intTypePromotion=1
ADSENSE

Phát hiện các điểm đột biến trên gen gyra và parc của các chủng vi khuẩn lậu phân lập

Chia sẻ: Văng Thị Bảo Yến | Ngày: | Loại File: PDF | Số trang:6

56
lượt xem
1
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Bài viết Phát hiện các điểm đột biến trên gen gyra và parc của các chủng vi khuẩn lậu phân lập trình bày nghiên cứu về tình hình kháng kháng sinh và giải thích cơ chế đề kháng của vi khuẩn lậu là rất cần thiết. Tiến hành giải trình tự gen của 71 chủng vi khuẩn lậu được phân lập từ những bệnh nhân có hội chứng tiết dịch niệu đạo, âm đạo đến khám tại Bệnh viện Da liễu Trung ương nhằm tìm hiểu cơ chế đề kháng với kháng sinh ciprofloxacin của vi khuẩn lậu,... Mời các bạn cùng tham khảo.

Chủ đề:
Lưu

Nội dung Text: Phát hiện các điểm đột biến trên gen gyra và parc của các chủng vi khuẩn lậu phân lập

TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> <br /> PHÁT HIỆN CÁC ĐIỂM ĐỘT BIẾN TRÊN GEN GYRA VÀ PARC<br /> CỦA CÁC CHỦNG VI KHUẨN LẬU PHÂN LẬP<br /> Lê Văn Hưng<br /> Trường Đại học Y Hà Nội<br /> Nghiên cứu về tình hình kháng kháng sinh và giải thích cơ chế đề kháng của vi khuẩn lậu là rất cần thiết.<br /> Tiến hành giải trình tự gen của 71 chủng vi khuẩn lậu được phân lập từ những bệnh nhân có hội chứng tiết<br /> dịch niệu đạo, âm đạo đến khám tại Bệnh viện Da liễu Trung ương nhằm tìm hiểu cơ chế đề kháng với<br /> kháng sinh ciprofloxacin của vi khuẩn lậu. Kết quả cho thấy các chủng nhạy cảm có nồng độ ức chế tối thiểu<br /> (Minimum Inhibitory Concentratation - MIC) 0,002 - 0,060 µg/ml không có đột biến gen. Các chủng có MIC<br /> càng cao càng xuất hiện nhiều đột biến trên gen gyrA và parC. Trên gen gyrA: 100% số chủng có đột biến<br /> tại codon 91 (Ser thành Phe). 63,8% số chủng có đột biến tại codon 95 (Asp thành Ala), các đột biến ở vị trí<br /> khác có tần số thấp hơn. Trên gen parC: 44,9% số chủng có đột biến tại codon 87 (Ser thành Asn). Đột biến<br /> ở codon 86 và 91 xuất hiện với tần số thấp hơn.<br /> Từ khóa: vi khuẩn lậu, kháng kháng sinh, ciprofloxacin, đột biến gen<br /> <br /> I. ĐẶT VẤN ĐỀ<br /> Ciprofloxacin là một kháng sinh được chỉ<br /> định điều trị bệnh lậu với liều uống duy nhất<br /> (500 mg), vì vậy kháng sinh này được thầy<br /> thuốc và bệnh nhân rất ưa chuộng. Do đó,<br /> việc lạm dụng kháng sinh này đã dẫn tới tốc<br /> độ đề kháng đang tăng nhanh và nếu không<br /> có biện pháp can thiệp hữu hiệu, ciprofloxacin<br /> có thể trở thành kháng sinh không có tác dụng<br /> đối với vi khuẩn lậu trong thời gian tới. Nhiều<br /> nghiên cứu của các nhà khoa học trên thế giới<br /> như Trees D. L và cộng sự (1998) tại Trung<br /> tâm phòng chống bệnh xã hội Atlanta, Mỹ [1],<br /> Su X. và Lind I. (2001) tại Đan Mạch [2]... về<br /> những chủng vi khuẩn lậu kháng ciprofloxacin<br /> cho thấy: những chủng đề kháng với<br /> ciprofloxacin đều có những thay đổi trên gen<br /> gyrA và gen parC. Đó là các gen có liên quan<br /> đến kháng ciprofloxacin. Gen gyrA có độ dài<br /> Địa chỉ liên hệ: Lê Văn Hưng - Bộ môn Da liễu - Trường<br /> Đại học Y Hà Nội<br /> Email: levanhungvdl@yahoo.com<br /> Ngày