intTypePromotion=1

Tóm tắt luận văn Thạc sĩ Khoa học: Xác định một số đoạn mã vạch ADN cho một số loài Trà hoa vàng ở vườn Quốc gia Tam Đảo

Chia sẻ: Nguathienthan Nguathienthan | Ngày: | Loại File: PDF | Số trang:15

0
33
lượt xem
3
download

Tóm tắt luận văn Thạc sĩ Khoa học: Xác định một số đoạn mã vạch ADN cho một số loài Trà hoa vàng ở vườn Quốc gia Tam Đảo

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Nghiên cứu gồm có năm nội dung chính: Tách chiết AND tổng số các mẫu lá trà hoa vàng, nhân bản các đoạn mã vạch ADN bằng kỹ thuật PCR, phân tích và xác định trình tự các đoạn mã vạch ADN thu được, xác định mối quan hệ di truyền giữa các loài trà hoa vàng nghiên cứu và với các loài khác trong chi trà Camellia dựa trên các trình tự thu được và xác định đoạn mã vạch đặc trưng cho các loài trà hoa vàng ở VQG Tam Đảo.

Chủ đề:
Lưu

Nội dung Text: Tóm tắt luận văn Thạc sĩ Khoa học: Xác định một số đoạn mã vạch ADN cho một số loài Trà hoa vàng ở vườn Quốc gia Tam Đảo

  1. ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN -------------------- HOÀNG MINH TRANG XÁC ĐỊNH MỘT SỐ ĐOẠN MÃ VẠCH ADN CHO MỘT SỐ LOÀI TRÀ HOA VÀNG Ở VƢỜN QUỐC GIA TAM ĐẢO Chuyên ngành: Sinh học thực nghiệm Mã số: 60420114 TÓM TẮT LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội - 2016
  2. Công trình được hoàn thành tại: Viện Công nghệ sinh học Lâm nghiệp - Trường Đại học Lâm nghiệp Việt Nam Người hướng dẫn khoa học: PGS.TS. Hà Văn Huân PGS.TS. Nguyễn Trung Thành Phản biện 1: PGS.TS. Nguyễn Thị Hồng Vân Phản biện 2: TS. Nguyễn Tƣờng Vân Luận văn được bảo vệ trước Hội đồng chấm luận văn thạc sĩ họp tại: Phòng 133 nhà T1 – Trường Đại học Khoa học Tự nhiên, ĐHQGHN Vào 09 giờ 30’ ngày 22 tháng 11 năm 2016 Có thể tìm luận văn tại: - Trung tâm Thư viện Đại học Quốc Gia Hà Nội
  3. I. MỞ ĐẦU Trà hoa vàng thuộc chi Trà Camellia (họ Theaceae, bộ Ericales) có hoa màu vàng, được phát hiện lần đầu tiên ở Việt Nam vào những năm đầu thế kỉ XX. Cho đến nay các nhà khoa học đã phát hiện ra khoảng trên 30 loài Trà hoa vàng, trong đó có 28 loài được tìm thấy ở Trung Quốc và 24 loài tìm thấy ở Việt Nam. Các loài trà hoa vàng có giá trị lớn về mặt dược liệu, được biết đến với tác dụng kiềm chế sinh trưởng khối u, ngăn ngừa ung thư, giảm lượng cholesterol và lipoprotein trong máu do có các nguyên tố vi lượng như Germanium (Ge), Selenium (Se), Mangan (Mn)… Ngoài ra trà hoa vàng còn có giá trị thẩm mỹ cao, được trồng làm cây cảnh do có hoa lớn màu vàng đặc trưng. Ở Việt Nam, Trà hoa vàng được phát hiện chủ yếu ở một số địa phương như VQG Tam Đảo (Vĩnh Phúc), VQG Cúc Phương (Ninh Bình), Phước Lộc (Lâm Đồng)…, trong đó ở VQG Tam Đảo phát hiện ra 8 loài với một số loài đặc hữu của Việt Nam như Camellia tamdaoensis, Camellia crassiphylla, Camellia petelotii … . Đây là nguồn gen vô cùng quý hiếm cho hệ thực vật ở Tam Đảo nói riêng và Việt Nam nói chung, cần được bảo vệ và phân loại để đưa ra biện pháp thích hợp cho việc bảo tồn nguồn gen, đa dạng sinh học. Tuy nhiên, hiện nay Trà hoa vàng ở Tam Đảo đang bị đe dọa nghiêm trọng do việc khai thác quá mức từ phía người