intTypePromotion=1
ADSENSE

Nghiên cứu ứng dụng kỹ thuật Nested RT-PCR trong chẩn đoán nhiễm Rubella trước sinh

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:8

1
lượt xem
0
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Mục tiêu của đề tài là hoàn thiện chương trình phát hiện đo virut Rubella bằng kỹ thuật RT-PCR lồng vào nhau; áp dụng kỹ thuật RT-PCR lồng nhau trong kiểm tra virut Rubella trước khi sinh ở đối tượng nhóm có nguy cơ cao. Mời các bạn cùng tham khảo nội dung chi tiết.

Chủ đề:
Lưu

Nội dung Text: Nghiên cứu ứng dụng kỹ thuật Nested RT-PCR trong chẩn đoán nhiễm Rubella trước sinh

  1. TÀ I L IỆ U TH A M K H Ả O ỉ. Hoàng văn Ngọc. Nghiên cứa thực trạng bệnh thalassemia và một số yếu tố liên quan ở trẻ em dân tộc Tày và Dao tại huyện Định Hóa tỉnh Thái Nguyên, Luận văn Thạc sỹ Y học. 2007. 2. Nguyễn Công Khanh. Một số đặc điểm lâm sàng và huyết học bệnh p Thalassemia ở người Việt Nam. Luận án Phó Tiến sỹ khoa học Y dược, Đại học Y Hà Nội. 1985. 3. Lý Thị Thanh Hà, Ngô Diễm Ngọc, Nguyễn Thị Phư ng Mai, Nguyễn Tân Sinh, Dư ng Bá Trực, Bùi Văn Viện, Nguyễn Thanh Liêm, ứn g dụng kỹ thuật sinh học phân tử trong chẩn đoán trước và sau sinh bệnh alpha Thalassemia tại Bệnh viên Nhi TW.Tạp chí Nhi khoa, tập 3, số 3,4 tháng 10/2010, tr.337­342. 4. Chui DH, Way JS. Hydrops fetal is caused by aỉpha­thalassemia: an emerging health care problem. Blood.1998, 91, pp.2213­2222 5. Di ss roth A. t al Hemoglobin synthesis in somatic cell hybrid: independent segregation of the human alpha and beta globin gene. Science 191,1976, p.1262. 6. Potrakul s. t al. Incidence of a Thalassemia in Bangkok. J.Med. Assoc, Thailan 1970,53, pp.250. 8. Told D.Lai MCS, Braga C.A, ISoo N.H. Alpha thalassemia in Chinese cord blood studies. Br J.Haematoi. 1969, 16, pp.551­556. 9. Embury S.H. t a t Organization o f the a globin gen in the chines a thalassemia syndromes. J.Clin.Inv sX. 1979,63. NGHIÊN c ứ u ỨNG D NG KỸ THUẬT NESTED RT-PCR TRONG CHÂN ĐOÁN NHIỄM RUBELLA TRƯỚC SINH BS. Đặng Tiến Trường*; s v . Lê H òa Yên* s v . N guyễn V ìấ H iếu* B S. Nguyễn Thị Hà* Ht âng dẫn; PGS. TS Nguyễn D uy Bắc* TÓM TẲT Sốt phátban Rubella đo virut Rubella gây nên, bệnh thường nhẹ, ít biến chứng. Tại Việt Nam, chưa có chương tr nh tiêm chủng quốc gia phòng nhiễm Rubella; nhiều thai phụ nhiễm Rubella phài đ nh chỉ thai nghén mà không rõ thai nhi có nhiễm Rubella không?. Việt Nam chưa có phương pháp chẩn đoán trước sinh CRĨ đạt được các tiêu chí chính xác, sớm, rè, đòi hỏi phương tiện đơn giản. V vậy, chúng tôi tiến hành đề tài với mục tiêu: ­ Hoàn thiện quy trìnhphát hiện nhiễm virut Rub lla bằng kỹ thuật nestedRT-PCR. - Áp dạng kỹ thuật n st d RT-PCR trong chẩn đoán nhiễm virut Rub lla trước sình ở nh m đối tượng cổ nguy c cao. Đổi tượng và phương pháp nghiên cún: 60 mẫu bệnh phẩm nhiễm virut Rubella. 60 mẫu tác nhân khác gây các triệu chứng phát ban. 41 thai phụ được chẩn đoán nhiễm virut Rubella bằng kỹ thuật huyết thanh học. Phương pháp nghiên cứu: ­ Tách chiết ARN và ADN. ­ Tối ưu hóa phản ứng Nested RT­PCR: tối ưu hóa thành phần và chu tr nh nhiệt của phản ứng. Sau khi nhân ADN đích, điện đi sản phầm ADN trên agarose gel 2% và phân tích kểt quả. ­ Đánh giá độ chính xác của kỹ thuật: xác định độ nhạy và độ đặc hiệu của kỹ thuật, chẩn đoán trên 60 mẫu ARN của virut Rubella và 60 mẫu không nhiễm phải virut Rubella, tính độ nhạy và độ đặc hiệu. + Xác định ngưỡng phát hiện của kỹ thuật: tiến hành chẩn đoán ưên các mẫu ARN pha loăng. + Giải tr nh tự sản phẩn phản ứng nested RT­PCR để xác định sản phẩm gen virut Rubella. ­ Áp dụng kỹ thuật nested RT­PCR trong chẩn đoán trước sinh. * Học viện Quân y 560
  2. Kết quả nghiên cứu: ­ Tối ưu hóa phản ứng nested RT­PCR: đã tôi ưu hóa thành phần và chu tr nh nhiệt cùa phản ứng nested RT­PCR. ­ Đánh giá độ nhạy và độ đặc hiệu của kỹ thuật: kỹ thuật xác định đương tính vói 60 mẫu virut Rubella và âm tính vói 60 mẫu khác. Độ nhạy của kỹ thuật 100%; độ đặc hiệu của kỹ thuật 100%, không có phản ứng chéo với các loại virat khác gây ưiệu chứng phát ban như Rubella. ­ Xác định được ngưỡng phát hiện của kỹ thuật nested RT­PCR là 10*6ng/fjl. ­ Kểt quà giải tr nh tự, Blast trên ngân hàng gen cho thấy, tr nh tự gen này của virut Rubella. Trong 41 mẫu dịch ổi tiến hành xé£ nghiệm, 15/41 mẫu cho kết quả đương tính, 26/41 mẫu âm tính. Kết quả này tương đồng với kết quà real time­PCR và phù hợp vói kết quả xét nghiệm IgM máu cuống rốn của thai nhi khi đ nh chỉ thai nghén. Kết luận và kiến nghị: ­ Đã tối ưu hóa quy tr nh kỹ thuật nested RT­PCR trong chẩn đoán nhiễm virat Rubella trước sinh với độ chính xác cao. Kết quà chẩn đoán trước sinh tương đồng với kết quả real time PCR và xét nghiệm IgM máu cuống rốn khi đ nh chỉ chỉ thai nghén. ­ Kỹ thuật nested RT­PCR đơn giàn, giá thành thấp, chính xác, nên được triển khai áp dụng rộng rãi ở các bệnh viện và cơ sở xét nghiệm, giúp giảm số trẻ mác CRS, giảm gánh nặng cho gia đ nh và xã hội. *Từ khóa: Virut Rubella; Nested RT­PCR. Application o f n st d R T-PC R t chniqu m diagnosis o f pr natal rub lla vừĩis Summ ary Rubella typhus caused by Rubella virus, the disease is usually mild, less complications. However, pregnant women infected with Rubella in the first trimester, 80 ­ 100 of fectus infected congenital Rubella infection ­ CRI and over 65% of cases of congenital rubella syndrome ­ CRS. CRS has the following expression: mental retardation, congenita deafness, cataracts, cardiovascular system defects... In Vietnam, there is not a national immunization program of Rubella prevention. Now, there is no method for prenatal diagnosis of CRI with precise, early, cheap and simple. So, we conducted subject to the following objectives: establish of nested RT­PCR techniques for detection of rubella virus; application of nested RT­PCR technique in the diagnosis of prenatal rubella virus infection in high­risk subjects. Materials and method: ­ 60 samples infected with Rubella virus, technical diagnosed fay real time PCR and vims isolation. 60 samples contaminated with bacteria and other viruses cause symptoms such as Rubella rash. ­ 41 women infected with rubella virus by serological techniques. Method: Extraction of RNA and DNA. ­ Optimization of nested RT­PCR reactions ­ DNA products was electrophoresis on agarose gel 2% and analyze the results. DNA products of the reaction of the nested RT­PCR is theoretically 143 bp ­ Evaluation of accuracy: using nested RT­PCR technique in the diagnosis of 60 RNA Rubella samples and 60 samples contain other virus, 2 x 2 tabulation to calculate sensitivity and specificity of