nhận: 26/03/2013<br /> Ngày được chấp thuận: 20/6/2013<br /> <br /> TCNCYH 83 (3) - 2013<br /> <br /> 2.751 nucleotide, mã hoá 916 amino acid;<br /> vùng quyết định đề kháng quinolon dài khoảng<br /> 279 nucleotide, mã hoá 93 amino acid. Gen<br /> parC có độ dài 2.307 nucleotide, mã hoá 768<br /> amino acid; vùng quyết định đề kháng<br /> quinolon dài khoảng 255 nucleotide, mã hoá<br /> 85 amino acid. Những nghiên cứu về tình hình<br /> kháng kháng sinh, cơ chế đề kháng của vi<br /> khuẩn lậu là rất cần thiết và phải được tiến<br /> hành thường xuyên nhằm đóng góp hữu hiệu<br /> cho công tác phòng chống các bệnh lây truyền<br /> qua đường tình dục nói chung và bệnh lậu nói<br /> riêng. Xuất phát từ những lý do trên đề tài<br /> nghiên cứu được tiến hành nhằm mục tiêu:<br /> góp phần tìm hiểu cơ chế đề kháng với kháng<br /> sinh ciprofloxacin của vi khuẩn lậu.<br /> <br /> II. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP<br /> 1. Đối tượng<br /> Trong khoảng thời gian từ năm 2005 đến<br /> 2007, có 5.091 bệnh nhân có hội chứng tiết<br /> dịch niệu đạo, âm đạo đến khám tại bệnh viện<br /> Da liễu Trung ương, phân lập được 503<br /> chủng. Nghiên cứu này đã chọn ngẫu nhiên 6<br /> 35<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> tháng từ tháng 7 năm 2007 đến tháng 12 năm<br /> <br /> 3. Phương pháp<br /> <br /> 2007 được 71 chủng vi khuẩn lậu.<br /> <br /> 3.1. Kỹ thuật xác định vi khuẩn lậu<br /> <br /> 2. Vật liệu<br /> <br /> Nhuộm Gram →Nuôi cấy trên môi trường<br /> <br /> Tủ nuôi cấy CO2 Sanyo (Nhật Bản). Môi<br /> <br /> Thayer - Martin →Test Oxidase và Neisseria 4H<br /> <br /> trường Thayer - Martin, Neisseria 4H, Oxidase<br /> <br /> → Kết luận: Neisseria gonorrhoear → Tiến<br /> hành kỹ thuật kháng sinh đồ: sử dụng E - test<br /> để xác định MIC của vi khuẩn lậu.<br /> <br /> (Mỹ). Thanh giấy E - test (Thụy Điển). Chủng<br /> chuẩn: ATCC 49226 (WHO cung cấp) (bảng 1).<br /> <br /> Bảng 1. Các đoạn mồi dùng trong phản ứng PCR và giải mã trình tự gen [3]<br /> <br /> Trình tự mồi (5’ - 3’)<br /> <br /> Gen<br /> <br /> Kích thước đoạn gen<br /> được khuếch đại<br /> <br /> Mồi xuôi<br /> Mồi ngược<br /> <br /> CGGCGCGTACTGTACGCGATGCA<br /> AATGTCTGCCAGCATTTCATGTGAGA<br /> <br /> GyrA<br /> <br /> 279bp<br /> <br /> Mồi xuôi<br /> Mồi ngược<br /> <br /> ATGCGCGATATGGGTTTGAC<br /> GGACAACAGCAATTCCGCAA<br /> <br /> ParC<br /> <br /> 255bp<br /> <br /> Thiết kế<br /> <br /> 3.2. Quy trình PCR đối với gen gyrA và<br /> gen parC<br /> Sử dụng hóa chất của hãng Bio - rad (Hoa<br /> Kỳ) với 2 cặp mồi đặc hiệu để tiến hành quy<br /> trình PCR đối với gen gyrA và gen parC.<br /> Thành phần phản ứng: Dung dịch đệm 10x<br /> (5 ml); dNTP 10 mM (1 ml); MgCl2 50 mM (1,5<br /> <br /> 3.3. Quy trình giải trình tự gen<br /> Quy trình giải trình tự đoạn gen có thể<br /> chứa đột biến được thực hiện theo quy trình<br /> hướng dẫn của hãng.<br /> a. Tinh sạch sản phẩm PCR bằng MinElute<br /> PCR Purification Kit:<br /> Thêm 200 ml buffer PB vào 40 ml sản<br /> <br /> ml); Taq polymerase 5 UI/ml (0,5 ml); Dung<br /> dịch DNA (5 ml); Mồi xuôi 10 mM (2,5 ml); Mồi<br /> <br /> phẩm PCR, trộn đều bằng pipet. Cho toàn bộ<br /> <br /> ngược 10 mM (2,5 ml); Nước khử ion (32 ml).