dân, đồng thời việc bảo tồn và nghiên cứu còn chưa được chú ý nhiều . Cho đến nay, việc phân loại thực vật nói chung và các loài thuộc chi Trà nói riêng chủ yếu dựa vào các đặc điểm hình thái, cấu tạo giải phẫu bên trong . Việc phân loại này trong một số trường hợp gặp nhiều khó khăn do một số loài Trà hoa vàng có đặc điểm hình thái tương đối giống nhau. Với sự phát triển của sinh học phân tử và công nghệ gen, một phương pháp phân loại dựa trên kỹ thuật phân tích ADN đã được nghiên cứu và phát triển sử dụng các đoạn mã vạch ADN đặc trưng cho loài (DNA barcode) . Phương pháp này trở thành công cụ đắc lực cho các nhà khoa học trong việc phát hiện loài mới, phân loại, đánh giá đa dạng di truyền và quan hệ di truyền các loài. Mỗi đoạn mã vạch ADN có đặc trưng riêng và có khả năng phân biệt sinh vật ở các mức độ khác nhau (chi, loài, dưới loài). Một số đoạn mã vạch ADN được sử dụng phổ biến ở thực vật có thể kể đến như matK, rbcL, trnH-psbA, rpoB, rpoC1, psbI-psbK, atpF-atpH, trnL-trnF... Với mục xây dựng cơ sở dữ liệu phân tử cho các loài Trà hoa vàng ở VQG Tam Đảo, cụ thể là 5 loài Hải đường vàng (Camellia tienii 1
  4. Ninh), Trà vàng Hakoda (Camellia hakoda Ninh, Tr.), Trà vàng lá dày (Camellia crassiphylla Ninh et Hakoda), Trà vàng Tam Đảo (Camellia tamdaoesis Hakoda et Ninh), Trà vàng Petelo (Camellia petelotii (Merr.) Sealy), đề xuất mã vạch thích hợp đặc trưng cho các loài trà này thông qua việc xác định và phân tích trình tự của một số đoạn mã vạch, tác giả tiến hành đề tài “Xác định một số đoạn mã vạch ADN cho một số loài Trà hoa vàng ở Vƣờn Quốc gia Tam Đảo” với đối tượng phân tích là năm vùng trình tự rbcL, matK, ycf1b, trnH – psbA và ITS2. Kết quả thu được sẽ đóng góp vào Ngân hàng gen Quốc tế để giám định các loài Trà hoa vàng, xác định mối quan hệ di truyền giữa các loài Trà hoa vàng với nhau và với các loài trong chi trà Camellia, nâng cao hiệu quả bảo tồn và phát triển các loài Trà hoa vàng quý hiếm ở không chỉ ở Việt Nam mà còn trên toàn thế giới. II. VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. VẬT LIỆU NGHIÊN CỨU 2.1.1. Đối tƣợng nghiên cứu Năm loài trà hoa vàng trong nghiên cứu này gồm có: Camellia crassiphylla Ninh et Hakoda (Trà vàng lá dày), Camellia hakodae Ninh (Trà vàng hakoda), Camellia petelotii (Merr.) Sealy (Trà vàng petelo), Camellia tamdaoensis Hakoda et Ninh (Trà vàng tam đảo), Camellia tienii Ninh, Tr. (Hải đường vàng) với số lượng mẫu là 3 mẫu/loài. Năm đoạn mã vạch nghiên cứu: matK, rbcL, trnH-psbA, ycf1b và ITS2. 2.1.2. Nội dung nghiên cứu Nghiên cứu gồm có năm nội dung chính: Tách chiết AND tổng số các mẫu lá trà hoa vàng, nhân bản các đoạn mã vạch ADN bằng kỹ thuật PCR, phân tích và xác định trình tự các đoạn mã vạch ADN thu được, xác định mối quan hệ di truyền giữa các loài trà hoa vàng nghiên cứu và với các loài khác trong chi trà Camellia dựa trên các trình tự thu được và xác định đoạn mã vạch đặc trưng cho các loài trà hoa vàng ở VQG Tam Đảo. 2.2. PHƢƠNG PHÁP NGHIÊN CỨU 2.2.1. Hóa chất, thiết bị và dụng cụ Hóa chất sử dụng bao gồm bộ KIT tách chiết ADN thực vật “Plant/Fungi DNA Isolation KIT” - Norgen, Canada; hóa chất PCR: Master mix 2X, nước PCR, mồi nhân gen; bộ KIT tinh sạch sản phẩm PCR “PCR Purification KIT” – Norgen, Canada; hóa chất điện di: Agarose; đệm TAE; Redsafe solution. Dụng cụ và thiết bị thí nghiệm 2