technique; dilution series of RNA Rubella virus from 100 ng/ịil to 10­8ng/jxl, for determine the detection threshold. DNA product was sequenced to comfum isolation from rubella virus. ­ Application of nested RT­PCR technique in the diagnosis of prenatal rubella virus: diagnosis on 41 samples of amniotic fluid of pregnant women infected with rubella in the first trimester. Results: Accomplishment of nested RT­PCR technique in the diagnosis of rubella virus. Optimization ofRT­PCR and nested PCR. There were many times of optimization of components and thermal cycle of reactions of RT­PCR and nested PCR, we obtained reactive component and condition of RT­PCR and nested PCR. 561
  3. Evaluation of accuracy: The sensitivity and specificity were 100%; no cross­reactivity with other viruses. Nested RT­PCR technique can detect samples containing concentrations at lo^ng/jil, corresponding to 0.001 pg/fjl which suggests that the level of detection of nested RT­PCR technique is very low. Results of sequencing, gene banks Blast show that gene sequence were rubella virus. Application of nested RT­PCR technique in the diagnosis of prenatal Rubella virus: In 41 amniotic fluid samples the tests conducted 15/41 positive samples, 26/41 negative samples. The result was consistent with the results of real iime­PCR and in accordance with IgM test results of fetal cord blood after abortion. Nested RT­PCR is a rapid diagnostic method, with high sensitivity and specificity, able to detect RNA of rubella in many different types of samples. Nested RT­PCR was more advantage than that of virus isolation methods for time, less complex requires simpler equipment. Condution: ~ Fully optimized nested RT­PCR technique in diagnosis of prenatal rubella virus infection with high accuracy Prenatal diagnosis similarities to real time PCR results and cord blood IgM test after abortion. ­ Nested RT­PCR technique, was simple, low cost, accurate, should be deployed widely used in hospital and laboratory facility, which helps reduce the number of children with CRS, reduce the burden on family and society Assembly. * Key words: Rubella virus; Nested RT­PCR. LĐẶTVẲ NĐ Sốt phát ban Rubella hay “sởi Đức” do virut Rubella gây nên, đặc trưng bời sốt, nổi ban và tổn thương hạch bạch huyết [ ỉ, 9]. Bệnh thường nhẹ, ít biển chứng. Tuy nhiên, phụ nữ mang thai nhiễm Rubella có thể gặp nhiều biến chứng như: sảy thai, thai chết lưu, dị tật thai nh i... Thai phụ mang thai nhiễm Rubella, thai nhi có nguy cơ bị nhiễm R ubella bẩm sinh (Congenital Rubella Infection ­ CRĨ) và bị hội chứng Rubella bẩm sinh (Congenital Rubella Syndrome ­ CRS). Người mẹ bị nhiễm Rubella trong 3 tháng đầu của thai kỳ 80­ 100% thai nhi bị CRI và trên 65% mắc CRS (Congential Rubella Syndromes ­ CRS). CRS có những biểu hiện chính như: Chậm phát triển trí tuệ, điéc bẩm sinh, đục thủy tinh thể, dị tật hệ thống tim m ạch... Những đị tật này gây nhiều vấn đề về sức khỏe và xã hội cần phải giải quyết. Theo thông báo của Tổ chức Y tế The giới, trên toàn cầu có khoảng 800.000 người mắc Rubella mỗi năm và tỷ ỉệ mắc CRS hàng năm là 0 6­ 2,2/1000 trẻ sổng. Thực íế, con số này còn lớn hơn nhiều [3, 5, 9]. Tại Việt Nam, hiện chưa có chương tr nh tiêm chủng quốc gia phòng nhiễm Rubella; năm 2011, dịch Rubella có xu hưởng lan rộng, số lượng ca phải dinh chỉ thai nghén đo thai phụ nhiễm Rubella tăng lên rất nhanh mặc đ i chưa xác định được thai nhi có nhiễm Rubella hay không?. Theo Hoàng Thị Thanh Thủy (2012), trong 6 tháng đầu năm 2011, chỉ tính riêng ở Bệnh viện Phụ sản TW có tới 914 ca phải đ nh chỉ t iai nghén do thai phụ nhiễm Rubella; trong đó, 285 thai phụ xin đ nh chỉ thai nghén mặc dù không có chỉ định [1]. Hiện nay, ở Việt N am chưa có phương pháp chẩn đoán trước sinh CRI đạt tiêu ch í chính xác, sớm rẻ đòi hỏi phương tiện đơn giản. Chẩn đoán bằng huyết thanh học và lấy máu cuống rốn muộn, độ chính xác hạn chê. Chẳn đoán bằng real time PCR cần phương tiện và hóa chất đắt tiền, nên giá thành cao. Trong các vụ địch vừa qua, số ca phải đ nh chỉ thai nghén nhiều, mặc dù chưa có kết quả xét nghiệm xác định có bị CRI hay không?. Đ ể giải quyểt những vấn đề trên, chúng tôi tiến hành đề tài “Nghiên cứu ứng dụng kỹ thuật Nested RT ­ PCR trong chẩn đoán nhiễm vi rút Rubella trước sinh” với mục tiêu: Hoàn thiện quy trình ph á t hiện nhiễm virut Ruh ỉỉa bằng k ỹ thuật n st d RT-PCR. ­ Ắ p dạ n g k ỹ thu ậ t n st d R T-P C R trong chẩn đoản nhiễm virut Rub ữa trước sinh ở n hổm đ i tư ng cồ nguy c ơ cao. 562
  4. n . ĐÓI TƯỢNG VÀ PHƯƠNG PHÁP NGHI N c ứ u 2.1. Đổi tượng nghiên cứu ­ Tối ưu hóa phản ứng nested RT­PCR: 01 mẫu virut Rubella được phân lập từ mẫu bệnh nhiễm vinit Rubella do Khoa Viruĩ, Viện Vệ sinh Dịch tễ TW cung cấp. ­ Đánh giá độ chính xác của kỹ thuật nested RT­ PCR: 60 mẫu bệnh phẩm nhiễm virut Rubella, được chẩn đoán bằng kỹ thuật real time PCR và phân lập virut. 60 mẫu bệnh phẩm nhiễm các loại vi khuẩn và yirut khác, gây triệu chứng phát ban như Rubella. ­ Áp dụng kỹ thuật nested RT­PCR trong chẩn đoán trước sinh. ­ 41 thai phụ được chẩn đoán nhiễm virut Rubella bằng kỹ thuật huyết thanh học. 2.2. Phương pháp nghiên cứu 2.2.1. Tách chiết ARN Tách chiết ARN của virut Rubella bằng bộ kit QIAamp@Viral RNA Mini kit, hãng QIAGEN, theo qui X ' 0 tr nh của nhà sản xuât; ARN tách chiêt được lưu trữ ở ­80 c cho tới khi sử dụng. Tách chiết ADN bằng bộ kít QIAamp® DNA M ini kit. ADN sau khi tách chiết được lưu trữ ở ­20°c cho tới khi sử dụng. 2.2.2. Phản ứng khuếch đại gen nested RT-PCR ­ Phản ứng RT­PCR: ARN được chuyển thành cADN và nhân AD N đích nhờ phản ứng RT­PCR bằng bộ Kit Qiagen onestep. Thể tích phản ứng gồm: 5x QIAGEN OneStep RT­PCR Buffer 10 ịil; hỗnhợp đNTP: 2 Ịil; Q solution: 10 ụ\; enzym mix 2 ịil; Primer R u lF 1 ụ\; Primer R u lR 1 |il; mẫu ARN: 2 jil; H 2O vừa đủ 50 |il. Chu tr nh nhiệt gồm các giai đoạn sau: chuyển đổi ARN thành cADN ở 5 0°c trong 30 phút, sau đó biến tính 9 5 °c ở ỉ 5 phút; thực hiện 30 chu kỳ gồm các giai đoạn: duỗi xoắn ở 9 5 °c trong 30 giây, bám mồi Ố0°c trong 30 giây, kéo dài 7 2 ° c trong 45 giây. Cuối cùng là giai đoạn kéo dài 7 2 °c trong 10 phút. ­ Phản ứng nested PCR: Thành phần phản ứng gồm: Buffer 10 X 5 |il; hỗn địch dNTP 0,8 ịil; Primer Ru2F 1 pi; Primer Ru2R 1 Ịil; KAPA Tag Polymerase 0,2 Jil; 4 fxl sản phẩm của phản ứng RT­PCR; H20 vừa đủ 50 |U. Chu tr nh nhiệt gồm các giai đoạn: biến tính 9 5 ° c ở 15 phút; thực hiện 30 chu kỳ gồm các giai đoạn:, duỗi xoắn ở 9 5 °c trong 30 giây, bám mồi 61 °c trong 30 giây, kéo dài 7 2 °c trong 45 giây. Cuối cùng là giai đoạn kéo dài 7 2 °c trong 10 phút. Sau khi nhân ADN đích, điện di sản phẩm ADN trên agarose gel 2% và phân tích kết quả. Sản phẩm ADN của phản ứng nested RT­PCR theo lý thuyết à 143 bp. Bảng 1. Tr nh tự các primer phục vụ nhân ADN của virut Rubella Ký hiệu Tr nh tự (5’­3 ’) Vị trí Tm°c Sàn phẩm R11I­F CAACACGCCGCACGGACAAC 8807 ± 8826 66 185bp Rul­R CCACAAGCCGCGAGCAGTCA 8991 ± 8972 66 Ru2­F CTCGAGGTCCAGGTCCYGCC 8826 ± 8845 68 143bp Ru2­R GAATGGCGTTGGCAAACCGG 8968 ± 8949 64 2.3. Đánh giá độ chính xác của kỹ thuật 2.3.1. Độ nhạy và độ đặc hiệu của kỹ thuậỉ Tiến hành sử dụng kỹ thuật nested RT­PCR chẩn đoán trên 60 mẫu ARN của virut Rubella và 60 mẫu khác không phải virnt Rubeỉla (12 mẫu sởi (ARN), 20 mẫu đengue (ARN), 3 m ẫu parvovirus B19 (ADN), 8 mẫu Chikungunya (ARN) 16 mẫu Coxsackie A (ARN), 01 mẫu Ad no virus (ADN). Lập bảng 2x2 để tính độ nhạy và độ đặc hiệu. 563
  5. 2.3.2. Xác định ngư ng phát hiện của kỹ ỉhuật Tách chiết ARN từ mẫu nuôi cấy virut Rubella, đo nồng độ ARN trên máy Nano drop; pha ỉoãng thành dung dịch ARN có nồng độ 100 ng/fil. Tiên hành pha loãng dàn mẫu ARN của virut Rubella có nồng độ 100 ng/(i (tương đương 105pg/fil) theo hệ số 10 thành dung dịch ARN có nồng độ 100 ngẠil, 10 ng/|il, 1 ngậđ, ỉõ ' ng/fjl, 10'2 ng/fil, 103 ng/fil, lo4 ng/|AỈ, 10 s ng/|il, 106 ng/|il, 10 7 ng/fil, 10‘8 ng/jil. Tiến hành chẩn đoán bằng kỹ thuật RT­PCR và nested RT­PCR trên các mẫu được pha loãng để xác định ngưỡng phát hiện của kỳ thuật. 2.3.3. Giải trình tự sản phẩn phản úng nested RT-PCR Đ ê c h ứ n g rninh sản nr h ẩ n zTtzbâ” z u .il ffep vww c ử a jJiiUIl « hả« ứĩ»ơ iivừlvU «e«í:eH iPvTi ­Pi í^ wiVP lỊp a t>r gơ«»n liiii ii t ụ ­"'IP v iỉ V UU vif’if Viiul iVUUVÚÀ. UOlỉ phâm của phản ứng nested RT­PCR được giải tr nh tự và so sánh trên genbank. 2.4. Á p đ ụ ng k ỹ th u ậ t ne ste d R T ­P C R tro n g ch ẫn đo án trư ớ c sinh Kỹ thuật nested RT­PCR được áp dụng chẩn đoán trên 41 mẫu dịch ối của thai phụ được xác định nhiễm virut Rubella trong 3 tháng đầu của thai kỳ bằng phương pháp huyết thanh học. Kết quả chẩn đoán cùa kỹ thuật nested RT­PCR so sánh vói kết quả real time­PCR và kết quả xét nghiệm IgM mấu cuổng rốn của thai nhi sau khi đ nh chỉnh thai nghén. 2.5. Thiết bị, hóa ch t 2.5.1. Thiết b| Dụng cụ và thiết bị chuyên dụng được sử dụng tại Trung tâm nghiên cứu Y học Quân sự ­ Học viện Quân y gồm: máy luân nhiệt tự động GeneAmp PCR system 9700 A BI (Applied Biosystèms, Hoa Ky), may ly tâm lạnh M ikro 22R (Hettich, Đức), máy soi và chụp gelDoc (Hoa Kỳ), bộ điện đi cùa Bio Rad. 2.5.2. Hóa ch t Qiagen ARN mini kít, Kit Qiagen onestep, Primer do hãng ĩnvitrogen tổng hợp, nước khử ion, agarose, li ang ADN chuẩn do hãng Sigma cung cấp và các vật tư tiêu hao khác. r a . KÉT QUẢ VÀ BÀN LUẬN 3.1. Hoàn thiện kỹ thuật nested RT-PCR trong chẩn đoán nhiễm virut Rubella. 3.1.1. Tối ưu hóa phản ứng RT-PCR và nested PCR Sau nhiều lần tối ưu hóa các thành phần phản ứng và chu tr rih nhiệt của phản ứng ở giai đoạn RT­PCR và giai đoạn nested PCR, chứng tôi thu được bảng thành phần phản ưng của giai đoạn RT­PCR và nested PCR được tr nh bày chi tiết trong phần phương pháp nghiến cứu. Trong phần báo cáo tóm tắt này, chỉ h nh ảnh tối ứu hóa nhiệt độ gắn primer được thể hiện và phân tích. -P h ả n ứng RT-PCR: IBipKililllllil m fs­ỉa.­iS ­5 Hình 1. Hình ảnh tối ưu hóa nhiệt độ gắn primer của phản ứng RT-PCR M: marker 100; NC: chứng âm; 1­8 lần lượt ỉà các băng sản phẩm của phản ố ng ở Ta lần lượt là 55 °c 57°c, 58°c, 59 c , 60°c, 61 °c, 63°c, 65°c. 564
  6. Để lựa chọn nhiệt độ gắn primer tối ưu, chúng tôi thực hiện phản ứng ở các ống khác nhau với cùng thành phần phản ứng và chu tr nh nhiệt như trên; chỉ khác nhau nhiệt độ gắn primer (Ta). Ta của primer phụ thuộc vào nhiệt độ nóng chảy của primer (Tm). Thường Ta của primer hơn kém Tm 5 ­ 10°c. Căn cứ vào Tm cùa primer là 66°c, tiên hành thư ở nhiệt độ 55°c, 57°c, 58°c, 59°c, 60°c, 61°c, f c , 65°c Kết quả ờ h nh 1 cho thấy, ở dải nhiệt độ từ 55 ­ 65 ° c đều xuất hiện băng sản phẩm. Tuy nhiên, các băng ờ nhiệt độ gắn primer thấp có smear lớn hơn. Nhiệt độ tang, smear thu hẹp dần. Từ 60 ­ 65°c không còn xuất hiện smear nữa. Tuy nhiên, phản ứng PCR sẽ không ổn định ở nhiệt độ gắn primer cao, nên chúng tôi quyết định chọn nhiệt độ gắn primer ở 60 °c. Điều này cho thấy, ờ nhiệt độ < 60°c sản phẩm PCR tạo ra nhiều, nhưng không xuất hiện sản phẩm phụ. ở nhiệt độ cao, tính ổn định của hoạt tính emzym polymerase sẽ giảm theo thời gian. Ở 60°c, băng sản phẩm không có smear và đậm nhất. Điều này có nghĩa ờ nhiệt độ này ta thu được sản phẩm đặc hiệu và hiệu suất phản ứng cao nhất. Như vậy, nhiệt độ gắn primer của phản ứng RT­PCR là 60°c. ­ Phản ứng n st d PCR H nh 2. Kêt quả tối ứu hóa nhiệt độ gắn primer của phản ứng nested PCR M: marker 100; NC1: chứng âm của NC của phản ứng RT­PCR; NC2 chứng âm hóa chất vòng 2; 1­7 lần lượt là các băng sản phẩm của phản ứng ở Ta lần lượt là 57°c, 58°c, 59°c, 60°c, 61°c, 63°c, 64°c. Có rất nhiều yếu tố ảnh hưởng tới kết quả của phản ứng PCR như nhiệt độ gắn primer, thời gian gắn primer, thời gian kéo dài chuỗi, hoạt động của enzym, nồng độ dNTP, nồng độ Mg2+... Khi tối ưu hóa phản ứng PCR, cần phải tối ưu hóa tất cả những yếu tố đó để có kết quả tốt nhất. Tuy nhiên, công việc này mất nhiều thời gian, công sức và hóa chất. V vậy, thực tể tối ưu hóa phản ứng PCR, thường tiến hành lựa chọn íhành phần phản ứng tiêu chuẩn và tiến hành tối ưu hóa nhiệt độ gắn primer (Ta) đầu tiên. Ta quyết định tới thành công hay thất bại của phản ứng PCR. Trong nghiên cứu này, ban đầu chúng tôi iựa chọn thành phần phản ứng và chu tr nh nhiệt như trên. Theo nguyên tắc dựa vào Tm của R2­F là 68°c và Tm của R2­R là 64°c. Chúng tôi lựa chọn dải nhiệt độ tối ưu hóa cho cặp primer của phản ứng nested PCR trong khoảng từ 57 ­ 64°c. Chúng tôi không đưa nhiệt độ Ta lên quá cao, v điều này không có lợi cho hoạt tính của enzym polymerase. Chúng tôi tiến hành chạy Ta ở nhiệt độ 57°c, 58°c, 59°c, 60°c, 61°c, 63°c, 64°c. Kết quả trên h nh 2 cho thây, Ta phản ứng Nested PCR ở 57°c, 58°c, 59°c, 60°c (băng từ 1­4) đều có băng sản phẩm phụ dài hơn sản phẩm chính. Ta ở 61°c, 63°c, 64°c xuất hiện băng sản phẩm rõ nét và không có sản phẩm phụ. Theo nguyên tắc ưu tiên sử đụng nhiệt Ta thấp, chúng tôi chọn Ta của phản ứng nested là 61°c. Sau khi xác định Ta primer của phàn ứng nested PCR là 61°c, tiểp tục thay đổi thời gian gắn primer, thời gian kéo đài chuỗi, lượng template đưa vào nhung hiệu quả của phản ứng nested không tốt hơn nên chu tr nh nhiệt được giữ nguyên như cũ. 3.1.2. Đánh giá độ chính xác của kỹ thuật thuật nested RT-PCR trong chẩn đoán nhiễm virut Rubella ­ Đánh giá độ nhạy và độ đặc hiệu của kỹ thuật 565
  7. Kỳ thuật xác định dương tính với 60 mẫu virut Rubella và âm tính với 60 mẫu các loại n ế u khác. Độ nhạy của kỹ thuật Se = [60:(60 + 0)] X 100% = 100%; độ đặc hiệu của kỹ thuật: Sp = [60:(60 + 0)3 X 100% = 100%. Các cặp primer của phán ứng nested RT­PCR không có phản ứng chéo vởi virut khác gây triệu chứng phát ban như Rubella. Phản ứng chéo không xảy ra ở virut có bản chất ARN giống Rubella và ADN không giống Rubella. Các nghiên cứu khác trên thế giới cũng cho thấy nested RT­ PCR có độ đặc hiệu cao (100%) [4]. ­ Xác định ngưỡng phát hiện của kỹ thuật nested RT­PCR Hình 3. Kết quả xác định ngư ng phát hiện của k ỹ thuật nested RT-PCR M: marker 100; NC: chứng âm của NC cùa phản ứng RT­PCR; 1­11 lần lượt là các băng sản phẩm của các mẫu 100ngẠiỉ, ÍOngẠiỉ, 1 ngẠil, lO^ngẠiỉ, 10"2ngẠil, lO^ng/gỉ, ỈO^ngẠil, lO^ngẠd, 10"7ng/|i], I0'8ngẠiI. Kỳ thuật nested RT­PCR có thể phát hiện mẫu có chứa nồng độ ở mức lơ 6ngẠil, tựơng ứng 0,001 pgẠil, điều này cho thấy ngưõng phát hiện của kỹ thuật nested RT­PCR rất thấp. Theo Thanapal AR và cs (2008), phương pháp RT­PCR có độ nhạy và ổn định hơn so với phương pháp real time PCR [8]. Cũng theo Bosma và cs (1995) RT­PCR có độ nhạy tương đương với 2 copies [4]. Trong khi đó, nghiên cứu của Kiyoko Okamoto và cs (2011) khẳng định phương pháp real time PCR khi sử dụng kit Taqman và chạy trên máy của hãng ABI chỉ cho chẩn đoán dương tính khi có tối thiểu 10 copies ARN của Rubella trong mẫu [6]. Điều này cho thấy kỹ thuật RT­PCR ưu thể hom so với kỳ thuật real time PCR về độ nhạy. Kết quả giải tr nh tự, Blast trên ngân hàng gen cho thấy, tr nh tự gen này là của virut Rubella. Phản ứng nested RT­PCR đã nhân được đoạn gen của virut Rubella chứ không phải của virut khác. 3.2. ứ n g dụng kỹ thuật nested RT-PCR trong chẩn đoán nhiễm virut Rubella truớc sinh Sau khi chuẳn hóa được quy tr nh trên mẫu chứng tiến hành áp dụng các bước tiến hành chẩn đoán trên 41 mẫu địch ôi của thai phụ bị nhiễm virut Rubella 3 tháng đầu. 3.2.1. Kết quả chẩn đoán trước sinh Rubella trên dịch ối và kết quả huyết thanh học của mẹ Trong 41 mẫu địch ỐỊ tiến hành xét nghiệm, 15/41 mẫu cho kết quả đương tính, 26/41 mẫu âm tính. Kết quả xét nghiệm ĩgM của mẹ cho 8 trường hợp dương tính và 33 trường hợp còn lạĩâ m tính. Bên cạnh đó, ket qua IgG lại cho 39 trường hợp dương tính va chi có 2 trường âm tính. Điều này cho thấy, IgM và IgG không phan ánh được thai nhi có nhiễm virut Rubella hay không. V vậy, không thể căn cứ vào kết quả xét nghiệm IgM và IgG của máu mẹ để đưa ra chỉ định đ nh chỉ thai nghén. 3.2.2. So sánh kết qu ả kỳ th u ật nested RT­PCR và kỳ th u ật real tim e PC R Toàn bộ mẫu dịch ối tién hành kỹ thuật nested RT­PCR phát hiện virnt Rubella so sánh với kỹ íhuật kỳ thuãt real time­PCR. 566
  8. 15/41 mẫu dịch ối cho kết quả dương tính với nested RT­PCR đều đo được số coppies bằng phương pháp real time­PCR. Tất cả các mẫu âm tính đều dưới ngưỡng hay không phát hiện được sự có mặt của ARN virut Rubella. Các sản phụ có kết quả nested RT­PCR dương tính vói virnt Rubella đều được chỉ định dinh chỉ thai nghén. Xét nghiệm IgM máu cuống rốn thai nhi vói vi rút ru virut Rubella. Kết quả cho thấy 15/15 số trường hợp đ nh chỉ thai nghén nghi đo CRI đều cho kết quả IgM máu cuống rốn dương tính. Nested RT­PCR là phương pháp chẩn đoán nhanh, với độ nhạy và độ đặc hiệucao, định ARN của Rubella trong nhiều loại mẫu bệnh phẩm khác nhau. Kết quả của xét nghiệm nhận được trong vòng 24 giờ kể từ khi nhận mẫu, ngược lại, phương pháp phân lập virat phải mất 3 ­ 4 tuần. Như vậy, RT­PCR ưu việt hơn hẳn so với phương pháp phân lập virut về thời gian, ít phức tạp hơn, đòi hỏi thiết bị đơn giản hơn [7, 8]. Ưu điểm này giúp kỹ thuật này có thể áp dụng ở nhiều bệnh viện, cơ sở xét nghiệm. Kỹ thuật huyết thanh học có nhiều nhược điểm như chỉ có thể áp dụng ở tuổi thai > 22 tuần, tỷ ỉệ âm tính giả cao do nồng độ kháng thể thấp trong máu cuống rốn của thai nhi, hơn nữa lấy máu cuống rốn là kỹ thuật phức tạp, chỉ tiến hành tại một số ít bệnh viện chuyên về sản khoa [7]. Năm 2011, dịch sốt Rubella bùng phát phức tạp ở V iệt Nam. Đặc biệt, bệnh lây lan rộng, nhiều phụ nữ mang thai nhiễm bệnh. Do chưa có công cụ chẩn đoán nhanh, đặc biệt là chẩn đoán trước sinh nhiễm Rubella bẩm sinh, kết hợp với cộng đồng íhiếu thông tin về Rubelỉa đã gây tâm lý hoang mang, lo lắng. Hơn nữa, có nhiều phụ nữ mang thai phải đ nh chỉ thai nghén do không có cơ sở chẩn đoán chính xác, khoa học [1]. V vậy, yêu cầu cần một công cụ chẩn đoán nhanh, chính xácgiúp cho việckiểm soát địch, hạn chế việc đ nh chỉ thai nghén không cần thiết [7]. IV. K ẾT LUẬN ­ Đã tối ưu hóa quy tr nh kỹ thuật nested RT­PCR trong chẩn đoán nhiễm virut Rubella trước sinh và xác định độ nhạy và độ đặc hiệu 100%, ngưỡng phát hiện 10"6 ngẠil (0,001 pg/ịil). ­ Kết quả chẩn đoán trước sinh bằng kỹ thuật nested RT­PCR phát hiện được 15/41 thai nhi nhiễm virut Rubella, tương đồng vói kết quả real time PCR và xét nghiệm máu cuống rốn sau khi đ nh chỉ thai nghén. TÀ I LIỆU TH A M K H ẢO 1. Nguyên Vãn Thưởng, Triệu Thị Thái, Phùng Nhã Hạnh, Nguyễn Vãn Bàng (2012), Hội chứng Rubelỉa bẩm sinh tại Hà Nội sau vụ địch đầu năm 2011, Tạp chí Nghiên cứu Y học. 2. Nguyễn Vũ Trung (2007). Vi rút Rubeỉla. V Sinh Y Học. Nhã xuất bản Y học, Hà Nội; tr. 304-307. 3. Banatva a J. E., Brown D. w . (2004), "Rub lla", Lancet, 363(9415), pp. 1127­37. 4. Bosma T. J., Corbett K. M., Eckstein M. B., O'Shea s., Vijayalakshmi p., Banatvala J. E., Morton K., Best J. M. (1995), "Use of PCR for prenatal and postnatal diagnosis of congenital rubella", J Clin Microbiol, 33(11), pp. 2881­7. 5. Cutts F. T­, Robertson s. E., Diaz­Ortega J. L., Samuel R. (1997), "Control of rubella and congenital rubelia syndrome (CRS) in developing countries, Pari Ỉ: Burden of disease from CRS", Bull World H alth Organ, 75(1), pp. 55­68. 6. Kiyoko o et al (2011). D v lopm nt o f a nov l TaqMan r al tim PCR assay for d t cting rub lla virus RNA. Journal of Virological M thods 168: pp. 267-271. 7. Kazumi K, Kaneko M, Sameshima H et al (2010). Rubella outbreak on Tokunoshima Island in 2004: a population­ based study of pregnant women. J Obst t Gyna col R s.36(5): pp. 938-43. 8. Thanapal AR et al (2008), Laboratory Confirmation of Cong nital Rub lla Syndrom inlnfanis: An Eye Hospital Based Investigation. Journal ofM dical Virology 80:pp. 536-546. 9. WHO (2010), "Controlling rubella and preventing congenital rubella syndrome ­ global progress, 2009", Wkly Epid miol R c, 85(42), pp. 413­8. 567
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2