUrRNA, có vai trò ổn định cấu trúc ribosom và thúc đẩy quá trình tổng hợp protein (Szymanski và cộng sự, 2001); rDNA 25 S mặc dù ít có sự biến đổi song lại rất có ý nghĩa trong phân loại (Guarro, 1999). Vùng ITS là vùng...

Chủ đề:
Lưu

Nội dung Text: Luận văn : Khuếch đại vùng gen ITS1 - 5,8 S - ITS2 các nguồn nấm Beauveria basiana có tính độc cao part 2

  1. 10 Hình 2.3 Sơ đồ nhóm gen rDNA nhân và rDNA ty thể (White và cộng sự, 1989) rDNA 18 S thường được quan tâm nghiên cứu; rDNA 5,8 S có kích thước rất nhỏ và ít có sự biến đổi song rRNA 5 S là thành phần không thể thiếu của nu - LSU- rRNA, có vai trò ổn định cấu trúc ribosom và thúc đẩy quá trình tổng hợp protein (Szymanski và cộng sự, 2001); rDNA 25 S mặc dù ít có sự biến đổi song lại rất có ý nghĩa trong phân loại (Guarro, 1999). Vùng ITS là vùng có rất nhiều sự biến đổi, mặc dù vùng ITS thường được sử dụng trong nghiên cứu tiến hóa của vi sinh tuy nhiên phần lớn các so sánh trên vùng này chỉ thường sử dụng ở mức độ xác định các biệt hóa trong cùng loài (Guarro, 1999). Phân nhóm rDNA 2.2.2. Theo White và cộng sự (1989), rDNA có thể chia thành 2 nhóm: rDNA nhân và rDNA ty thể. rDNA nhân rDNA nhân (nu - rDNA) gồm có nu - SSU - rDNA (17 - 18 S) mã hóa rRNA tiểu đơn vị nhỏ (small subunit rDNA) và nu - LSU - rDNA (26 - 28 S) mã hóa rRNA tiểu đơn vị lớn (large subunit rDNA). Nu - SSU - rDNA tiến hóa tương đối chậm, thường được sử dụng trong nghiên cứu các sinh vật có ít quan hệ về mặt di truyền. Nu - LSU - rDNA mặc dù có ít vùng
  2. 11 biến đổi nhưng lại rất có ý nghĩa trong nghiên cứu so sánh và phân loại ở nhiều cấp độ (Guarro, 1999). rDNA ty thể rDNA ty thể (mt - rDNA) cũng gồm có hai loại: mt - SSU - rDNA (19 S) và mt - LSU - rDNA. Các mt - rDNA tiến hóa khá nhanh, thường được sử dụng trong nghiên cứu các sinh vật cùng họ (Yamamoto và cộng sự, 1995). Theo nghiên cứu của Santos và cộng sự (2002), ở các loài sinh vật có lạp thể, rDNA của lạp thể (cp - rDNA) cũng rất thay đổi về kích thước giữa các loài. Nghiên cứu cũng kết luận rằng cp - LSU - rDNA (23 S) có sự thay đổi lớn về kích thước trong các loài sinh vật có lạp thể, cp - SSU - rDNA (16 S) thường ít được sử dụng trong nghiên cứu vì nó có đặc tính phái sinh. Sơ lƣợc lịch sử nghiên cứu rDNA 2.2.3. rDNA được quan tâm nghiên cứu từ rất sớm. Bằng cách tách gen, nhân dòng và đọc trình tự, người ta đã đọc được rất nhiều trình tự rDNA. Đặc biệt, phương pháp đọc trình tự trực tiếp sản phẩm PCR ra đời tạo rất nhiều thuận lợi cho các nghiên cứu liên quan đến rDNA (White và cộng sự, 1989). Năm 1984, Hassouna và cộng sự đã giải trình tự toàn bộ gen mã hóa 28 S rRNA trên chuột và phát hiện có gia tăng kích thước của gen này ở các sinh vật eukaryote bậc cao. Năm 1985, Hasegawa và cộng sự dựa trên trình tự rDNA nghiên cứu mối quan hệ phát sinh loài của giới eukaryote. Field và cộng sự (1988) là những người đầu tiên đề nghị nghiên cứu rDNA để xác định mối quan hệ trong phát sinh loài của động vật đa bào. Đặc biệt, rDNA nhân mã hóa rRNA 18 S được xem là đủ đa dạng có thể giải quyết nhiều vấn đề liên quan đến lịch sử phát sinh động vật đa bào (Halanych và Kenneth M., 1998). Năm 1989, Gams và cộng sự sử dụng phương pháp PCR - RFLP thay vì đọc trình tự khi nghiên cứu rDNA. Năm 1990, Palmer và cộng sự đã so sánh trình tự SSU - rDNA của nhân, ty thể và lục lạp của thực vật hạt kín và thấy rằng trình tự rDNA 18 S của nhân là có nhiều