  5. bao gồm găng tay, khẩu trang, pipette các loại, cối chày sứ… Máy móc sử dụng gồm có máy PCR, cân phân tích, máy ly tâm, máy đo nano drop, tủ lạnh -80o, bộ điện di, máy chụp ảnh bản gel… Mồi được sử dụng để nhân các đoạn trình tự được thiết kế dựa trên các tài liệu đã được công bố. Bảng 2.1. Trình tự các cặp mồi sử dụng Vùng Tên Tm Trình tự mồi gen mồi (oC) mTHV 5’- 60.7 F TCCATGGGTTTATATGGATCCTTCCTGGTT-3’ matK 5’- mTHV CCCGCCATGGATGGAAGAATTCAAAAGATA- 60.5 R 3’ rP1 F 5’- ATGTCACCACAAACAGAGACTAAAGC -3’ 57.2 rbcL rP1 R 5’ - GTAAAATCAAGTCCACCRCG - 3’ 52.8 trnH- trnPF1 5’- CGCGCATGGTGGATTCACAATCC - 3’ 61.1 psbA psbPR1 5’- GTTATGCATGAACGTAATGCTC - 3’ 52.3 5’- TCTCGACGAAAATCAGATTGTTGTGAA - ycf1b F 56.9 3’ ycf1b ycf1b 5’- ATACATGTCAAAGTGATGGAAAA- 3’ 50.6 R Is2P1 F 5’- ATGCGATACTTGGTGTGAAT - 3’ 51.9 ITS2 Is2P1 5’- TCCTCCGCTTATTGATATGC - 3’ 52.1 R 2.2.2. Phƣơng pháp nghiên cứu Thu mẫu lựa chọn mẫu lá bánh tẻ không bị sâu bệnh nấm mốc, lấy 3 mẫu/loài x 5 loài từ các cá thể độc lập. Sau khi thu, mẫu được bảo quản trong túi nilon có chứa hạt silica gel hút ẩm, ghi đầy đủ thông tin mẫu và được giữ ở -80oC để tách chiết ADN phục vụ nghiên cứu. Phương pháp tách chiết ADN tổng số từ các mẫu lá của 5 loài Hải đường vàng (Camellia tienii Ninh), Trà vàng Hakoda (Camellia hakoda Ninh, Tr.), Trà vàng lá dày (Camellia crassiphylla Ninh et Hakoda), Trà vàng Tam Đảo (Camellia tamdaoesis Hakoda et Ninh), Trà vàng Petelo (Camellia petelotii (Merr.) Sealy) theo hướng dẫn của Kit (Plant/Fungi DNA Isolation Kit). Xác định nồng độ và độ tinh sạch của dung dịch ADN tổng số bằng máy đo nano drop. Nhân bản đoạn gen matK, rbcL, 3
  6. trnH-psbA, ITS2 và ycf1b từ các mẫu ADN tổng số tách chiết được bằng kỹ thuật PCR trên máy PCR 9700 Thermal Cycler Applied Biosystems (Mỹ), mỗi phản ứng PCR được thực hiện trong tổng thể tích 20 μl, bao gồm: H2O deion (7 µl), 2x PCR Master mix Solution (10 µl), 10 pmol/ µl mồi xuôi (1,0 µl), 10 pmol/ µl mồi ngược (1,0 µl) và 50 ng/µl ADN khuôn (1 µl). Chương trình phản ứng PCR: 94oC trong 3 phút; (94oC: 30 giây, 55oC : 30 giây, 72oC : 1 phút) lặp lại 40 chu kỳ; 72oC trong 5 phút; bảo quản sản phẩm PCR ở 4oC. Nhiệt độ gắn mồi các phản ứng khác nhau phụ thuộc và cặp mồi sử dụng. Mỗi phản ứng PCR lặp lại 3 lần trên mỗi mẫu thí nghiệm. Kết quả PCR được kiểm tra bằng điện di trên gel agarose 1,0 %, quan sát kết quả dưới đèn cực tím (UV) và chụp ảnh bằng hệ thống Dolphin - Doc Image system của hãng Wealtec (Mỹ). Sản phẩm PCR được tinh sạch theo hướng dẫn của kit tinh sạch sản phẩm PCR (PCR Purification Kit) của Norgen, Canada. Sau khi tinh sạch sản phẩm PCR được gửi cho phòng thí nghiệm 1st Base ở Malaysia để giải trình tự. Trình tự nucleotide của đoạn ADN được xác định tại bằng máy giải trình tự, sử dụng bộ Kit BigDye® Terminator v3.1 Cycle Sequencing. Trình tự nucleotide của đoạn ADN được phân