TÌM KIẾM TRÌNH TỰ SINH HỌC VÀ ĐĂNG KÝ TRÌNH TỰ TRÊN CƠ SỞ DỮ LIỆU

Chia sẻ: Nguyen Lan | Ngày: | Loại File: PPT | Số trang:47

0
52
lượt xem
29
download

TÌM KIẾM TRÌNH TỰ SINH HỌC VÀ ĐĂNG KÝ TRÌNH TỰ TRÊN CƠ SỞ DỮ LIỆU

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Phương pháp Sanger: là phương pháp dựa trên sự tổng hợp gián đoạn DNA. Dựa theo phương pháp này chúng ta có thể xác định được trình tự nucleotide của DNA hay RNA (ATGC…TTT)

Chủ đề:
Lưu

Nội dung Text: TÌM KIẾM TRÌNH TỰ SINH HỌC VÀ ĐĂNG KÝ TRÌNH TỰ TRÊN CƠ SỞ DỮ LIỆU

  1. TÌM KIẾM TRÌNH TỰ SINH HỌC VÀ ĐĂNG KÝ TRÌNH TỰ TRÊN CƠ SỞ DỮ LIỆU
  2. Mục tiêu của bài học Có khả tìm kiếm được những trình tự sinh học  như DNA, RNA, Protein. Đăng ký những trình tự đã nghiên cứu được lên Cơ  sở dữ liệu sinh học bằng phần mềm Sequin. 2 Tìm kiếm trình tự sinh học
  3. Nguyên tắc trong giải trình tự Phương pháp Sanger: là phương pháp dựa trên sự  tổng hợp gián đoạn DNA. Dựa theo phương pháp này chúng ta có thể xác định  được trình tự nucleotide của DNA hay RNA (ATGC… TTT) 3 Tìm kiếm trình tự sinh học
  4. Nhiễm sắc thể, DNA, Gene, Nucleotide 4 Giới thiệu môn học
  5. Gửi trình tự lên Genebank của NCBI Sequin Đưa vào cơ sở dữ liệu sinh học: Trình tự đã giải -NCBI - Các cơ sở dữ liệu khác 5 Giới thiệu môn học
  6. Nguyên tắc tìm kiếm trình tự sau khi đã giải trình tự .Tìm bằng từ khóa: 2.Công cụ tìm kiếm -Mã số truy cập Kết quả -Tên (gene hay Protein) cần tìm -GI -Độ dài trình tự -Trọng lượng phân tử -Tên tác giả giải trình tự 6 Tìm kiếm trình tự sinh học
  7. Tìm kiếm trình tự sinh học qua NCBI Click 7 Tìm kiếm trình  tự sinh học
  8. Tìm kiếm trình tự DNA 8 Tìm kiếm trình tự sinh học
  9. Tìm kiếm trình tự qua mã số truy cập Mã số truy cập của một trình tự là mã số do các nhà quản trị CSDLSH đặt cho một trình tự, thường có dạng : 8 ký tự : 2 chữ và 6 số ví dụ như AY690640 6 ký tự : 1 chữ và 5 số ví dụ như U20068 9 Tìm kiếm trình tự sinh học
  10. TÌM KIẾM TRÌNH TỰ SINH HỌC QUA MÃ SỐ TRUY CẬP 10 Tìm kiếm trình tự sinh học
  11. Kết quả tìm trình tự DNA qua mã số truy cập 11 Giới thiệu môn học
  12. Tìm kiếm trình tự qua tên gene 12 Tìm kiếm trình tự sinh  học
  13. 13 Tìm kiếm trình  tự sinh  học
  14. Cách lấy trình tự theo định dang FASTA 14 Giới thiệu môn học
  15. Định dạng FASTA FASTA là một giải thuật bắt cặp trình tự được  David J. Lipman và William R. Pearson miêu tả lần đầu tiên vào năm 1985 ( Rapid and sensitive protein similarity searches).  Nhiều phần mềm tin sinh học cần dữ liệu trình tự gene hoặc protein theo kiểu định dạng FASTA như ví dụ minh hoạ dưới đây: >tên trình tự gattctcacttggtctgctgcaaggacgcggaccattaaaactgttcatggcccttgtggcgttctcgttt cctaacaatcccaccaacagcagggatactaaaaagatggggaacgatcaaaaaatcaaaagctatc aatgtcttgagagggttcaggaaagagattggaaggatgctgaacatcttgaacaggagacgcagga cagcaggcgtgattgttatgttgattccacagcgatggcgttccatttaaccacacgcaatgg 15 Tìm kiếm trình tự sinh học
  16. Một số mã số truy cập của RefSeq database 1. mRNAs and Proteins  NM_123456 Curated mRNA  NP_123456 Curated Protein  NR_123456 Curated non-coding RNA  XM_123456 Predicted mRNA  XP_123456 Predicted Protein  XR_123456 Predicted non-coding RNA 2. Chromosome NC_123455 Microbial replicons, organelle genomes, human chromosomes 4. Assemblies NT_123456 Contig 16 Tìm kiếm trình tự sinh  học
  17. Ví dụ 1: NM_123456 Curated mRNA NM_123456 17 Tìm kiếm trình s sinh  học
  18. V í dụ 2: NC_12345 18 Giới thiệu môn học
  19. Kết quả tìm kiếm bộ gene 19 Giới thiệu môn học
  20. Thẻ giới hạn phạm vi tìm kiếm DNA [ALL] : Tất cả các trường tìm kiếm  [ACCN]: Mã số truy cập của trình tự - Accession  number : Số gi [GI]  [AUTH] : Tên tác giả giải trình tự- author name  [PDAT] : Ngày trình tự được chỉnh sửa hay ngày trình  tự được cập nhật (update) – publication date [ORGN] : Sinh vật chứa trình tự đó - organism  [TITL] :Định nghĩa trình tự trong mẫu tin – title  [SLEN] :Chiều dài của trình tự - Sequence length  [GENE] : Tên gene  20 Tìm kiếm  trình  tự môn học

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản