Đề tài: Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B

Chia sẻ: Minh Minh | Ngày: | Loại File: PDF | Số trang:24

0
161
lượt xem
52
download

Đề tài: Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục tiêu đề tài: "Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B" nhằm hoàn thiện qui trình kỹ thuật PCR – RFLP xác định kiểu gene của HBV và bước đầu xác định sự phân bố các kiểu gene của HBV ở nhóm bệnh nhân nghiên cứu.

Chủ đề:
Lưu

Nội dung Text: Đề tài: Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B

  1. ĐỀ TÀI ”Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B”
  2. ĐẶT VẤN ĐỀ Viêm gan virút B (VGVR B) hiện nay vẫn là một bệnh rất phổ biến trên toàn thế giới và luôn là một mối quan tâm lớn đối với công tác y tế của toàn cầu và cũng như của Việt Nam. Bệnh có tỷ lệ mắc cao và thường gây nên những hậu quả nặng nề như viêm gan mạn, xơ gan và ung thư tế bào gan nguyên phát. Trên thế giới, có hơn hai tỉ người bị nhiễm vi rút viêm gan B (HBV), trong đó có khoảng 350 - 400 triệu người bị nhiễm HBV mạn tính. Khoảng 25 đến 40% số người bị nhiễm HBV mạn tính này tử vong sớm vì những biến chứng là xơ gan và/hoặc ung thư gan. (Lee và CS 1997) Việt Nam nằm trong vùng dịch tễ cao của vi rút viêm gan B, ước tính có khoảng 10 triệu người mang HBsAg nên viêm gan vi rút B là vấn đề quan trọng của sức khoẻ cộng đồng. Tỷ lệ mang HBsAg cao nhất là lứa tuổi từ 41-50 chiếm 18,7% trong khi lứa tuổi có tỷ lệ thấp nhất từ 0-10 là 10,7 %. Nhưng tỷ lệ HBeAg(+) /HBsAg(+) của lứa tuổi 0 - 10 là 91 %. Theo diễn biến tự nhiên, tỷ lệ mất HBsAg hàng năm là 1-2%, và chuyển đổi huyết thanh HBeAg chung là 9,6%. Vào những năm cuối thế kỷ 20, kỹ thuật sinh học phân tử ra đời và có tốc độ phát triển nhanh chóng đã mở ra một kỷ nguyên mới về chẩn đoán gen nên chúng ta đã có thể chẩn đoán được vi rút viêm gan B ở mức độ phân tử. Nhờ ứng dụng các kỹ thuật về phân tích DNA của HBV mà chúng ta có thể giải quyết được các hạn chế của các kỹ thuật miễn dịch kinh điển. Các kỹ thuật sinh học phân tử này bao gồm các xét nghiệm HBV – DNA : kỹ thuật PCR, Realtime – PCR (PCR với thời gian thực) và bDNA (khuyếch đại tín hiệu), xác định các kiểu gene của HBV và xác định các đột biến kháng thuốc. Cho đến nay, 2 vấn đề mới nổi lên và đang được quan tâm trong việc chẩn đoán HBV là vai trò thực sự của kiểu gen vi rút viêm gan B và sự đột biến của vi rút B trong quá trình diễn tiến tự nhiên của bệnh cũng như dưới tác động của thuốc đặc trị. Để xác định kiểu gene của HBV hiện nay có nhiều phương pháp. Đó là: + Phương pháp giải trình tự gene (Sequencing)
  3. + Phương pháp lai trên pha rắn như Test INNO – LIPA. + Phương pháp realtime – PCR technique. + Phương pháp PCR đa mồi. + Phương pháp PCR – RFLP. Tuy nhiên mỗi phương pháp có những ưu nhược điểm riêng. Phương pháp giải trình tự gene, lai trên pha rắn, kỹ thuật Realtime – PCR và PCR đa mồi có ưu điểm xác định các kiểu gene của HBV một cách chính xác do sự thiết kế các cặp mồi đặc hiệu. Nhưng có nhược điểm là công tác chuẩn bị mẫu mất nhiều thời gian và bên cạnh đó cần phải có những trang thiết bị hiện đại do đó giá thành cho một xét nghiệm còn cao. Phương pháp PCR – RFLP là sử dụng các enzyme giới hạn TasI và SspI cắt các trình tự đã biết của sản phẩm PCR nhân đoạn gene của HBV. Qua đó xác định kiểu gen của HBV thông qua phân tích tính đa hình của các đoạn giới hạn. Đây là một phương pháp đơn giản dễ thực hiện không cần những trang thiết bị đắt tiền do đó đáp ứng được yêu cầu về mặt giá thành và cũng rút ngắn được thời gian. Chính vì những lý do đó chúng tôi tiến hành đề tài ” Nghiên cứu ứng dụng kỹ thuật PCR – RFLP xác định kiểu gene của vi rút viêm gan B” với các mục tiêu: 1. Hoàn thiện qui trình kỹ thuật PCR – RFLP xác định kiểu gene của HBV. 2. Bước đầu xác định sự phân bố các kiểu gene của HBV ở nhóm bệnh nhân nghiên cứu.
  4. TỔNG QUAN 1. TÌNH HÌNH NHIỄM VI RÚT VIÊM GAN B 1.1. Tình hình nhiễm HBV trên thế giới. Trên thế giới, có hơn hai tỉ người bị nhiễm HBV, với ước lượng 350-400 triệu người bị nhiễm HBV mạn tính. Khoảng 25 đến 40% số người bị nhiễm HBV mạn tính này chết sớm vì xơ gan và/hoặc ung thư gan. Ba phần tư số người mang HBV sống ở châu Á; tỷ lệ người mang HBV mạn tính ở Trung Quốc và Ðông Nam Á ở mức cao từ 8% dân số trở lên. Nhiễm HBV cũng phổ biến ở châu Phi hạ Sahara. Tỉ lệ lưu hành HBV ở mức trung bình tại vùng Ðịa Trung Hải, Nhật Bản, và một phần Ðông Âu. Nhiễm HBV tương đối ít gặp, ảnh hưởng dưới 2% dân số, tại phần lớn Tây Âu, châu Úc và châu Mỹ. Mặc dù vậy, hàng năm có khoảng 300.000 người tại Hoa Kỳ và có đến một triệu người châu Âu bị nhiễm bệnh. Sự khác biệt về tỉ lệ lưu hành toàn cầu là do khác biệt về các đường lây truyền HBV chính. Ở các vùng bệnh lưu hành địa phương như châu Á và Tây Phi, lây truyền HBV thường xảy ra trong thời kỳ chu sinh, với tỉ lệ lây truyền cho trẻ sơ sinh cao đến 90% từ các bà mẹ có HBsAg và HBeAg dương tính. Cách lây truyền này cũng xảy ra ở những vùng có tỉ lệ lưu hành thấp, chủ yếu là ở những người nhập cư từ các vùng có bệnh lưu hành địa phương. Hơn nữa, nhiễm bệnh ở tuổi càng nhỏ, thì cơ hội trở thành người mang HBV mạn tính càng cao. Các chương trình tiêm chủng tuy thành công, nhưng vẫn thường gặp các trường hợp mới nhiễm HBV tại nhiều nước có mức độ lưu hành địa phương cao, và có hàng triệu người đã nhiễm siêu vi mà đối với họ những văc-xin hiện dùng không có tác dụng. Do đó, can thiệp điều trị là phương án duy nhất đối với những người có bệnh gan thật sự do nhiễm HBV. 1.2. Tình hình nhiễm HBV ở Việt Nam.
  5. Tại Việt Nam , rất nhiều công trình nghiên cứu đã chỉ ra rằng tỷ lệ nhiễm HBV ở nước ta cho thấy Việt Nam nằm ở vùng dịch lưu hành cao. Tại Hà Nội, theo Hoàng Thuỷ Nguyên và cs, Trần Thị Chính và cs, Phan Thị Phi Phi và cs, tần suất nhiễm HbsAg của người lớn bình thường lần lượt là 15 – 26%, 14,4% và 13,9. Tại thành phố Hồ Chí Minh, theo Trần Văn Bé và Bửu Mật, thì tỷ lệ này là 9,3. Ở qui mô nghiên cứu cộng đồng, đã có 2 công trình khảo sát tỷ lệ mang HbsAg bằng các biện pháp nghiên cứu dịch tễ học. Công trình của Lê Vũ Anh được tiến hành năm 1988 tại cộng đồng dân cư Hà Nội bằng phương pháp lấy mẫu ngẫu nhiên phân tầng trên 1.304 người, HbsAg(+) là 148, tần suất mang HbsAg la 11,35  0,02 %. Công trình của Châu Hữu Hầu tiến hành ở một huyện vùng đồng bằng sông Cửu Long bằng phương pháp lấy mẫu nhiên theo cụm với 1.801mẫu, tỷ lệ mang HbsAg là 11 2%. Gần đây cũng có một số nghiên cứu tỷ lệ mang HbsAg trong cộng đồng. Theo Phạm Hoàng Phiệt nghiên cứu 9087 người tại thành phố Hồ Chí Minh năm 1995 thấy có 1341 người mang HbsAg(+) chiếm tỷ lệ là 14,8%. Một nghiên cứu khác tại Thanh Hoá năm 2003 trên 1579 người có 266 người mang HbsAg(+) chiếm tỷ lệ 16,8  1,8. Nghiên cứu tai thừa thiên Huế năm 2006 tỷ lệ người mang HbsAg dao động từ 4 đến 21,2% và tỷ lệ khác nhau ở các lứa tuổi khác nhau. 2.TÌNH HÌNH NGHIÊN CỨU CÁC KIỂU GENE CỦA HBV. 2.1. Vi rút viêm gan B và cấu tạo bộ gene của vi rút viêm gan B. Vi rút viêm gan B(HBV) thuộc họ Hepadnaviridae là những virút có kích thước nhỏ. Đây là virut viêm gan duy nhất có acid nhân là DNA (các viruts khác đều là RNA). Cấu tạo của HBV dưới kính hiển vi điện tử có 3 loại tiểu thể khác nhau: Tiểu thể hình cầu nhỏ có đường kính 22 nm. Tiểu thể hình ống (hình que) có đường kính 20 – 22 nm và dài từ 40 – 400 nm. Tiểu thể hình cầu lớn có đường kính là 42 – 45 nmcòn gọi là tiểu thể Dane, chính là virút hoàn chỉnh.
  6. Bộ gene của HBV là một phân tử DNA vòng có cấu trúc mạch kép không hoàn toàn, kích thước 3,2 Kb, nó được cấu tạo bởi 2 sợi có chiều dài không bằng nhau. Chuỗi dài nằm ngoài mang điện tích âm, tạo nên một vòng tròn liên tục có chiều dài có định là 3,2 Kb và mã hoá cho các thông tin di truyền của virút. Chuỗi ngắn nằm trong, có cực tính dương thay đổi và chỉ bằng 50 – 80% chiều dài sợi âm. HBV có cấu trúc đặc biệt nhỏ gọn, có được sự tiết kiệm trong cấu trúc bộ gene bằng cách sắp xếp những miền giao của các gene: S, C, P và X cho nên có khả năng tổng hợp được nhiều loaị Protein quan trọng của virút.
  7. 2.2. Sự phân bố các kiểu gene của HBV. Có 2 cách phân loại HBV: Kiểu huyết thanh (Serotype) và kiểu gen (Genotype). Trước đây người ta phân HBV thành 4 kiểu huyết thanh adr, adw, ayr và ayw dựa vào các kháng nguyên của kháng nguyên bề mặt HBV (HBsAg). Tuy nhiên những ý nghĩa của kiểu huyết thanh chưa được nghiên cứu nhiều. Với sự phát triển của sinh học phân tử, ngày nay người ta phân loại HBV dựa vào nghiên cứu trên bộ gen của HBV và phân loại HBV thành 8 kiểu gene được đặt tên từ A đến H dựa vào sự khác nhau trên 8% của toàn bộ bộ gen HBV (Kidd-Ljunggren et al., 2002; Kramvis et al., 2005; Norder et al., 2004; Okamoto et al., 1988; Schaefer, 2005). Sự phân bố các kiểu gene của HBV phụ thuộc vào các vùng địa lý khác nhau. + Kiểu gene A chủ yếu ở Mỹ, bắc và trung Âu. + Kiểu gene B và C chủ yếu ở châu Á. + Kiểu gene D chủ yếu ở Nam Âu, vùng Địa Trung Hải và Ấn Độ. + Kiểu gene E chủ yếu ở châu Phi đặc biệt ở vùng hạ Sahara. + Kiểu gene F chủ yếu ở Nam Mỹ và Polynesia. + Kiểu gene G có ở Mỹ, châu Âu bao gồm các nước Pháp, Đức và Hà Lan. + Kiểu gene H chỉ có ở Nam và Trung Mỹ. 2.3. Các phương pháp xác định kiểu gene của HBV.
