intTypePromotion=1

Tóm tắt luận án Tiến sĩ Nông nghiệp: Đánh giá nguồn gen và phân tích chỉ thị phân tử liên quan tính trạng năng suất trứng ở giống gà Liên Minh

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:27

0
6
lượt xem
0
download

Tóm tắt luận án Tiến sĩ Nông nghiệp: Đánh giá nguồn gen và phân tích chỉ thị phân tử liên quan tính trạng năng suất trứng ở giống gà Liên Minh

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục tiêu nghiên cứu của luận án nhằm đánh giá được sự đa dạng di truyền gà Liên Minh sử dụng trình tự nucleotide D-loop ADN ty thể và xác định mối quan hệ di truyền, xuất xứ của gà Liên Minh. Xác định được mối liên quan di truyền giữa các gen ứng viên (PRL, VIP, VIPR1, NPY, GH, GHR) với tính trạng năng suất trứng ở gà Liên Minh.

Chủ đề:
Lưu

Nội dung Text: Tóm tắt luận án Tiến sĩ Nông nghiệp: Đánh giá nguồn gen và phân tích chỉ thị phân tử liên quan tính trạng năng suất trứng ở giống gà Liên Minh

  1. BỘ GIÁO DỤC VÀ ĐÀO TẠO BỘ NÔNG NGHIỆP VÀ PTNT VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM TRẦN THỊ BÌNH NGUYÊN ĐÁNH GIÁ NGUỒN GEN VÀ PHÂN TÍCH CHỈ THỊ PHÂN TỬ LIÊN QUAN TÍNH TRẠNG NĂNG SUẤT TRỨNG Ở GIỐNG GÀ LIÊN MINH Chuyên ngành : Công nghệ sinh học Mã số : 9420201 TÓM TẮT LUẬN ÁN TIẾN SĨ NÔNG NGHIỆP Hà Nội, 2019
  2. Công trình hoàn thành tại: Viện Khoa học Nông nghiệp Việt Nam Người hướng dẫn khoa học: TS. Nguyễn Thị Diệu Thúy TS. Nguyễn Hữu Đức Phản biện 1: ……………………………………………… Phản biện 2 ……………………………………………… Phản biện 3: ……………………………………………… Luận án sẽ được bảo vệ trước Hội đồng đánh giá luận án cấp viện họp tại Viện Khoa học Nông nghiệp Việt Nam, vào hồi giờ ngày tháng năm Có thể tìm hiểu luận án tại thư viện: - Thư viện Quốc gia Việt Nam - Thư viện Viện Khoa học Nông nghiệp Việt Nam - Thư viện ...
  3. DANH MỤC CÔNG TRÌNH CÔNG BỐ LIÊN QUAN ĐẾN LUẬN ÁN 1. Tran Thi Binh Nguyen, Nguyen Huu Duc, Do Vo Anh Khoa, Nguyen Thi Dieu Thuy (2018), “Effect of nucleotide polymorphism of candidate genes on egg production traits in native Lien Minh chicken”, Livestock Research for Rural Development 30(6). 2. Tran Thi Binh Nguyen, Nguyen Huu Duc, Vu Duc Quy, Pham Thu Giang, Nguyen Manh Linh, Dinh Thi Ngoc Thuy, Nguyen Thi Dieu Thuy (2018) “Polymorphism in candidate genes of Lien Minh chicken”, Vietnam Journal of Agricultural Sciences 1(2), tr. 174-182. 3. Trần Thị Bình Nguyên, Nguyễn Hùng Cường, Vũ Thị Tiến, Tạ Thị Loan, Đỗ Võ Anh Khoa, Nguyễn Thị Diệu Thuý (2018).,“Đa hình gen Neuropeptide y (NPY) liên quan tính trạng năng suất trứng ở gà Liên Minh”, Hội nghị khoa học Công nghệ sinh học toàn quốc, Hà Nội 26/10/2018, tr. 1828-1833. 4. Trần Thị Bình Nguyên, Nguyễn Hữu Đức, Nguyễn Thị Diệu Thuý (2018), ”Đa hình gen prolactin liên quan tính trạng sản xuất trứng ở giống gà liên Minh”, Tạp chí công nghệ sinh học, 16(2), tr. 1-8. 5. Trần Thị Bình Nguyên, Đỗ Thị Liễu, Nguyễn Hữu Đức, Hoàng Thị Yến, Vũ Công Quy, Nguyễn Hùng Cường và Nguyễn Thị Diệu Thúy (2016),” Khả năng sinh sản và đa hình ứng cử gen liên quan tính trạng sản xuất trứng ở giống gà Liên Minh”, Tạp chí Khoa học kỹ thuật chăn nuôi, số 212, tr. 2-8
  4. MỞ ĐẦU 1. TÍNH CẤP THIẾT CỦA ĐỀ TÀI Gà Liên Minh là giống gà bản địa của huyện đảo Cát Hải, thành phố Hải Phòng, Việt Nam. Gà Liên Minh thích hợp với nuôi chăn thả, chịu đựng tốt điều kiện thức ăn nghèo dinh dưỡng, khả năng đề kháng rất cao. Nhu cầu của thị trường về con giống và sản phẩm thịt gà Liên Minh rất lớn. Tuy nhiên, khả năng sinh sản của gà Liên Minh khá thấp, nghiên cứu trên 30 hộ tại xã Trân Châu, huyện Cát Hải, thành phố Hải Phòng đã chỉ ra rằng gà Liên Minh nuôi tại hộ theo phương thức chăn thả có tuổi thành thục muộn (đẻ trứng ở 197,5 ngày tuổi) và sản lượng trứng khá thấp (75,6 quả/mái/năm) (Doan BH et al, 2016). Trong lúc đó sản lượng trứng ở gà Ri hoa mơ tại 38 tuần tuổi đạt 58,99 quả/mái (Ngô Thị Kim Cúc và cs, 2014). Vì vậy, vấn đề cải thiện năng suất trứng ở gà Liên Minh là cấp thiết nhằm bảo tồn, khai thác và phát triển giống gà Liên Minh. Sản lượng trứng ở gà là kết quả tác động từ các yếu tố: Di truyền, dinh dưỡng, ánh sáng, chế độ chăm sóc thú y. Hiện nay, các đa hình gen đang được nghiên cứu nhằm cải thiện các đặc điểm kinh tế ở gà bản địa. Các đa hình gen PRL (Prolactin), VIP (Vasoactive Intestinal Peptide), VIPR1 (Vasoactive Intestinal Peptide Receptor 1), NPY (Neuropeptide Y), GH (Growth hormone) và GHR (Growth hormone receptor), đã được xác định liên quan đến khả năng sinh sản ở một số giống gà bản địa trên thế giới. Một số đa hình gen có thể ứng dụng như những chị thị ADN, nhằm cải thiện năng suất trứng ở gà bản địa. Mặt khác, chưa có một nghiên cứu nào đánh giá về đa dạng nguồn gen dựa trên trình tự nucleotide vùng D-loop gen ty thể ở gà Liên Minh. Kết quả của nghiên cứu này có thể sử dụng nhằm cung cấp thông tin về đa dạng di truyền, hỗ trợ cho việc đăng ký bản quyền giống gà Liên Minh, đồng thời góp phần xây dựng bức tranh toàn cảnh về mức độ đa dạng di truyền của các giống gà bản địa. Vì vậy, Đánh giá nguồn gen và phân tích chỉ thị phân tử liên quan tính trạng năng suất trứng ở giống gà Liên Minh nhằm cung cấp thông tin di truyền vùng D- loop gen ty thể và các gen ứng viên có thể cải thiện khả năng sản xuất trứng, hỗ trợ công tác bảo tồn khai thác và phát triển giống gà Liên Minh. 2. MỤC TIÊU NGHIÊN CỨU - Đánh giá được sự đa dạng di truyền gà Liên Minh sử dụng trình tự nucleotide D-loop ADN ty thể và xác định mối quan hệ di truyền, xuất xứ của gà Liên Minh. - Xác định được mối liên quan di truyền giữa các gen ứng viên (PRL, VIP, VIPR1, NPY, GH, GHR) với tính trạng năng suất trứng ở gà Liên Minh. 1
  5. 3. Ý NGHĨA KHOA HỌC VÀ THỰC TIỄN CỦA ĐỀ TÀI 3.1. Ý nghĩa khoa học Cung cấp thông tin khoa học đầu tiên về trình tự nucleotide vùng D-loop gen ty thể ở giống gà Liên Minh. Tài liệu khoa học đầu tiên nghiên cứu tần số xuất hiện alen/kiểu gen tại các đa hình gen PRL, VIP, VIPR1, NPY, GH, GHR trên đối tượng gà Liên Minh; bước đầu đánh giá mối liên quan giữa đa hình gen PRL, VIP, VIPR1, NPY, GH, GHR với khả năng sản xuất trứng. Kết quả nghiên cứu về tính đa hình gen ứng viên với tính trạng sản lượng trứng là cơ sở khoa học trong nghiên cứu ứng dụng chỉ thị phân tử hỗ trợ chọn lọc gà Liên Minh có năng suất trứng cao, đồng thời cung cấp thông tin về gà Liên Minh cho các nhà chọn giống, tài liệu tham khảo cho các nhà nghiên cứu, sinh viên và những người quan tâm về gà bản địa. 3.2. Ý nghĩa thực tiễn Cung cấp cơ sở khoa học góp phần xây dựng thương hiệu gà Liên Minh. Cung cấp thông tin có căn cứ khoa học để quảng bá và phát triển thị trường tiêu thụ sản phẩm đặc sản gà Liên Minh. Cung cấp thông tin để Trung tâm ứng dụng tiến bộ Khoa học và Công nghệ Hải phòng, các công ty, cơ sở chăn nuôi hỗ trợ chọn lọc các đàn gà Liên Minh hạt nhân cãi thiện sản lượng trứng. 4. NHỮNG ĐÓNG GÓP MỚI CỦA ĐỀ TÀI - Đánh giá được nguồn gen gà Liên Minh: Phân tích được trình tự nucleotide vùng D-loop gen ty thể gà Liên Minh để đánh giá mức độ đa dạng nguồn gen. - Xác định được tần số alen/kiểu gen gà Liên Minh: Đã xác định được tần số alen/kiểu gen PRL, VIP, VIPR1, NPY, GH, GHR của gà Liên Minh. - Đánh giá được mối liên quan giữa đa hình gen và tính trạng năng suất trứng: Nghiên cứu đầu tiên trên giống gà Liên Minh về mối liên quan giữa đa hình gen PRL, VIP, VIPR1, NPY, GH, GHR với khả năng sản xuất trứng. 5. ĐỐI TƯỢNG VÀ PHẠM VI NGHIÊN CỨU CỦA ĐỀ TÀI 5.1. Đối tượng nghiên cứu Gà bản địa Liên Minh thuộc Thôn Liên Minh - Xã Trân Châu - Huyện Cát Hải - Thành phố Hải Phòng. 5.2. Phạm vi nghiên cứu Đề tài ứng dụng công nghệ sinh học và các công cụ tin sinh học để phân tích đa dạng di truyền gà Liên Minh, phục vụ công tác bảo tồn, khai thác và phát triển giống gà Liên Minh. 2
  6. Đề tài tập trung nghiên cứu các gen ứng viên liên quan đến khả năng sản xuất trứng, từ đó có thể xác định được các gen mục tiêu, phục vụ công tác chọn lọc giống gà Liên Minh có năng suất trứng cao. 6. Bố cục của luận án Luận án được trình bày trong 107 trang (không kể phần tài liệu tham khảo và phụ lục): Mở đầu (3 trang); chương 1: Tổng quan tài liệu (36 trang); chương 2: Vật liệu, nội dung và phương pháp nghiên cứu (13 trang); chương 3: Kết quả nghiên cứu và thảo luận (61 trang); Kết luận và đề nghị (2 trang). Tài liệu tham khảo được sử dụng là 177, trong đó có 32 tài liệu tiếng Việt và 145 tài liệu tiếng Anh. Luận án có 34 bảng, 44 hình, 3 phụ lục, 5 công trình đã công bố. CHƯƠNG I. TỔNG QUAN TÀI LIỆU Luận án đã sử dụng và phân tích 33 tài liệu tham khảo bằng tiếng Việt và 147 tài liệu bằng tiếng Anh, liên quan đến các nội dung sau: Ty thể (Mitochondria) là bào quan có mặt ở hầu hết tất cả các sinh vật nhân chuẩn, với bộ gen riêng kích thước bộ gen phân tử khoảng 16 kb. DNA ty thể với đặc điểm: i) số lượng bản sao lớn; ii) tồn tại ở dạng đơn bội và hầu như không có hiện tượng tái tổ hợp; iii) tốc độ đột biến tương đối nhanh (so với các locus của hệ gene nhân) và iv) di truyền theo dòng mẹ ở phần lớn các loài, vì thế nó được sử dụng như một công cụ trong phân tích mối quan hệ tiến hoá và đánh giá biến đổi di truyền trong và giữa các loài (Harpending et al., 1998). Trình tự nucleotide vùng D-loop là vùng có mức độ tiến hóa nhanh nhất so với các vùng khác của mtDNA, do vậy đây là vùng rất thích hợp trong phân tích sự đa dạng di truyền quần thể, đặc biệt các thay đổi bên trong của cùng 1 loài. Để cải thiện khả sinh sản ở gà Liên Minh cần nghiên cứu mối liên quan giữa đặc điểm sinh sản với các gen ứng viên. Các gen ứng viên được lựa chọn xuất phát từ kiến thức sinh lý sinh sản và các báo cáo về ảnh hưởng của các gen ứng viên đến khả năng sinh sản trong các dòng gia cầm thương mại. Hormone prolactin là một polypeptide được tiết ra bởi tuyến yên trước, có liên quan có ảnh hưởng lớn tới sinh lý như: Điều hòa thẩm thấu, luteolysis (buồng trứng thoái hóa), kiểm soát và duy trì hành vi đòi ấp ở gà mái. Các nghiên cứu đã chỉ ra rằng PRL xuất hiện ở vùng dưới đồi, tuyến yên, ống dẫn trứng và trứng, với mức độ cao nhất được tìm thấy trong tuyến yên (Li và cs, 2009a). Ở gà, hormone prolactin là một trong những hormone đóng vai trò quan trọng trong sản xuất trứng. Nồng độ prolactin tăng mạnh trong huyết tương, có thể gây ra hành vi ấp trứng (Sockman và cs, 2000) và dẫn đến giảm sản xuất trứng (Reddy và cs, 2002). Một đột biến xảy ra trong vùng điều khiển (promotor) có thể ảnh hưởng đến sự biểu hiện của gen PRL, do đó nó có thể ảnh hưởng đến sản xuất trứng. Sự tiết prolactin ở chim chủ yếu được điều hòa bởi các yếu tố giải phóng, một trong số 3
  7. đó là peptite Vasoactive (Kagya-Agyemang và cs, 2012). Peptite Vasoactive (VIP) là một yếu tố giải phóng prolactin ở chim (ElL Halawani et al.et al., 1990; 1997). Neuropeptide Y (NPY) là một chất điều chế thần kinh quan trọng, có liên quan đến chức năng tuyến sinh dục ở chim và động vật có vú (Hilal et al.et al., 1996). NPY có thể ảnh hưởng đến tốc độ sản xuất trứng thông qua vai trò của nó trong kiểm soát rụng trứng (Dunn et al.et al., 2004). Gen mã hóa neuropeptite Y liên quan đến tuổi thành thục sinh dục và sản lượng trứng (Xu và cs, 2011a; Xu và cs, 2011a; Dunn và cs, 2004; Li và cs, 2009b). Gen NPY có thể tạo ra các dấu hiệu cho tuổi bắt đầu đẻ và thông qua vai trò của nó trong việc kiểm soát rụng trứng, ảnh hưởng đến tốc độ sản xuất trứng. Tiêm NPY làm thay đổi nồng độ hormone luteinizing và hormone tăng trưởng trong huyết tương (Pierroz et al.et al., 1996). Hormon tăng trưởng (GH), khi kết hợp với thụ thể hoóc môn tăng trưởng hình thành đường dẫn tín hiệu GH-GHR- IGFs, ảnh hưởng đến sự phát triển của gà (Lau et al.et al., 2007). Các thụ thể hormone tăng trưởng (GHR) kiểm soát số lượng nang trứng ở động vật được vào giai đoạn tăng trưởng nhanh (Roberts et al.et al., 1994; Monget et al.et al., 2002). Vì vậy nghiên sử dụng trình tự nucleotide vùng D-loop để đánh giá đa dạng nguồn gen gà Liên Minh. Đồng thời sử dụng các gen ứng viên liên quan đến khả năng sinh sản nhằm tìm ra đa hình gen có liên quan đến khả năng sản xuất trứng ở gà Liên Minh. CHƯƠNG II. VẬT LIỆU VÀ PHƯƠNG PHÁP 2.1. Vật Liệu 2.1.1. Vật liệu nghiên cứu 2.1.1.1. Mẫu dùng để phân tích đa dạng nguồn gen Thu mẫu máu gà Liên Minh tại các hộ gia đình thuộc thôn Liên Minh để phân tích đa dạng di truyền (2015). Các cá thể gà Liên Minh được lựa chọn dựa trên các tiêu chí: Hạn chế quan hệ huyết thống (từ các hộ nuôi khác nhau thuộc thôn Liên Minh, xã Trân Châu, huyện Cát Hải, Hải Phòng), gà trống (n=12 cá thể) và gà mái (n=12 cá thể), các cá thể trưởng thành mang đặc điểm đặc trưng của giống, đã được xác nhận của các chuyên gia giống tham gia đề tài “Khai thác và phát triển giống gà Liên Minh tại Hải Phòng" tại quyết định số 2398/QĐ-BKHCN ngày 31/8/2012 của Bộ trưởng Bộ Khoa học và Công nghệ. Ngoài ra, hai giống gà bản địa gà Đông Tảo – GDT (n=18) và Gà Nhiều Ngón – GNN (n=6) được thu mẫu từ địa phương nơi là nguồn gốc của chúng (Huyện Khoái Châu, Hưng Yên và Vườn Quốc gia Xuân Sơn, Phú Thọ). 2.1.1.2. Mẫu dùng đánh giá mối liên quan giữa đa hình các gen ứng viên với tính trạng năng suất trứng Thu trứng gà Liên Minh tại các gia đình thuộc thôn Liên Minh, ấp nở, chăm sóc, 4
  8. tiêm phòng và theo dõi tại Trung tâm ứng dụng tiến bộ KH&CN thành phố Hải Phòng theo hình thức cá thể từ lúc nở (01 ngày tuổi) đến 44 tuần tuổi. Gà Liên Minh được chăm sóc thú y, dinh dưỡng, môi trường giống nhau và theo dõi các đặc điểm liên quan đến tính trạng sản xuất trứng. 2.1.1.3. Danh sách mồi sử dụng trong nghiên cứu Bảng 2.2. Thông tin mồi sử dụng trong phân tích trình tự nucleotide Gen Vùng Trình tự mồi [5’ -3’] Kích thước [bp] Nguồn F: AGGACTACGGCTTGAAAAGC Oka et al, Ty thể D-loop 1321 2007 R: CATCTTGGCATCTTCAGTGCC F: Mồi xuôi R: Mồi ngược Bảng 2.3. Thông tin mồi sử dụng trong phân tích gen ứng viên Nhiệt Kích độ gắn Locus Đa hình Trình tự mồi [5’ -3’] thước Nguồn mồi [bp] (oC) C-2402T F: AGAGGCAGCCCAGGCATTTTAC 56 439 Cui et al, 2006 (PRL5) R: CCTGGGTCTGGTTTGGAAATTG 358/chèn/xóa F:TTTAATATTGGTGGGTGAAGAGACA PRL 54 154/130 Xu et al, 2011 24bp(PRL24) R: ATGCCACTGATCCTCGAAAACTC F: AGAGGCAGCCCAGGCATTTTAC C2161G 56 439 Cui et al, 2006 R: CCTGGGTCTGGTTTGGAAATTG F:GCTTGGACTGATGCGTACTT C+338T 55 520 Zhou et al, 2010 R:GTATCACTGCAAATGCTCTG VIP F: GCTTGGACTGATGCGTACTT G5138982T 55 520 Xu et al, 2011a R: GTATCACTGCAAATGCTCTG C1715301T F:CTCCTCAGGCAGACCATCATG 61 486 Xu et al, 2011 (VIPR1/TaqI) R:CTTGCACGTATCCTTGGGTAGC VIPR1 C1704887T F:CCCCGTTAAACTCAGCAGAC 61 434 Xu et al, 2011 (VIPR1/ HhaI) R:CCCAAAGTCCCACAAGGTAA Chèn/xóa 4 bp tại F: TCTCAGAGCTCCAACGTATGA 56 248 Xu et al, 2011a 3139135 R: ATATTTCTGTGCCTGAACAACA NPY F:CGTGGCTGCTTTGCTTCCTTTC C31394761T 58 324 Xu et al, 2011 R:GGGGTACGAGGCAAGGACATG F: CTAAAGGACCTGGAAGAAGGG Makhsous et al, GH C2983T 62 1164 R: AACTTGTCGTAGGTGGGTCTG 2013 F: GGCTCTCCATGGGTATTAGGA GHRi2 A294-541G 58 718 Li et al, 2008 R: GCTGGTGAACCA ATCTCGGTT F: ACGAAAAGTGTTTCAGTGTTGA GHRi5 C571T 60 750 Li et al, 2008 R: TTTATCCCGTGTTCTCTTGACA F: Mồi xuôi R: Mồi ngược Thành phần của phản ứng cắt (tổng thể tích một phản ứng 15 µl): nước deion (2,5 µl), đệm cắt 10X (1,5 µl), sản phẩm PCR (10 µl), enzym cắt hạn chế (10U), thời gian ủ là 16 giờ,nhiệt độ ủ tương ứng với từng enzyme cắt (Bảng 2.4). Bảng 2.4. Thông tin về phản ứng enzyme cắt hạn chế (RE) Kích thước sản phẩm cắt Nhiệt độ Locus Đa hình RE Số hiệu GenBank Hãng sản xuất [bp] cắt [oC] C-2402T (PRL5) AluI AB011438 439/304/160/144/81/54 37 Thermo, Mỹ PRL – 358/ chèn/xóa - AF288765 154/130 37 Thermo, Mỹ 24 bp (PRL24) C2161G Csp6I AB011438 439/405/34 37 Thermo, Mỹ C+338T HinfI NC_006090 520/480/40 37 Thermo, Mỹ VIP G5138982T ApoI NC_006090 520/486/34 37 Thermo, Mỹ 5
  9. C1715301T TaqI NC_006089 486/310/176 65 Thermo, Mỹ VIPR1 C1704887T HhaI NC_006089 434/253/181 37 Thermo, Mỹ Chèn/xóa 4 bp tại 3139135 DraI M87298 248(252) 167/81 37 Thermo, Mỹ NPY 324/200/124 C31394761T KpnI GI:35797382 9 37 Thermo, Mỹ 200/124 GH C-2983T SacI JN675393 1164/1020/ 570/450/144 37 Thermo, Mỹ GHR C571T (intron 5) NspI NC_006127 750/550/200 37 Thermo, Mỹ A294-541G 718/428/290 GHR HinIII NC_006127 37 Thermo, Mỹ (intron 2) 258/170/290 2.1.2. Các hóa chất -Hóa chất được dùng trong nghiên cứu sinh học phân tử của các hãng Sigma (Đức), Merck (Đức), Thermo (Mỷ). 2.1.3. Máy móc thiết bị sử dụng Máy PCR Eppendorf AQ mastercycle 5332YN056927 (Đức), máy điện di ngang FCIE-PLAS-HU1030012479 (Anh), máy ổn nhiệt (JSR-JSWB22T-Hàn Quốc), tủ lạnh bảo quản 40C (Panasonic - Nhật Bản), máy soi gel (UVP-M-26V/P/N95-0458- 02, Mỹ), máy ly tâm lạnh (HETTICH-UNI version 320R, Đức), Máy đo áp lực võ trứng, Thiết bị đo quang phổ Nano Drop. 2.2. NỘI DUNG NGHIÊN CỨU - Nội dung 1: Đánh giá đa dạng di truyền gà Liên Minh dựa trên ADN ty thể - Nội dung 2: Phân tích mối liên quan giữa các chỉ thị di truyền và tính trạng sản xuất trứng ở giống gà Liên Minh + Thí nghiệm 1: Xác định các chỉ số liên quan đến tính trạng sản xuất trứng ở 90 cá thể gà mái Liên Minh; + Thí nghiệm 2: Xác định tần số alen/kiểu gen tại các gen ứng viên (PRL, VIP, VIPR1,NPY, GH và GHR) liên quan tính trạng năng suất trứng; Xác định mối liên quan giữa các gen ứng viên và tính trạng sản lượng trứng ở gà Liên Minh. 2.3. PHƯƠNG PHÁP NGHIÊN CỨU 2.3.1. Phương pháp thu mẫu máu Mẫu máu gà Liên Minh được lấy bằng xylanh 5 ml từ tĩnh mạch cánh, rồi nhanh chóng chuyển sang ống đựng máu chứa chất chống đông EDTA-K. Bảo quản ống máu ở 4ºC, đưa về phòng thí nghiệm bảo quản ở -20ºC. 2.3.2. Phương pháp tách ADN hệ gen từ máu ADN hệ gen được tách chiết từ các mẫu máu theo phương pháp của Ausubel và cộng sự (1995). 2.3.3. Phương pháp nhân đoạn ADN bằng phản ứng chuỗi polymerase (PCR) Để đánh giá đa dạng nguồn gen và kiểm tra các đa hình gen, trước tiên phải khuếch đại các đoạn ADN: D-loop, PRL, VIP, VIPR1, NPY, GH và GHR sử dụng các cặp mồi đặc hiệu (Mullis, 1990). 6