tích bằng các phần mềm chuyên dụng như DNAClub, Bioedit, Mega6,...Trình tự nucleotide của các đoạn mã vạch ADN sau khi phân tích được đăng ký trong ngân hàng cơ sở dữ liệu ADN của Việt Nam (www.dnabank.vn). Trình tự ADN sau khi được giải trình tự sẽ được so sánh và sắp xếp thẳng hàng sử dụng thuật toán MUSCLE [100]. Kết quả sắp xếp thẳng hàng sẽ được sử dụng sau đó để tính khoảng cách di truyền, sử dụng phần mềm MEGA6 trên cơ sở phương pháp tính Kimura 2- parameter, xây dựng cây phân loại theo phương pháp Maximum Likelihood trong MEGA6. Cây phân loại xây dựng theo mô hình Kimura 2-parameter, giá trị bootstrap 1000, tất cả các vị trí bao gồm các gap và dữ liệu trống đều được sử dụng để phân tích. III. KẾT QUẢ - THẢO LUẬN 3.1. Kết quả tách chiết ADN tổng số các mẫu trà hoa vàng. Bảng 3.1. Mẫu vật nghiên cứu STT Tên loài Tên khoa học Kí hiệu mẫu TCT88.1 1 Hải đường vàng Camellia tienii Ninh TCT88.2 TCT88.3 TCH89.1 2 Trà vàng hakoda Camellia hakoda Ninh, Tr. TCH89.2 4
  7. TCH89.3 TCC90.1 Camellia crassiphylla Ninh 3 Trà vàng lá dày TCC90.2 et Hakoda TCC90.3 TCT91.1 Trà vàng tam Camellia tamdaoensis 4 TCT91.2 đảo Hakoda et Ninh TCT91.3 TCP92.1 Camellia petelotii (Merr.) 5 Trà vàng petelo TCP92.2 Sealy TCP92.3 T88.1 T88.2 T88.3 T89.1 T89.2 T89.3 T90.1 T90.2 T90.3 T91.1 T91.2 T91.3 T92.1 T92.2 T92.3 Hình 3.1. Kết quả điện di sản phẩm tách chiết ADN tổng số các mẫu Trà hoa vàng Kết quả điện di ADN tổng số các mẫu trà hoa vàng cho thấy các băng ADN tổng số tương đối sắc nét, sáng rõ chứng tỏ ADN tổng số thu được khá nguyên vẹn, ít đứt gãy, đồng thời kết quả đo nano drop cho thấy ADN thu được với hàm lượng tương đối lớn, độ tinh sạch cao, phù hợp sử dụng cho phản ứng PCR ở bước sau. Bảng 1.2. Nồng độ và độ tinh sạch của các mẫu ADN tổng số (pha loãng 10 lần) Mẫu T88 T89 T90 T91 T92 371 417 365 451 256 Nồng độ ADN 432 423 396 318 284 (ng/µl) 295 315 402 331 312 1.77 1.66 1.88 1.69 1.51 OD260nm/OD280nm 1.82 1.93 1.68 1.53 1.73 1.99 1.81 2.05 1.78 2.01 5
  8. 3.2. Kết quả PCR các đoạn mã vạch ADN. Kết quả PCR các đoạn mã vạch ADN được kiểm tra bằng phương pháp điện di trên gel agarose 1%, cho thấy các băng ADN lên rõ nét, kích thước đồng đều giữa các mẫu, không có băng phụ chứng tỏ mồi được dùng để nhân bản các đoạn mã vạch được thiết kế đặc hiệu. Đối chứng dương lên băng rõ nét, có kích thước bằng với các băng được nhân bản, đối chứng âm không lên băng chứng tỏ hóa chất và các điều kiện tiến hành phản ứng PCR là hoàn toàn bình thường. So sánh với kích thước các băng marker cho thấy đoạn gen matK có kích thước khoảng 950bp, đoạn rbcL có kích thước khoảng 600bp, đoạn trnH-psbA là 500bp, đoạn ITS2 khoảng 400bp và đoạn ycf1b là 750bp. Các sản phẩm PCR này có thể giải trình tự trực tiếp để thu được trình tự các đoạn Mã vạch ADN cho các loài trà hoa vàng ở VQG Tam Đảo. 3.3. Giải trình tự và phân tích trình tự các đoạn mã vạch ADN 3.3.1. Kết quả giải trình tự Kết quả giải trình tự nucleotide các đoạn mã vạch cho thấy với mỗi loài trà hoa vàng được làm 3 mẫu với 3 lần thí nghiệm độc lập, kết quả nhận được và phân tích bằng phần mềm tin sinh cho