  8. Có nhiều phương pháp đã được nghiên cứu và dùng trong việc xác định HBV genotypes như giải trình tự chuỗi (sequencing), PCR - RFLP (Restriction Fragment Length Polymorphism), LiPA (Line Probe Assay), phản ứng miễn dịch men (Enzyme- linked Immunoassay). Mỗi phương pháp có những ưu và nhược điểm khác nhau. + Phương pháp giải trình tự gene có thể xem như có nhiều ưu điểm nổi bật vì bên cạnh việc xác định được trình tự chuỗi các Nucleotids trong bộ gen của HBV để từ đó so sánh với thư viện gen và xác định được HBV genotypes mà còn dựa vào kết quả giải trình tự này chúng ta có thể xác định được một số dạng đột biến kháng thuốc của HBV để từ đó có phát đồ điều trị tối ưu. Tuy nhiên phương pháp này đòi hỏi phải có các trang thiết bị đồng bộ đắt tiền và nhân lực có trình độ để vận hành khai thác do đó chỉ ứng dụng được ở một số Labo có điều kiện. + Phương pháp PCR – RFLP là phương pháp sử dụng các enzyme giới hạn cắt các trình tự đã biết sản phẩm PCR nhân đoạn gene của HBV sau đó đem sản phẩm cắt điện di trên thạch Agarose 1,5% và phân tích tính đa hình của các đoạn giới hạn. Đây là một phương pháp đơn giản dễ thực hiện do đó có thể thực hiện một cách thường qui trong các phòng thí nghiệm có trang bị máy PCR thông thường. 2.4. Tình hình nghiên cứu các kiểu gene của HBV. 2.4.1. Tình hình nghiên cứu các kiểu gene của HBV trên thế giới. 2.4.2. Tình hình nghiên cứu các kiểu gene của HBV ở Việt Nam.
  9. ĐỐI TƯỢNG, VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƯỢNG NGHIÊN CỨU. Các mẫu huyết thanh của bệnh nhân bị nhiễm HBV và các mẫu huyết thanh của người bình thường. Bao gồm: + 30 mẫu huyết thanh của người bị nhiễm HBV. + 15 mẫu huyết thanh của người bình thường không bị nhiễm HBV. 2.2. VẬT LIỆU VÀ THIẾT BỊ DỤNG CỤ NGHIÊN CỨU 2.2.1. Các sinh phẩm hoá chất chính. Tên hoá chất Hãng sản xuất
  10. 1. Hoá chất dùng trong PCR 2.2.2. dNTPs Fermentas (Đức) Các Agarose Fermentas (Đức) máy Loading Dye Fermentas (Đức) và TBE Sigma (Mỹ) thiết Thang chuẩn ADN Fermentas (Đức) bị Taq-ADN-polymerase New England (Anh) chính 2. Hoá chất phục vụ giải trình tự gen . Big Dye Terminator V3.1 Applied BioSciences (Mỹ) HiDi Formamid Applied BioSciences (Mỹ) Ethanol tuyệt đối Fermentas Tên máy, thiết bị Hãng sản xuất Tủ ấm ổn nhiệt Sanyo (Nhật Bản) Máy PCR (GeneAmp PCR System 9700) Applied BioSciences (Mỹ) Máy PCR (Thermo cycle) Bio-rad (Pháp) Máy ly tâm ( Biofuge Primo R) Heraeus (Mỹ) Máy đo pH (Digital pH Meter Delta 320)_ Thommas Scientitic (Mỹ) Máy chụp ảnh Gel-Doc Dolphin (Mỹ) Tủ lạnh –200C, –800C. Nuaire (Mỹ) Lò vi sóng Sanyo (Nhật Bản) Tủ an toàn sinh học cấp II Shelab (Mỹ) Bể ổn nhiệt Memmert (Đức) Máy lắc Gyromax 737R Amerex Instrument (Đức) Máy lắc ngang reciprocating Jeio – Tech (Hàn Quốc) Máy quang phổ tử ngoại khả kiến Nano Drop Analitika (Đức) Máy phân tích trình tự ADN ABI 3130 system Applied BioSciences (Mỹ)