<br /> Tổng thể tích là 50 ml.<br /> <br /> dịch vào cột chiết tách. Ly tâm 13.000 vòng/<br /> phút trong 1 phút. Hút bỏ phần dịch lọc. Thêm<br /> <br /> - Chu kỳ nhiệt:<br /> 93oC 3 phút - [93oC 30 giây - 52oC 1 phút 72 C 1 phút] x 30 chu kì - 72oC 5 phút.<br /> o<br /> <br /> - Sản phẩm khuếch đại gen<br /> Điện di sản phẩm PCR trên gel agarose<br /> <br /> 750 ml buffer PE, ly tâm 13.000 vòng/phút<br /> trong 1 phút. Hút bỏ dịch lọc. Ly tâm thêm<br /> 20.000 vòng/phút trong 1 phút. Chuyển cột<br /> chiết tách sang ống ly tâm 1,5 ml. Thêm 20 ml<br /> buffer EB vào chính giữa cột chiết tách. Để ở<br /> <br /> 1,5% trong dung dịch đệm TBE 1x. Bản thạch<br /> sau khi chạy điện di được ngâm trong dung<br /> <br /> nhiệt độ phòng 1 phút, sau đó ly tâm 10.000<br /> vòng/phút. Bảo quản ở -20oC.<br /> <br /> dịch ethidium bromid 0,5 mg/ml trong 30 phút,<br /> <br /> b. Phản ứng giải trình tự (Sequencing<br /> Reaction).<br /> <br /> rửa qua nước cất. Chụp ảnh bản gel trong<br /> buồng tối dưới ánh sáng cực tím. Sản phẩm<br /> PCR được dùng để giải trình tự.<br /> 36<br /> <br /> Sử dụng cặp mồi đặc hiệu cho gen gyrA và<br /> gen parC.<br /> TCNCYH 83 (3) - 2013<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> ABI PRISM Dye Terminator Cycle Sequencing<br /> <br /> Ly tâm 14.000 vòng/phút trong 20 phút. Hút bỏ<br /> <br /> Core Kit: Pha Premix gồm 5X sequencing<br /> buffer (4 ml); dNTP mix (1 ml); A dye<br /> <br /> dịch nổi. Thêm 200 ml cồn 70%. Ly tâm<br /> 14.000 vòng/phút trong 5 phút. Hút bỏ dịch<br /> <br /> terminator (0,5 ml); C dye terminator (0,5 ml);<br /> G dye terminator (0,5 ml); T dye terminator<br /> <br /> nổi. Để khô ở nhiệt độ phòng, tránh ánh sáng.<br /> Hoà tan bằng 25 ml final buffer.<br /> <br /> (0,5 ml); AmpliTaq (1 ml).<br /> Thành phần phản ứng: Premix 8µl, sản<br /> phẩm PCR sau tinh sạch 5µl, mồi 3,2 pmol,<br /> nước cất vừa đủ 20µl.<br /> Chu kỳ nhiệt:<br /> 96oC 10 giây – [96oC 10 giây – 50oC 5 giây<br /> – 60oC 4 phút] x 25 chu kỳ - 4oC 1 phút<br /> c. Tinh sạch sản phẩm<br /> <br /> - Đọc kết quả bằng máy ABI PRISM 310<br /> của hãng Applied Biosystem.<br /> Trình tự các nucleotide ở các mẫu nghiên<br /> cứu được so sánh với trình tự nucleotide của<br /> gen gyrA và parC của chủng vi khuẩn lậu gốc<br /> để tìm ra các điểm khác nhau với chủng gốc.<br /> <br /> III. KẾT QUẢ<br /> <br /> Thêm vào 20 ml sản phẩm sequencing: 3<br /> ml KCH3COO 3M pH = 7,0; 14,5 µl nước cất;<br /> 62,5 µl cồn 100%. Để nhiệt độ phòng 15 phút.<br /> <br /> 1. Kết quả điện di sản phẩm PCR xác<br /> định đoạn gen gyrA, parC<br /> <br /> Hình 1. Kết quả điện di sản phẩm PCR<br /> <br /> Hình 2. Kết quả điện di sản phẩm PCR<br /> <br /> xác định đoạn gen gyrA<br /> Giếng 1: chứng âm<br /> <br /> xác định đoạn gen ParC<br /> Giếng 1: chứng âm<br /> <br /> Giếng 2: chứng dương<br /> Giếng 3: thang ADN 100 bp<br /> <br /> Giếng 2: chứng dương<br /> Giếng 3: thang ADN 100 bp<br /> <br /> Giếng 4 đến 7: kết quả dương tính<br /> <br /> Giếng 4 đến 7: kết quả dương