  3. 12 biến đổi nhất. Cũng trong năm này, Devereux và cộng sự lần đầu tiên chú ý tới những tương đồng trong trình tự 16 S của vi khuẩn khi nghiên cứu phân loại. Các nghiên cứu sinh học phân tử nhằm phân loại nấm trên cơ sở rDNA được phát triển những năm đầu của thập niên 90 (Bruns và cộng sự, 1991; ). So sánh những thay đổi của nu - SSU - rDNA (18 S), Bruns và cộng sự (1992) đã tìm được quan hệ di truyền của nhiều loài nấm sợi. Năm 1994, Gutell đã tổng hợp những biến đổi trong cấu trúc bậc hai của rRNA 16 S từ các đại diện thuộc giới cổ vi khuẩn, vi khuẩn và eukaryote trên cả nhân, ty thể và lạp thể. Các nghiên cứu phát sinh loài thực vật dựa trên vùng ITS được tiến hành bởi Baldwin và cộng sự (1995). Những năm gần đây, ngoài ý nghĩa phân loại, rDNA và vùng ITS rất được quan tâm nghiên cứu ở cấp độ phân tử. Năm 1998, Chilton và cộng sự chứng minh cấu trúc ITS2 bậc hai có sự tương đồng giữa các họ phụ của lớp giun tròn. Năm 1999, Joseph và cộng sự đã chứng minh vùng trung tâm trong cấu trúc ITS2 bậc 2 của động vật có xương sống và nấm men có nhiều điểm tương đồng. Năm 2004, Colette và cộng sự nghiên cứu về vai trò của vùng ITS2 trong tiến trình tạo tiền rRNA ở nấm men. Sơ đồ vị trí và trình tự các primer dùng trong nghiên cứu rDNA và vùng ITS 2.2.4 2.2.4.1 Vị trí và trình tự primer khuếch đại nu - rDNA Vị trí primer Hình 2.4 Sơ đồ vị trí primer trên nu - rDNA (White và cộng sự, 1989) Các primer từ NS1 đến NS8 được thiết kế dựa trên vùng trình tự bảo tồn của rDNA 18 S của S. cerevisiae, Distyostelium discoideum và Stylonicha pustulata. Các primer NS1 và NS2 có thể sử dụng cho hầu hết các loại nấm, tảo đỏ và sinh vật đơn
  4. 13 bào, NS3 và NS4 dùng cho hầu hết các loại nấm, NS7 và NS8 chỉ khuếch đại được rDNA của thực vật và động vật có xương sống. NS1 và NS8 thường dùng để đọc trình tự hầu hết các loại rDNA nhưng không đọc được trình tự vùng primer. NS2 và NS3, NS4 và NS5, NS6 và NS7 có trình tự bổ sung, được thiết kế để đọc được trình tự cả vùng primer (White và cộng sự, 1989). Các primer vùng ITS được thiết kế dựa trên vùng bảo tồn của các gen 18 S, 5,8 S, 28 S. ITS1 là trình tự bổ sung của NS8. Primer ITS2 và ITS3 được thiết kế và sàng lọc dựa trên vùng bảo tồn thuộc 5,8 S của N. crassa, Schizosaccharomyces pombe và S. cerevisiae, Vicia faba và chuột. Vùng bảo tồn trên rDNA 28 S của S. prombe, S, cerevisiae và lúa (Oryza sativa) được so sánh để thiết kế ITS4. Primer ITS5 có trình tự giống với rDNA 18 S của N. crassa, có đầu 5’ chỉ cách primer ITS1 25 bp (White và cộng sự, 1989). Trình tự primer Bảng 2.1 Trình tự primer dùng khuếch đại nu – rDNA (Bruns và cộng sự, 1990; White và cộng sự, 1989) Tm (0C) Trình tự Primer Nu – SSU – rDNA primer 56 NS1 GTAGTCATATGCTTGTCTC 68 NS2 GGCTGCTGGCACCAGACTTGC 68 NS3 GCAAGTCTGGTGCCAGCAGCC 56 NS4 CTTCCGTCAATTCCTTTAAG 57 NS5 AACTTAAAGGAATTGACGGAAG 65 NS6 GCATCACAGACCTGTTATTGCCTC 65 NS7 GAGGCAATAACAGGTCTGTGATGC 65 NS8 TCCGCAGGTTCACCTACGGA ITS Primer ITS1 TCCGTAGGTGAACCTGCGG 65 ITS2 GCTGCGTTCTTCATCGATGC 62 ITS3 GCATCGATGAAGAACGCAGC 62 ITS4 TCCTCCGCTTATTGATATGC 58 ITS5 GGAAGTAAAAGTCGTAACAAGG 63 Nu - LSU – Rdna NL1F TGGGTGGTAAATTCCATCTA 51
  5. 14 NL2F GTGAAATTGTTAAAAGGGAAAC 53 NL13 CAAGCGAACTTTCATCATGCACG 63 NL14 CTTTAGAACAAGGGTTGAAC 51 2.2.4.2. Vị trí và trình tự primer khuếch đại mt - rDNA Vị trí primer Các primer ML1, ML2, ML4, MS1, MS2 được sử dụng để khuếch đại c ác trình tự đặc trưng ở hầu hết các loại nấm. Ở vài loài nấm, trình tự khuếch đại bởi 2 primer ML6 và ML5 chứa một intron khá lớn nên việc khuếch đại thường không hiệu quả. Các đột biến thay đổi kích thước như vậy thường rất phổ biến ở các gen ty thể, do đ ó kích thước vùng khuếch đại thay đổi rất đáng kể (White và cộng sự, 1989). Hình 2.5 Vị trí primer trên rDNA ty thể (White và cộng sự, 1989). Trình tự primer Bảng 2.2 Trình tự primer dùng khuếch đại mt - rDNA (Bruns và cộng sự, 1990; White và cộng sự, 1989) Tm (0C) Trình tự Primer Mt – SSU - rDNA CAGCAGTCAAGAATATTAGTCAATG MS1 65 GCGGATTATCGAATTAAATAAC MS2 63 AACCACCATTCATCGTTGAC MS4 63 Mt – LSU – rDNA GTACTTTTGCATAATGGGTCAGC ML1 68
  6. 15 TATGTTTCGTAGAAAACCAGC ML2 63 GCTGGTTTTCTACGAAACATATTTAAG ML3 67 GAGGATAATTTGCCGAGTTCC ML4 68 CTCGGCAAATTATCCTCATAAG ML5 66 CAGTAGAAGCTGCATAGGGTC ML6 65 GACCCTATGCAGCTTCTACTG ML7 63 TTATCCCTAGCGTAACTTTTATC ML8 57 Ý nghĩa của ITS - rDNA trong phân loại nấm 2.2.5. Nghiên cứu so sánh trình tự rDNA (ribosomal RNA gene) đóng vai trò quan trọng trong phân loại và xác định quan hệ di truyền (Woese and Olsen (1986), Zimmer và cộng sự (1988), Medlin và cộng sự (1989)) và đặc biệt có ý nghĩa trong ngành phân loại nấm. Từ trước đến nay nấm thường được phân loại dựa trên đặc điểm hình thái, cơ chế trao đổi chất, cấu trúc vách tế bào và thành phần protein nên kết quả phân loại thường không chính xác; các so sánh dựa trên trình tự nu được xem là cơ sở chính xác nhất, rất có ý nghĩa trong phân loại nấm (Guarro, 1999). Nhờ những phân tích trên nu - SSU - rDNA có thể chia giới nấm thành 4 lớp Acrasiomycota, Myxomycota, Oomycota, và Fungi (Bruns và cộng sự, 1991). Cũng dựa trên cơ sở so sánh SSU - rDNA, người ta cũng đã chứng minh Schizosaccharomycetales có nguồn gốc từ lớp Myxomycota (Guarro, 1999). Các phân tích trên mt - LSU - rDNA (24 S) cho thấy P. carinii thuộc lớp nấm men Basidiomycete trong khi đó người ta thường lầm tưởng loài này thuộc nhóm động vật nguyên sinh (Wakefield, 1992). Trên cơ sở so sánh trình tự LSU - rDNA và trình tự SSU - rDNA, Leclerc (1994) chứng minh S. apiospermum and S. prolificans có quan hệ về di truyền. Muthumeenakshi và cộng sự (1994) đã chứng minh có sự đa hình xảy ra khi nghiên cứu những thay đổi trong vùng ITS của các dòng Trichoderma harzianum. Dựa trên trình tự rDNA 18 S, 5,8 S và vùng ITS, Berbee và cộng sự (1995) đã chứng minh Penicillium, Aspergillus, và Paecilomyces thuộc lớp Trichocomaceae. Giới thiệu kỹ thuật PCR 2.3. Khái niệm 2.3.1.