  11. 2.2.3. Các primer dùng trong nghiên cứu. Các primer đặc hiệu cho nhân đoạn gene vùng precore của HBV có trình tự tương ứng là: + Cặp primer cho PCR vòng 1: HBV_preC16a: 5’_CACCTCTGCCAATCATCTCT_3’ HBV_590as: 5’_CTGCGAGGCGAGGGAGTT_3’ + Cặp primer cho PCR vòng 2: HBV_A: 5’_TTCTTCTTCTAGGGGACCTGCCTCAGTCC_3’ HBV_nonA_TTCTTCTTCTAGGGGACCTGCCTCATCGT_3’ HBV_P1865_CÂGCCTCCAAGCTGTGCCTTGGGTGGCCTT_3’ 2.3. PHƯƠNG PHÁP NGHIÊN CỨU 2.3.1. Thiết kế nghiên cứu. Tiến hành nghiên cứu theo phương pháp: Thực nghiệm labo có đối chứng dựa theo phương pháp của Hannoune 1998 có cải tiến. (các chủng chuẩn đã được công bố trên GeneBank). Sơ đồ nghiên cứu Tách DNA từ các mẫu huyết thanh của bệnh nhân Nested -PCR Điện di sản phẩm PCR2 trên thạch Agarose kiểm tra Nếu có band đặc hiệu cắt bằng enzyme SspI
  12. Nếu cắt là Genotype A hoặc B Nếu không cắt là genotype từ C đến H Cắt sản phẩm PCR vòng 2 bằng enzyme TasI Điện di kiểm tra, phân tích và xác định các genotype (A - H) dựa vào các tính đa hình các đoạn giới hạn Sequencing kiểm tra 2.3.2. Các kỹ thuật cụ thể. * Tách chiết DNA theo protocol của nhà sản xuất: Sử dụng kít tách triết DNA của QIAgene (Đức)và qui trình cụ thể như sau: 1. Cho 20l Protease K vào tube eppendorf 1,5 ml. Sau đó cho 200l huyết thanh mẫu vào. 2. Cho 200l buffer AL vào mẫu sau đó Vortex nhanh 15 giây. 3. Ủ ở nhiệt độ 560 C trong 10 phút. Spindown. 4. Cho 200l cồn tuyệt đối vào mẫu sau đó Vortex nhanh 15 giây rồi đem Spindown. 5. Chuyển toàn bộ sang tube QIAamp spin column. Ly tâm 8000 rpm trong 1 phút sau đó đổ bỏ dịch lọc ở dưới cột rồi giữ lại cột. 6. Cho 500l Buffer AW1. Ly tâm 8000 rpm trong 1 phút sau đó đổ bỏ dịch lọc ở dưới cột rồi giữ lại cột.
  13. 7. Cho 500l Buffer AW2. Ly tâm 14000 rpm trong 3 phút sau đó đổ bỏ dịch lọc ở dưới cột rồi giữ lại cột. Chuyển cột sang một tube vô trùng khác. Tiếp tục ly tâm 14000 rpm trong 1 phút. 8. Chuyển cột sang một tube eppendorf vô trùng khác. Sau đó thêm 200l Buffer AE hay nước cất khử ion. Ủ nhiệt phòng trong 1 phút rồi ly tâm 8000 rpm trong 1 phút. 9. Thu DNA trong các tube và bảo quản ở - 200C. 2.3.3. Kỹ thuật Nested – PCR nhân đoạn gene vùng precore của HBV. Kỹ thuật Nested - PCR nhân đoạn gene vùng precore của HBV được thực hiện tương tự như ở các labo sinh học phân tử khác trên thế giới [], đã được tối ưu hoá tại Trung tâm Sinh Y Dược học Học Viện Quân Y và xây dựng thành protocol của Phòng Vi sinh vật và Các mầm bệnh sinh học. Sơ đồ qui trình Đo nồng độ ADN của mẫu nghiên cứu Tính toán giá trị các thành phần phản ứng PCR Tạo hỗn hợp phản ứng Nhân gen theo chu trình nhiệt đã được tối ưu hoá Điện di kiểm tra vạch đặc hiệu
  14. Cụ thể 1. Sau khi đo nồng độ ADN template, tính và tạo các nồng độ ADN của các mẫu như nhau để khi đưa vào hỗn hợp mix cùng một thể tích ADN template, và đạt khoảng 100 ng trong 1 thể tích 25 µl phản ứng. 2. Tính các giá trị của các thành phần khác Tính toán các thành phần cho phản ứng PCR PCR vòng 1 PCR vòng 2 x1 x1 PCR system of R1 F.Conc. PCR system of R2 F.Conc. Vol (µl) Vol (µl) Water 16.3 Water 34.8 PCR bufer (10X) 2.5 1X PCR bufer (10X) 5 1X dNTP mix (5 mM) 2 0.2 mM dNTP mix (5 mM) 4 0.2 mM Primer pre16as(10pmol/l) 0.5 0.5 µM Primer A (10pmol/l) 1 0.5 µM Primer 590as(10pmol/l) 0.5 0.5 µM Primer non A(10pmol/l) 1 0.5 µM Primer 1865(10pmol/l) 1 Taq Polymerase (5U/µl) 0.2 1 unit Taq Polymerase (5U/µl) 0.2 1 unit DNA template 3 N/a DNA template 3 N/a Total 25 Total 50 3. Chu trình luân nhiệt như sau: 3.1. PCR vòng 1: Chu trình gồm 35 chu kỳ, mỗi chu kỳ 4 bước: Bước 1: Duỗi xoắn ADN cưỡng bức ở 940 C trong 5 phút.