tính<br /> <br /> TCNCYH 83 (3) - 2013<br /> <br /> 37<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> 2. Trình tự nucleotid của đoạn gen gyrA chứa đột biến (mũi tên đánh dấu điểm đột biến)<br /> <br /> 3. Trình tự nucleotid của đoạn gen parC chứa đột biến (mũi tên đánh dấu điểm đột biến)<br /> <br /> IV. BÀN LUẬN<br /> <br /> vậy, MIC cũng có mối liên quan với số lượng<br /> <br /> vi khuẩn lậu gồm: 2 chủng nhạy cảm và 69<br /> <br /> đột biến [4]. Với MIC nhỏ, mang ít đột biến.<br /> MIC lớn mang nhiều đột biến hơn. Kết quả<br /> <br /> chủng đề kháng. Phân tích các đột biến trên<br /> gen gyrA và parC và sự phối hợp giữa các đột<br /> <br /> này tương đồng với những nghiên cứu của<br /> các tác giả trên thế giới [5, 6, 7]. Tuy nhiên,<br /> <br /> biến trên 2 gen này cho thấy: tất cả những<br /> chủng đề kháng đều có đột biến trên 2 gen<br /> <br /> nghiên cứu này thu được kết quả khác với các<br /> tác giả các tác giả trên thế giới là những<br /> <br /> gyrA và parC, số lượng đột biến cũng tăng<br /> theo nồng độ MIC. 2 chủng nhạy cảm MIC<br /> <br /> chủng kháng ciprofloxacin đều có đột biến trên<br /> <br /> Nghiên cứu giải trình tự gen của 71 chủng<br /> <br /> 0,002 - 0,060 µg/ml (2,8%) không có thay đổi<br /> <br /> gen gyrA tại codon 91 (Ser thành Phe). Điều<br /> này có thể do những chủng vi khuẩn lậu lây<br /> <br /> nào trong trình tự DNA. 11 chủng đề kháng có<br /> MIC 1 - 2 µg/ml (tỷ lệ 15,5%) mang 2 đột biến<br /> <br /> truyền hiện nay tại Việt Nam có nguồn gốc từ<br /> cùng một chủng và mang tính khu vực [8]. Kết<br /> <br /> trên gen gyrA và không mang đột biến trên<br /> gen parC. 6 chủng đề kháng có MIC 1 - 2 µg/<br /> <br /> quả của nghiên cứu thu được đã chứng minh<br /> rằng sự đề kháng của vi khuẩn lậu với<br /> <br /> ml (8,5%) mang 3 đột biến trên cả 2 gen gyrA<br /> <br /> ciprofloxacin, loại thuốc được xem như liệu<br /> <br /> và parC; 52 chủng đề kháng có MIC 3 - 32 µg/<br /> ml (73,2%) mang 3 đột biến gồm 2 đột biến ở<br /> <br /> pháp hàng đầu vào những năm 1990, đã tăng<br /> lên nhanh chóng ở mức MIC cao đáng báo<br /> <br /> codon 91 (Ser thành Phe) và codon 95 (Asp<br /> thành Ala) của gen gyrA, và 1 đột biến ở<br /> <br /> động với các đột biến mới ở vi khuẩn lậu. Do<br /> đó sự giám sát liên tục về tính kháng kháng<br /> <br /> codon 87 (Ser thành Asn) của gen parC. Như<br /> <br /> sinh, với khuynh hướng ngày càng gia tăng<br /> <br /> 38<br /> <br /> TCNCYH 83 (3) - 2013<br /> <br /> TẠP CHÍ NGHIÊN CỨU Y HỌC<br /> những chủng đa đề kháng lan truyền trong<br /> cộng đồng là rất cần thiết để có thể tránh<br /> những thất bại trong điều trị.<br /> <br /> 3. Otero, L., et al (2001). First Isolate of a<br /> Neisseria gonorrhoeae Strain<br /> <br /> Associated<br /> <br /> With an Ofloxacin Treatment Failure in Spain.<br /> Sex Transm Dis, 28(10), 576 - 578.