  7. 16 Kỹ thuật PCR (polymerase chain reaction) được mô tả bởi Mulis và cộng sự. (1985) là kỹ thuật cho phép làm tăng bội đáng kể các đoạn DNA cần được ng hiên cứu. Khác với sự tăng bội DNA qua sự tạo dòng nhờ vi khuẩn, PCR được thực hiện in vitro theo con đường enzyme. Nguyên tắc phản ứng PCR 2.3.2. Tất cả các DNA polymerase khi hoạt động tổng hợp một mạch DNA mới từ khuôn đều cần sự hiện diện của những primer chuyên biệt. Primer là những đoạn oligonucleotide có khả năng bắt cặp bổ sung vào đầu 3’ của khuôn, DNA polymeras e sẽ nối dài primer để hình thành mạch mới (Bùi Trang Việt, 2002). Hiện tượng trên chính là cơ sở của phương pháp PCR. Nếu được cung cấp hai primer (forward primer và reverse primer) có khả năng bắt cặp chuyên biệt với hai đầu của một trình tự DNA, phản ứng PCR sẽ nhân bản trình tự nằm giữa hai primer này (PCR thường được dùng để nhân bản các trình tự DNA có chiều dài khoảng 200 -2000 bp) (Bùi Trang Việt, 2002). Thành phần cơ bản của phản ứng PCR và các yếu tố ảnh hƣởng 2.3.3. 2.3.3.1. Primer và nhiệt độ lai Primer là yếu tố quan trọng ảnh hưởng tới tính đặc hiệu và tính hiệu quả của phản ứng khuếch đại. Trình tự của primer thường được chọn sao cho không có có sự bắt cặp bổ sung giữa primer xuôi và primer ngược, không có những cấu trúc “kẹp tóc” do sự bắt cặp bổ sung trong mỗi primer và Tm của 2 primer phải không quá cách biệt nhau. Ngoài ra, thành phần nucleotide của primer phải cân bằng tránh lập lại nhiều lần các cặp GC. Primer được chọn phải đặc trưng cho trình tự DNA cần khuếch đại, không trùng với các trình tự trên gen. Trình tự nằm giữa hai primer không quá lớn, phản ứng PCR sẽ tối ưu trên những trình tự nhỏ hơn 1 kb (Hồ Huỳnh Thùy Dương, 1998). 2.3.3.2. DNA mẫu Kết quả phản ứng PCR phụ thuộc rất lớn vào độ tinh sạch cũng như lượng DNA mẫu. Tuy nhiên, trong kỹ thuật chẩn đoán nhanh bằng PCR, DNA thu nhận trực tiếp từ dịch chiết tế bào nhưng kết quả vẫn tốt. Lượng DNA mẫu thường được sử dụng
  8. 17 là 100 ng. Lượng mẫu phù hợp có tác dụng hạn chế sự khuếch đại tạo các sản phẩm không mong muốn (Hồ Huỳnh Thùy Dương, 1998). 2.3.3.3. Enzyme DNA polymerase Enzyme được sử dụng đầu tiên là đoạn Klenow của DNA polymerase I.. Đây là enzyme không chịu nhiệt nên thao tác ph ức tạp và hiệu quả thấp. Phương pháp PCR trở nên thuận lợi hơn với việc phát hiện ra enzyme DNA polymerase chịu nhiệt được tách từ vi khuẩn Thermus aquaticus hiện diện trong suối nước nóng, viết tắt là Taq polymerase, không bị mất hoạt tính ở nhiệt độ biến tính DNA và có khả năng xúc tác tiổng hợp từ đầu đến cuối quá trình phản ứng. Một enzyme có nhiều chức năng chuyên biệt và hoàn thiện hơn là Tth polymerase được tách từ Thermus thermophilus, có khả năng hoạt động như một enzyme phiên mã ngược khi có mặt của RNA khuôn và Mn 2+ (khuếch đại bản mẫu RNA thông qua sự hình thành cDNA), ngược lại khi khuôn là DNA và có ion Mg2+, Tth polymerase lại xúc tác phản ứng khuếch đại DNA (Hồ Huỳnh Thùy Dương, 1998). 