  15. Bước 2: Hạ nhiệt độ xuống 580 C và duy trì trong 45 giây để primer gắn vào gen đích. Bước 3: Nâng nhiệt độ lên 720 C và duy trì trong 7 phút để Taq DNA- polymerase xúc tác phản ứng nối dài primer theo nguyên lý bổ xung với gen đích của HBV để tổng hợp nên đoạn ADN mới giống hệt đoạn ADN của gen đích ban đầu. 3.1. PCR vòng 2: Chu trình gồm 40 chu kỳ, mỗi chu kỳ 4 bước: Bước 1: Duỗi xoắn ADN cưỡng bức ở 940 C trong 5 phút. Bước 2: Hạ nhiệt độ xuống 580 C và duy trì trong 45 giây để primer gắn vào gen đích. Bước 3: Nâng nhiệt độ lên 720 C và duy trì trong 7 phút để Taq DNA- polymerase xúc tác phản ứng nối dài primer theo nguyên lý bổ xung với gen đích của HBV để tổng hợp nên đoạn ADN mới giống hệt đoạn ADN của gen đích ban đầu. 4. Điện di sản phẩm PCR trên Agarose 1,5%, nhuộm Ethidium bromide và đọc trên máy đọc Gel- Doc. Kết thúc giai đoạn PCR thu được kết quả: Đoạn DNA kích thước 527 bp. 2.3.4. Phản ứng cắt bằng enzyme SspI Sử dụng enzym giới hạn FastDigest SspI để cắt sản phẩm PCR vòng 2. . Kết quả sau khi thực hiện phản ứng cắt sẽ thu được 2 phần mà sẽ tạo 1 vạch trên hình ảnh điện di có kích thước khoảng 444 bp và 1 vạch là phần còn lại của sản phẩm PCR vòng 2. Protocol dùng FastDigest SspI []: - 10X FastDigest buffer: 2μl - FastDigest Enzym: 1μl - PCR product: 10 μl - Water, nuclease-free: vừa đủ 20μl
  16. Ủ ở 37 trong 15 phút. Điện di trong agarose 1.5% kiểm tra band đặc hiệu. Những mẫu nào có 2 vạch tương ứng với vị trí 444 bp và 80 bp thì là cắt. 2.3.4. Phản ứng cắt bằng enzyme TasI Sử dụng enzym giới hạn FastDigest TasI để cắt sản phẩm PCR vòng 2. Protocol dùng FastDigest TasI []: - FastDigest buffer B: 2μl - FastDigest Enzym: 1μl - PCR product: 15 μl - Water, nuclease-free: vừa đủ 30μl Ủ ở 650C lắc 650 vòng/phút trong 15 phút. Điện di trên thạch Agarose kiểm tra, phân tích và xác định genotype dựa vào tính đa hình của các đoạn giới hạn. 2.3.2.6. Phương pháp đọc trình tự DNA theo Sanger trên máy đọc trình tự tự động phân tích kết quả bằng các phần mềm chuyên dụng Sơ đồ qui trình: Chạy PCR gắn BigDye Tinh sạch BigDye Biến tính HiDi Chạy máy giải trình tự tự động ABI 3130 system Phân tích trình tự gene Thứ tự các bước thực hiện bao gồm:
  17. * Chạy phản ứng PCR gắn BigDye: Thành phần phản ứng: + BigDye Buffer 5X: 2 μl + BigDye terminator: 4 μl + Primer M13: 1 μl + DNA template: 0,8 μg + Nước cất khử ion: vừa đủ 20 μl. Chu trình nhiệt: 960C x 1 phút (960C x 10 giây 500C x 5 giây 600C x 4 phút) x 25 chu kỳ. 40C: forever * Tinh sạch sản phẩm PCR gắn BigDye: Tinh sạch BigDye ở sản phẩm PCR trên bằng Ethanol và EDTA theo quy trình của BigDye Terminater v3.1 [21]: + Cho 5 μl EDTA nồng độ 125 mg vào tận đáy tube chứa sản phẩm. + Cho thêm 60 μl ethanol tuyệt đối vào mỗi phản ứng. + Ủ ở nhiệt độ phòng 15 phút. + Ly tâm 2500g x 30 phút ở 40C + Bỏ nước nổi, thêm 60 μl ethanol 70% vào mỗi tube. + Ly tâm1650g x15 phút ở 40C. + Bỏ nước nổi. + Làm khô bằng Vacum Dry trong 15 phút ở 450C. * Biến tính HiDi và chạy Sequening Sản phẩm tinh sạch sau khi đã làm khô và hả hết hơi cồn, được thêm vào mỗi tube 20 μl HiDi. Để ở 950C x 5 phút rồi 40C x 5 phút. Cuối cùng đưa toàn bộ sản
  18. phẩm đã biến tính vào máy giải trình tự tự động ABI avant 3130. Vận hành máy theo đúng qui trình phần mềm đã cài đặt. * Phân tích kết quả: Kiểm tra kết quả thu được bằng phần mềm của máy ABI avant 3130. Sau đó đối chiếu với genbank xác định genotype của HBV. Xử lý số liệu thu được theo phương pháp thống kê y học, sử dụng chương trình thống kê tin sinh y học.
  19. III. KẾT QUẢ VÀ BÀN LUẬN 3.1. Kết quả Nested – PCR Sau khi chạy phản ứng PCR1 sẽ cho đoạn gen có kích thước 580bp. Sử dụng sản phẩm này làm DNA template cho phản ứng PCR2. Khi điện di sẽ cho band đặc hiệu ở vị trí tương ứng 527bp. Kết quả cụ thể ở bảng 3.1 Bảng 3.1: Kết quả điện di sản phẩm Nested - PCR Kết qủa Số lượng Tỷ lệ(%) Có band đặc hiệu 55 100 Không có band đặc hiệu 0 0 Tổng số 55 100 527bp Nhận xét: 100% các mẫu có band đặc hiệu tương ứng với 527bp 3.2. Kết quả cắt bằng SspI Bảng 3.2: Kết quả cắt sản phẩm Nested-PCR bằng enzym SspI Kết qủa Số lượng Tỷ lệ(%) Cắt 33 60 Không cắt 22 40 Tổng số 55 100
  20. Nhận xét: Khi cắt bằng SspI có 60% số mẫu bị cắt thành 2 band tương ứng với vị trí 440bp và 80bp. Có 40% số mẫu không bị cắt bởi enzym này. Như vậy 33 mẫu có thể là genotype A hoặc B. Còn 22 mẫu không cắt thì kiểu gen là từ C đến H. 3.3. Kết qủa cắt bằng TasI Bảng 3.3: Kết qủa cắt sản phẩm Nested-PCR bằng enzyme TasI Genotype Số lượng Tỷ lệ(%) B 33 60 C 22 40 Nhận xét: Khi cắt bằng enzyme TasI có 60% số mẫu cắt thành 2 band tương ứng với vị trí 168 bp và 183 bp. Có 40% số mẫu cắt thành 2 band tương ứng với vị trí 200 bp và 231bp. Đối chiếu với các đoạn giới hạn của các genotype của HBV thì 60% là genotype B và 40% là genotype C. Kết qủa này cũng phù hợp với nghiên cứu của Phạm Thu Thuỷ tại thành phố Hồ Chí Minh genotype B là 60% và genotype là 40%.

CÓ THỂ BẠN MUỐN DOWNLOAD

Đồng bộ tài khoản