<br /> <br /> V. KẾT LUẬN<br /> <br /> 4. Xu J. S., Wang B., Wang C. X., et al<br /> <br /> Ciprofloxacin thuộc nhóm quinolon. Đích<br /> <br /> (2006). Study on fluoroquinolone<br /> <br /> resistance<br /> <br /> tác động của nhóm kháng sinh này là ADN<br /> gyrase và topoisomerase IV của vi khuẩn. Sự<br /> <br /> and the relationship between resistance and<br /> <br /> đột biến của vi khuẩn lậu (tại gen gyrA và<br /> parC làm thay đổi đích kháng sinh, do đó dẫn<br /> <br /> orrhoeae. Zhonghua Liu Xing Bing Xue Za Zhi,<br /> <br /> đến sự đề kháng với kháng sinh ciprofloxacin<br /> của vi khuẩn lậu.<br /> <br /> 5. Shultz T. R., Tapsall J. W., White P. A.<br /> (2001). Correlation of in vitro susceptibilities to<br /> <br /> Lời cảm ơn<br /> <br /> newer quinolones of naturally occurring quino-<br /> <br /> Xin cảm ơn sự giúp đỡ chân thành từ<br /> PGS.TS. Trần Hậu Khang, ThS. Trần Mẫn<br /> Chu, ThS. Phạm Đăng Bảng, PGS.TS.<br /> Nguyễn Vũ Trung, CN. Ninh Thị Dần, CN. Lê<br /> Phương Thảo bệnh viện Da liễu Trung ương<br /> và GS.TS. Norihisa Ishii, Viện truyền nhiễm<br /> quốc gia, Nhật Bản.<br /> <br /> mutations of gyrA and parC in Neisseria gon27(8), 702 - 704.<br /> <br /> lone-resistant Neisseria gonorrhoeae strains<br /> with changes in gyrA and parC. Antimicrob<br /> Agents Chemother, 45(3), 734 - 738.<br /> 6. Tanaka M., Nakayama H., Haraoka M.,<br /> et al (2000). Antimicrobial resistance of Neisseria gonorrhoeae and high prevalence of<br /> ciprofloxacin-resistant solates in Japan, 1993<br /> to 1998. J Clin Microbiol, 38(2), 521 - 525.<br /> <br /> TÀI LIỆU THAM KHẢO<br /> <br /> 7. Zhang T., Zhou X., Chen Y., et al.<br /> <br /> 1. Trees D. L., Sandul A. L., Whittington<br /> W. L et al (1998). Identification of novel mutation patterns in the parC gene of ciprofloxacinresistant isolates of Neisseria gonorrhoeae. Anti-<br /> <br /> (2009). Fluoroquinolone resistance and mutation patterns in gyrA and parC genes in<br /> Neisseria gonorrhoeae isolates from Shanghai, China. J Huazhong Univ Sci Technolog<br /> <br /> microb Agents Chemother, 42(8), 2103 - 2105.<br /> 2. Su X., Lind I (2001). Molecular basis of<br /> high - level ciprofloxacin resistance in Neisseria gonorrhoeae strains isolated in Denmark<br /> <br /> Med Sci, 29(1), 29 - 34.<br /> <br /> from<br /> <br /> Neisseria<br /> <br /> 1995<br /> <br /> to<br /> <br /> 1998.<br /> <br /> Antimicrob<br /> <br /> Chemother, 45(1), 117 - 123.<br /> <br /> Agents<br /> <br /> 8. Chaudhry U., Ray K., Bala M., et al<br /> (2002). Mutation patterns in gyrA and parC<br /> genes of ciprofloxacin resistant isolates of<br /> gonorrhoeae<br /> <br /> from<br /> <br /> India.<br /> <br /> Sex<br /> <br /> Transm Infect, 78(6), 440 - 444.<br /> <br /> Summary<br /> MUTATIONS IN GYRA AND PARC GENES OF<br /> NEISSERIA GONORRHOEAE ISOLATED FROM PATIENTS<br /> We study the antibiotic resistance and resistance mechanisms of N. gonorrhoeae. We<br /> sequenced a part of gyrA and parC genes of 71 strains from patients admitted at the National<br /> Hospital for Dermatology and Venereology with urethral and vaginal discharges to understand the<br /> resistance mechanisms to ciprofloxacin. Ciprofloxacin-susceptible strains (MIC 0,002-0,060 µg/<br /> TCNCYH 83 (3) - 2013<br /> <br /> 39<br /> <br />
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD


intNumView=56

 

Đồng bộ tài khoản
2=>2