2.3.3.4. dNTP Mỗi loại dNTP thường được sử dụng với nồng độ từ 20 – 200 M. Nồng độ cao hơn sẽ dẫn đến việc tạo ra các sản phẩm không mong muốn. Sự mất cân bằng trong thành phần các nucleotide sẽ làm tăng các lỗi sao chép của polymerase (Hồ Huỳnh Thùy Dương, 1998). 2.3.3.5. Mg2+ và nồng độ Mg2+ Mg2+ là cofactor cho hầu hết các DNA polymerase, đặc biệt là các DNA polymerase chịu nhiệt. Nồng độ Mg2+ ảnh hưởng mạnh tới quá trình chạy PCR. Nồng độ Mg2+ quá thấp (< 0,5 mM) sẽ làm giảm phản ứng kéo dài mạch DNA do hoạt động của Taq polymerase bị ức chế. Nồng độ Mg2+ quá cao tuy ổn định mạch kép DNA nhưng lại hạn chế sự biến tình hoàn toàn sản phẩm trong mỗi chu kỳ dẫn đến giảm sản phẩm cuối cùng. Quá thừa Mg2+ dẫn đến sự bắt cặp sai giữa primer và khuôn, kết quả là tạo ra nhiều sản phẩm không đặc hiệu. Nồng độ tối ưu Mg2+ phải được xác định cho từng phản ứng qua nhiều thử nghiệm (Hồ Huỳnh Thùy Dương, 1998).
  9. 18 Những ứng dụng quan trọng của phản ứng PCR 2.3.4. Kể từ khi ra đời, phương pháp PCR ảnh hưởng sâu sắc tới các nghiên cứu về sinh học phân tử. Các ứng dụng tiêu biểu của PCR bao gồm: sản xuất mẫu dò dùng trong phương pháp lai phân tử, xác định trình tự acid nucleic, tạo đột biến điểm định hướng. Ngoài ra, PCR còn được ứng dụng trong nhiều lĩnh vực khác như: Trong y học, PCR được dùng trong chẩn đoán nhanh các bệnh có nguyên nhân là các vi sinh vật mà không có khả năng mọc trên môi trường nuôi cấy hoặc chậm phát triển như virus HIV, Mycobacterium tuberculosis, Chlamydia thông qua việc khuếch đại va phát hiện đoạn DNA đặc hiệu. Trong lĩnh vực pháp y, PCR được ứng dụng để thiết lập dấu vân tay DNA. Trong ngành khảo cổ học, PCR giúp khuếch đại những đoạn DNA c ủa những sinh vật đã tuyệt chủng như khủng long, voi răng mấu và những hóa thạch khác. Gần đây nhất là sự đóng góp thiết thực của kỹ thuật PCR trong việc giải mã bộ gen người. 2.4. Nguyên tắc đọc trình tự 2.4.1. Nguyên tắc phƣơng pháp đọc chuỗi mã Sanger Phương pháp đọc chuỗi mã Sanger dựa trên sự tổng hợp sợi DNA bổ sung của sợi cần được xác định trình tự. Trong các phản ứng tổng hợp sợi bổ sung, dideoxynucleotide được bổ sung vào thành phần phản ứng. Dideoxynucleotide (ddNTP) là các deoxynuckeotide đã được khử nhóm OH ở 3’, khi dideoxynucleotide gia nhập vào chuỗi, sự kéo dài chuỗi sẽ ngưng lại (Khuất Bửu Thanh, 2003). 2.4.2. Nguyên tắc giải trình tự gen bằng máy sequencer Nguyên tắc chung của máy giải trình tự gen tự động dựa trên cơ sở phương pháp dideoxy. Máy đọc trình tự cả trên hai mạch đơn, do vậy có thể phát hiện và giảm các nhầm lẫn do kỹ thuật. Cả hai loại primer xuôi và ngược đều được sử dụng để đọc cả hai mạch đơn DNA (Bùi Chí Bửu và Nguyễn Thị Lang, 1999). Giải trình tự theo phương pháp tự động không phải dùng chất phóng xạ mà sử dụng các chất huỳnh quang để đánh dấu DNA, máy sequencer có thể phát hiện cùng một lúc hiện tượng huỳnh quang ở bốn độ dài sóng khác nhau (Bùi Chí Bửu và Nguyễn Thị Lang, 1999).
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2