  10. 2.3.4. Phương pháp tinh sạch PCR và giải trình tự gen Tinh sạch đoạn ADN để giải trình tự: Quy trình tinh sạch được sử dụng bộ kit QIAquick PCR Purification Kit (QIAGEN). Sản phẩm sau khi tinh sạch được gửi giải trình tự gen trên máy đọc tự động ABI- 3100 Avant Gentic Analyzer của công ty Macrogen (Hàn Quốc). 2.3.5. Phương pháp phân tích đa hình gen ứng viên Đa hình các gen PRL, VIP, VIPR1,NPY, GH và GHR được xác định bằng kỹ thuật PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) với enzyme cắt đặc hiệu thích hợp. 2.3.6. Đánh giá các chỉ tiêu liên quan tính trạng sinh trưởng và sinh sản ở gà Các chỉ tiêu liên quan đến khả năng sản xuất trứng được theo dõi theo mô tả của Bùi Hữu Đoàn và cộng sự (2011) bao gồm: Tuổi đẻ quả trứng đầu (ngày), khối lượng quả trứng đầu tiên (gram), năng suất trứng (tổng số lượng quả trứng/ mái/ 20 tuần) khối lượng trứng (gram) và chỉ số hình dạng trứng (kích thước đường kính lớn/đường kính nhỏ D/R). 2.3.7. Khối lượng cơ thể Khối lượng cơ thể gà Liên Minh được cân vào thứ sáu hàng tuần vào 19 giờ, khi gà lên chuồng, sử dụng cân đồng hồ có độ chính xác 5 g. 2.3.8. Phương pháp xử lý số liệu Trình tự nucleotide vùng D-loop gen ty thể gà được xử lý bằng chương trình phần mềm ClustalX 2.0.11, Bioedit 5.0 (Hall, 1999). Xác định, phân tích các chỉ tiêu về đa dạng di truyền (số vị trí đa hình, số lượng haplotype, đa dạng haplotype, đa dạng nucleotide, phép kiểm tra Tajima) sử dụng phần mềm DnaSP V5 (Librado và Rozas, 2009), cây phả hệ di truyền xây dựng theo phương pháp Neighbor-Joining bằng phần mềm MEGA 6, với giá trị bootstrap 1.000 lần lấy mẫu thử (Tamura và cs., 2007). Các số liệu kiểu hình – kiểu gen (tần số alen, kiểu gen) được ghi lại bằng phần mềm Excel và xử lý theo phương pháp thống kê sinh học. Tần số alen được tính theo công thức: p= (2AA + AB) / 2N và q= (2BB+ AB) / 2N, trong đó p là tần số alen A, q là tần số alen B, còn N là tổng số mẫu nghiên cứu, cân bằng Hardy-Weinberg (HWE) được ước lượng bằng phương pháp của Rodriguez và cộng sự (2009). Tương quan giữa kiểu gen và các tính trạng năng suất trứng được tính toán dựa trên mô hình tuyến tính tổng quát (Genral Linear Model) của MiniTab 16.0. Yij = µ + Gi + ij, trong đó: Yij: Tính trạng quan sát; μ: Trung bình chung; Gi: Ảnh hưởng của kiểu gen; ij: Sai số ngẫu nhiên. 7
  11. CHƯƠNG III. KẾT QUẢ VÀ THẢO LUẬN 3.1. KẾT QUẢ PHÂN TÍCH ĐA DẠNG NGUỒN GEN GÀ LIÊN MINH 3.1.1. Tách chiết ADN hệ gen Để tiến hành đánh giá đa dạng di truyền gà Liên Minh dựa vào trình tự nucleotide vùng D-loop ADN ty thể, cần phải thu nhận được ADN hệ gen tách từ máu gà ở dạng tinh sạch và không đứt gãy. Bảng 3.1. Kết quả đo quang phổ ADN hệ gen Mẫu ADN OD260nm/280nm Nồng độ (ng/µl) Từ GLM01 đến GLM24 Từ 1,82 đến 1,99 Từ 100,56 đến 694,80 Từ GNN01 đến GNN06 Từ 1,81 đến 1,90 Từ 257,50 đến 428,96 Từ GDT01 đến GDT18 Từ 1,85 đến 1,97 Từ 225,60 đến 515,37 Bảng 3.1 cho thấy tỉ số OD260/280 của các mẫu ADN nằm trong khoảng 1,8 – 2,0, chứng tỏ ADN tách chiết được là tinh sạch, nồng độ ADN đạt từ 100,56 – 694,80 ng/µl vì vậy mẫu ADN hệ gen đảm bảo chất lượng để phục vụ các thí nghiệm tiếp theo. 3.1.2. Khuếch đại vùng D-loop ADN ty thể bằng phản ứng PCR Kết quả hình 3.2 cho thấy, sản phẩm ADN là một băng sáng, rõ nét và có kích thước phân tử khoảng 1300 bp (băng điện di nằm giữa hai băng ADN chuẩn 1000 bp và 1500 bp). Hình 3.2. Kết quả điện di sản phẩm PCR trên gel agarose 1% Giếng 1 → 9: Sản phẩm PCR của các mẫu gà Liên Minh, M: Thang ADN chuẩn 1kb (Merck) 3.1.3. Giải trình tự nucleotide vùng D-loop Kết quả giải trình tự nucleotide vùng D-loop gà Liên Minh đã được đăng ký trên GenBank với các mã số: Từ mã số KY172116 đến mã số KY172121 và từ mã số MH425591 đến mã số MH425608. 8
  12. 3.1.4. Phân tích đa hình nucleotide vùng D-loop của gà Liên Minh và một số gà bản địa có mã số trên Genbank 3.1.4.1. Phân tích mức độ đa dạng vùng D-loop Phần mềm DnaSP được sử dụng để phân tích đa hình nucleotide vùng D-loop gen ty thể gà Liên Minh. Các thông số phân tích bao gồm: Số vị trí đa hình (number of polymorphic sites – S); số lượng haplotype (number of haplotype - h); đa dạng haplotype (haplotype diversity - Hd); đa dạng nucleotide (nucleotide diversity - Pi); phép kiểm tra Tajima (Tajima’s test - D). Kết quả phân tích các thông số đa hình nucleotide (1050 bp) ở gà Liên Minh, các gà bản địa Việt Nam và các gà bản địa trên thế giới được thể hiện trên bảng 3.2. Bảng 3.2. Chỉ số đa dạng di truyền vùng D-loop gà Liên Minh (455 bp) và một số giống gà bản địa Giống N S h Hd Pi NC D Tham khảo Gà Liên Minh Liên Minh 24 23 12 0,913 0,007 4 0,187* Nghiên cứu này Đông Tảo 18 11 7 0,856 0,004 1 * 1,721 Nghiên cứu này * Nhiều Ngón 6 4 3 0,867 0,002 1 0,562 Nghiên cứu này N: Số lượng mẫu; S: Số vị trí đa hình; h: Số haplotype; Hd: Đa dạng haplotyoe; Pi: Đa dạng nucleotide; NC(number of clade): Số nhánh; D: Tajima’s Test; *: P>0,05 3.1.4.2. Đa hình trình tự nucleotide vùng D-loop a. Phân tích đa hình trình tự nucleotide vùng D-loop giữa gà Liên Minh và các giống gà bản địa Việt Nam Kết quả phân tích cho thấy, có 21 vị trí đa hình thay thế nucleotide và không có đa hình chèn/xóa nucleotide khi so sánh với gà bản địa Việt Nam mang mã số GU564373 (gà Đông Tảo). Hình 3.4 cho thấy, trong 21 vị trí thay thế có 11 vị trí thay thế T→C, bốn vị trí thay thế A→G, năm vị trí thay thế C→T, chỉ có một vị trí thay thế nucleotide G→A. Đặc biệt, thay thế T→C tại vị trí 241 xuất hiện ở tất cả gà Liên Minh nghiên cứu, ngoài ra thay thế này tại vị trí 206 xuất hiện ở 17/24 mẫu nghiên cứu. b. Phân tích đa hình trình tự nucleotie vùng D-loop giữa gà Liên Minh và các giống gà nhà trên thế giới Kết quả cho thấy từ 24 trình tự nucleotide (Hình 3.5) được xác định bởi 23 vị trí đa hình nucleotide giữa gà Liên Minh và gà nhà nhánh E mang mã số AB268540 (Gallus gallus domesticus), bao gồm 22 vị trí thay thế nucleotide và một vị trí chèn 9
  13. nucleotide. Đặc biệt chèn nucleotide G tại vị trí 860 xuất hiện ở tất cả gà Liên Minh nghiên cứu. Bên cạnh đó, thay thế nucleotide T→C xuất hiện ở 10 vị trí (167, 199, 217, 243, 246, 256, 270, 315, 367, 888) và thay thế và C→T chỉ xuất hiện tại vị trí 225, 261, 310 và 446. 3.1.4.3. Hệ số tương đồng nucleotide vùng D-loop a. Phân tích hệ số tương đồng nucleotide vùng D-loop giữa gà Liên Minh với các giống gà bản địa Việt Nam (455 bp) Đa số các giống gà bản địa Việt Nam sử dụng 455 bp vùng siêu biến D-loop để phân tích đa dạng di truyền (Lê Tiến và cs, 2009; Cuc et al, 2011). Vì vậy, sử dụng 455 bp vùng siêu biến đoạn D-loop để so sánh mức độ tương đồng nucleotide vùng D-loop giữa gà Liên Minh và gà bản địa Việt Nam. Kết quả phân tích cho thấy, hệ số tương đồng nucleotide giữa các cá thể gà Liên Minh đạt 97,5% - 100%. Trong đó, có 14 cá thể gà Liên Minh nhóm I (GLM 01, GLM02, GLM03, GLM06, GLM 07, GLM 08, GLM 09, GLM 11, GLM12, GLM13, GLM14, GLM15, GLM16 và GLM18) (Hình 3.4) có hệ số tương đồng trình tự nucleotide đạt 100%. Các gà Liên Minh trên có hệ số tương đồng nucleotide với gà Liên Minh nhóm II (GLM10 và GLM17) đạt 97,5%. Hệ số tương đồng nucleotide giữa gà Liên Minh và các gà bản địa Việt Nam dao động trong khoảng 96,8 - 99,7%. Trong đó, hệ số tương đồng nucleotide giữa gà Liên Minh thuộc nhóm I (n = 14) so với các gà bản địa nằm trong nhánh B khá cao đạt từ 99,3 - 99,7%. Gà Liên Minh trong nhóm này cũng có hệ số tương đồng nucleotide cao khi so sánh với gà Đông Tảo và gà Nhiều Ngón (99,1-99,7%). Ngược lại, gà Liên Minh ở nhóm I có hệ số tương đồng nucleotide với các gà bản địa Việt Nam trong nhánh C, D, E, G, I chỉ đạt từ: 97,3 -97,9%. Gà Liên Minh nhóm II (GLM10 và GLM17, Hình 3.4) có hệ số tương đồng cao so với các gà bản địa nằm trong phân nhánh B8 (99,1%), còn gà Liên Minh tại nhóm III (GLM04, GLM19, GLM23, GLM24) lại có hệ số tương đồng nucleotide với gà bản địa Việt Nam nằm trong phân nhánh D1 là 99,1%. Gà Liên Minh thuộc nhóm IV (GLM20) và nhóm V (GLM05) có hệ số tương đồng cao với các gà bản địa Việt Nam thuộc phân nhánh C1 (99,5-99,7%). Gà Liên Minh nhóm VI (GLM21) và VII (GLM22) có hệ số nucleotide tương đồng cao so với gà nhà ở phân nhánh E1 (99,3-99,5%). b. Phân tích hệ số tương đồng nucleotide vùng D-loop giữa gà Liên Minh và các gà nhà trên thế giới (1050 bp) 10
  14. Sử dụng 1050 nucleotide vùng D-loop gà Liên Minh để so sánh với các giống gà bản địa trên thế giới (Oka et al, 2007). Kết quả phân tích cho thấy, hệ số tương đồng nucleotide giữa các cá thể gà Liên Minh đạt 98,7% - 100%. Trong đó, gà Liên Minh tại các nhóm I (GLM 01, GLM 07, GLM 08, GLM 09, GLM 11), nhóm II (GLM02, GLM18), nhóm III (GLM12, GLM13, GLM14, GLM15), nhóm IV (GLM06) và nhóm V(GLM03, GLM16) có hệ số tương đồng trình tự nucleotide rất cao đạt từ 99,7% - 99,9%, các gà Liên Minh trong cùng một nhóm có hệ số tương đồng nucleotide đạt 100%. Hệ số tương đồng nucleotide của gà Liên Minh và các gà nhà theo kết quả nghiên cứu của Oka và cộng sự đạt 98,2% - 100%. Gà Liên Minh thuộc nhóm I, II, III, IV và V có hệ số tương đồng nucleotide với gà thuộc phân nhánh E1, E2, E3, E4 (Oka et al, 2007) đạt 99,6% - 100,0%. Gà Liên Minh GLM10, GLM17, GLM21, GLM22 có hệ số tương đồng nucleotide cao với gà thuộc phân nhánh A (99,6%- 100,0%), gà Liên Minh thuộc nhóm VIII (GLM04, GLM19, GLM23, GLM24) có hệ số tương đồng nucleotide khá cao khi so sánh với các gà nhà nằm trong nhánh C, đạt 99,5%. Hệ số tương đồng nucleotide giữa GLM05, GLM20 với gà nhà phân nhánh D đạt 99,8-99,9%. Hệ số tương đồng này thấp hơn khi so sánh gà Liên Minh với các gà nhà thuộc phân nhánh G, F, chỉ đạt từ 98,2% - 99,2%. 3.1.4.4. Phân bố Haplotype gà Liên Minh Sử dụng phần mềm DnaSP version 5 xác định haplotype trên 1050 bp và 455 bp. Kết quả phân tích haplotype trên 1050 bp vùng D-loop 24 mẫu gà Liên Minh nghiên cứu được phân bố thành 12 haplotype (Bảng 3.3). Trong đó, gà Liên Minh tập trung nhiều nhất vào haplotype 1, haplotype 3 và haplotype 8. Kết quả phân tích haplotype trên 455 bp vùng D-loop gà Liên Minh nghiên cứu được phân bố thành bảy haplotype (Bảng 3.4). Trong đó, gà Liên Minh tập trung nhiều nhất vào haplotype 1. 3.1.4.5. Cây phân loại di truyền của gà Liên Minh dựa trên trình tự nucleotide vùng D-loop a. Cây phân loại di truyền giữa gà Liên Minh và các giống gà bản địa Việt Nam (455 bp) 11
  15. Hình 3.10. Cây phân loại di truyền gà Liên Minh và các giống gà bản địa Việt Nam Sử dụng 455 bp vùng D-loop, xây dựng theo phương pháp Neighbor-joining sử dụng MEGA 6.0 với giá trị bootstrap 1.000. (1,2,3...: Haplotype; (-): số cá thể gà trong haplotype; ● GLM: Gà Liên Minh, ■ DT: Gà Đông Tảo; ▲ - GNN: Gà Nhiều Ngón. 12
  16. Cây phân loại di truyền được xây dựng dựa trên 48 trình tự D-loop gà bản địa Việt Nam (24 trình tự GLM, sáu trình tự GNN và 18 trình tự GDT) cùng với 11 trình tự tham chiếu tương ứng với bảy nhánh được xác định bởi Liu và cộng sự (2006) và 37 trình tự gà bản địa Việt Nam phân bố bảy nhánh (Cuc et al, 2011). Sử dụng 455 bp vùng siêu biến D-loop ADN ty thể để xác định mối quan hệ di truyền giữa gà Liên Minh và các giống gà bản địa Việt Nam (Hình 3.10). Cây phân loại di truyền dựa trên trình tự nucleotide vùng D-loop cho thấy gà Liên Minh phân bố trên bảy haplotype thuộc 5 nhánh (A, B, C, D, E), tập trung chủ yếu ở nhánh B (58,3% mẫu) – là nhánh phân bố chính của các giống gà bản địa Việt Nam và Đông Nam Á. Trong nghiên cứu này, đã không tìm thấy mẫu gà Liên Minh, Đông Tảo, Nhiều Ngón phân bố trong nhánh G, H, I và F. Kết quả này phù hợp với nghiên cứu của Cuc và cộng sự (2011). b. Cây phân loại di truyền giữa gà Liên Minh, gà Nhiều Ngón, gà Đông Tảo và các giống gà nhà trên thế giới Hình 3.11. Cây phân loại di truyền của gà Liên Minh, gà Đông Tảo, gà Nhiều Ngón và các gà nhà trên thế giới Sử dụng 1050 bp vùng D-loop, xây dựng theo phương pháp Neighbor-joining sử dụng MEGA 6.0 với giá trị bootstrap 1.000 lần lặp lại. (1,2,3...: Haplotype; (-): số cá thể gà trong 1 haplotype. ● GLM: Gà Liên Minh, ■GNN: Gà Nhiều Ngón, ▲GDT: Gà Đông Tảo, Oka: Các gà đại diện nằm trên các nhánh do Oka và cộng sự., 2007 phân tích) 13
  17. Cây phân loại di truyền được xây dựng dựa trên 48 trình tự D-loop gà bản địa Việt Nam (24 trình tự GLM, sáu trình tự GNN và 18 trình tự GDT) cùng với 11 trình tự tham chiếu tương ứng với bảy nhánh được xác định bởi Oka và cộng sự (2007) (Hình 3.11). Sử dụng 1050 bp vùng D-loop và sử dụng phương pháp NJ để xây dựng cây phân loại di truyền đối với gà Liên Minh, gà Nhiều Ngón, gà Đông Tảo và gà nhà trên thế giới. Kết quả cho thấy, 24 mẫu GLM được phân bố ở năm nhánh A, B, C, D và E, nhưng chủ yếu ở nhánh E (58,3%). Cụ thể là: 14 mẫu gà Liên Minh thuộc haplotype 1, 2, 3, 4 phân bố trong nhánh E. Các nghiên cứu trước đây cho thấy rằng, gà thuộc nhánh E đã được quan sát thấy ở gà bản địa Châu Á, Trung Quốc, Lào, Nhật Bản và Ấn Độ (Liu et al, 2006, Oka et al, 2007, Cuc et al, 2011, Kawabe et al, 2014) và không được quan sát thấy ở các gà bản địa Châu Phi (Miao et al, 2013). 3.2. PHÂN TÍCH CHỈ THỊ PHÂN TỬ LIÊN QUAN TÍNH TRẠNG NĂNG SUẤT TRỨNG Ở GIỐNG GÀ LIÊN MINH 3.2.1. Theo dõi 5 chỉ tiêu liên quan tính trạng năng suất trứng của 90 cá thể gà Liên Minh Nghiên cứu tiến hành chọn lọc và nuôi 90 cá thể gà Liên Minh riêng biệt trong từng lồng, trong điều kiện ánh sáng, độ ẩm, chế độ dinh dưỡng... tương đối giống nhau, phục vụ đánh giá tương quan giữa các gen ứng viên và tính trạng năng suất trứng ở gà Liên Minh. Các chỉ tiêu theo dõi bao gồm: Tuổi bắt đầu đẻ quả trứng đầu tiên (TBĐĐT), số lượng trứng (SLT), khối lượng trứng trung bình (KLTTB), khối lượng trứng trung bình từ 36 tuần đến 44 tuần tuổi, khối lượng quả trứng đầu tiên (KLQTĐT), chỉ số hình dạng trứng (CSHDT) của từng cá thể gà Liên Minh. 3.2.2. Tần số alen/kiểu gen các đa hình gen PRL, PRLR, VIP, VIPR1, NPY, GH và GHR; phân tích mối liên quan với tính trạng năng suất trứng ở gà Liên Minh 3.2.2.1. Tách chiết ADN hệ gen 3.2.2.2. Tần số alen/kiểu gen các đa hình gen PRL và mối liên quan với tính trạng năng suất trứng a. Khuếch đại các đoạn gen PRL bằng phản ứng PCR b. Phân tích đa hình gen PRL bằng enzyme cắt giới hạn c. Xác định đa hình gen PRL bằng giải trình tự nucleotide d. Phân tích tần số alen/kiểu gen tại các vị trí đa hình gen PRL Đa hình PRL24, PRL/2161 có tần số kiểu gen tuân theo Định luật Hardy- Weinberg (P>0,05). Còn đa hình PRL/2402 không tuân theo định luật Hardy- Weinberg (P
  18. e. Mối liên quan giữa kiểu gen và tính trạng năng suất trứng ở giống gà Liên Minh Bảng 3.9. Mối liên quan giữa kiểu gen PRL24 và tính trạng năng suất trứng ở giống gà Liên Minh Kiểu gen (N) Chỉ tiêu P ID (24) DD (66) Tuổi đẻ quả trứng đầu (ngày) 185,33±8,21 187,12±8,25 0,365 Năng suất trứng trung bình (quả) 45,29±5,77 43,14±4,73 0,075 Khối lượng trứng trung bình (g) 47,57±3,11a 45,05±4,33b 0,011 Khối lượng trứng trung bình 36-44 (g) 49,13±3,27 a 46,58±4,68 b 0,016 Khối lượng quả trứng đầu tiên (g) 42,16±4,57 39,95±4,98 0,062 Kích thước trứng (D/d) 1,28±0,03 1,28±0,03 0,632 Ghi chú: Các giá trị trung bình mang chữ cái khác nhau trên cùng một hàng là khác biệt có ý nghĩa thống kê (P
  19. Bảng 3.11. Mối liên quan giữa kiểu gen PRL2161 và tính trạng năng suất trứng ở giống gà Liên Minh Kiểu gen (N) Chỉ tiêu P CC (4) CG (26) GG (60) Tuổi đẻ quả trứng đầu (ngày) 187,00±2,94 186,42±8,55 186,72±8,41 0,985 SL trứng trung bình 48,50±3,70* 44,00±4,98* 43,27± 5,10* - KL trứng trung bình (g) 48,99±3,25 45,10±3,58 45,77±4,41 0,221 KL trứng trung bình 36-44(g) 51,14±3,37 46,94±3,74 47,14±4,76 0,206 KL quả trứng đầu tiên (g) 41,48±4,45 39,69±5,89 40,85±4,55 0,565 Kích thước trứng (D/d) 1,27±0,02 1,27±0,02 1,29± 0,03 0,107 Ghi chú: KL trứng trung bình 36-44: Khối lượng trứng trung bình của cá thể từ 36-44 tuần tuổi. *: Không đủ điều kiện để phân tích phương sai; KL: Khối lượng; SL: Số lượng. f. Ảnh hưởng của haplotype gen PRL tại các vị trí: -385; 2402; và 2161 đến các tính trạng năng suất trứng ở gà Liên Minh Kết quả phân tích sự kết hợp của hai đa hình PRL24 và PRL/2402 (Bảng 3.12), cho thấy khối lượng trứng trung bình của gà mang haplotype IDTT (48,17± 1,83) cao hơn so với gà mang haplotype IDCT (47,20±3,68), DDCT (46,71 ±4,73), DDTT (44,22 ±3,91) (P
  20. Bảng 3.13. Ảnh hưởng của hai đa hình PRL24 và PRL/2161 đến các chỉ tiêu liên quan tính trạng năng suất trứng ở gà Liên Minh Tuổi đẻ quả Năng suất Khối lượng Khối lượng Chỉ số hình Haplotype trứng đầu trứng trung trứng (36-44) trứng trung dạng trứng (N) (ngày) bình (quả) (g) bình (g) (D/d) DDCC (3) 187,33±3,51 47,67±4,04 52,34±2,89 49,41±3,85 1,27±0,02 DDCG (16) 185,00±8,81 42,69±3,98 45,70±3,96 43,83±3,77 1,28±0,02 DDGG (47) 187,83±8,26 43,00±4,93 46,52±4,81 45,18±4,41 1,29±0,03 * * * * IDCC (1) 186,00± 0,00 51,00±0,00 47,52±0,00 47,75±0,00 1,29±0,00* IDCG (10) 188,70±8,03 46,10±5,88 48,91±2,40 47,14±2,09 1,27±0,02 IDGG (13) 182,69±7,99 44,23±5,78 49,41±3,98 47,88±3,87 1,29±0,04 P 0,391 0,167 0,038 0,041 0,372 (N): Số cá thể Khối lượng trứng trung bình của gà mang haplotype DDCC (49,41 ±3,85) cao hơn so với gà mang haplotype DDCG (43,83±3,77) là 5,58 gam (P
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2