thấy các đoạn tương ứng của 3 mẫu trong cùng một loài trà có trình tự tương đồng với nhau 100%. Kết quả được thể hiện cụ thể trong bảng 3.3. Bảng 3.3. Đánh giá trình tự các đoạn mã vạch thu đƣợc Các đoạn mã vạch ADN trnH- matK rbcL ycf1b ITS2 psbA Số lượng cá thể 15 15 15 15 15 Tỷ lệ PCR thành công 100 100 100 100 100 (%) Tỷ lệ giải trình tự 100 100 100 100 100 thành công (%) 945 - 502 - 750 - 397 - Độ dài trình tự 599 951 510 762 399 Độ dài so sánh 951 599 510 762 408 Số vị trí thay thế 1 1 1 2 4 Số vị trí bảo thủ 950 598 508 760 404 Số nucleotide thêm/mất 6 0 14 12 26 đi Số vị trí mang thông tin 0 0 1 0 2 6
  9. 3.3.1.1. Kết quả phân tích trình tự đoạn matK So sánh trình tự đoạn mã vạch ADN matK ở ba loài Hải đường vàng (mT88), Trà vàng Hakoda (mT89), Trà vàng Tam Đảo (mT91) cho thấy không có sự khác biệt giữa ba loài này. Tỷ lệ tương đồng của 3 loài trà hoa vàng nói trên so với trình tự matK loài trà xanh Camellia sinensis công bố trên ngân hàng gen NCBI là 100%. Cùng với đó, tỷ lệ tương đồng của loài Trà vàng lá dày (mT90) là 99,89%, loài Trà vàng Petelo (mT92) là 99,37%. Các loài này theo cách phân loại dựa trên sự khác biệt ở trình tự matK có họ hàng gần với một số loài trà như Camellia sinensis var. Sinensis, Camellia leptophylla, Camellia crapnelliana, xa hơn với các loài trà Camellia impressinervis, Camellia yunnanensis, Camellia japonica, Camellia oleifera… 7
  10. Hình 3.2. Cây phân loại sinh học xây dựng dựa trên trình tự đoạn matK 8
  11. 3.3.1.2. Kết quả phân tích trình tự đoạn rbcL So sánh trình tự rbcL của cả năm loài với nhau và so với trình tự trên Ngân hàng gen quốc tế NCBI loài Camellia oleifera cho thấy không có sự khác biệt lớn (chỉ sai khác 1 nucleotide ở loài Hải đường vàng Camellia tienii so với các loài còn lại). 4 loài trà hoa vàng còn lại có trình tự rbcL giống hệt nhau và giống với trình tự loài Camellia oleifera trên NCBI. Mức độ tương đồng cao trên 99% của trình tự rbcL ở các loài trà cho thấy đoạn trình tự này rất bảo thủ không chỉ trên đối tượng trà hoa vàng mà còn ở các loài trà khác thuộc chi Camellia nói chung. Tuy nhiên khi mục đích sử dụng không yêu cầu phân loại đến mức độ loài, trình tự matK vầ rbcL thu được là sự lựa chọn phù hợp để giám định do tương đối dễ nhân bản và giải trình tự. 3.3.1.3. Kết quả phân tích trình tự đoạn trnH-psbA Kết quả phân tích so sánh cho thấy đoạn trnH-psbA ở giữa các loài Trà hoa vàng có sự sai khác tương đối lớn. Độ dài các đoạn trnH-psbA ở các loài Camellia tienii, Camellia hakodae, Camellia crassiphylla, Camellia tamdaoensis và Camellia petelotii lần lượt là 502, 509, 504, 504 và 510bp, trong đó Camellia crassiphylla và Camellia tamdaoensis là hai loài có trình tự trnH-psbA khác biệt nhất so với các loài khác và so với loài Camellia oleifera trên ngân hàng gen NCBI. Sự sai khác tương đối lớn giữa các loài trong cùng chi Camellia nói chung và các loài Trà hoa vàng nghiên cứu nói riêng cho thấy đoạn trình tự trnH-psbA là dấu chuẩn tiềm năng cho việc phân biệt các loài trà hoa vàng sử dụng mã vạch ADN. Cây phân loại sinh học xây dựng được cho thấy hai loài Camellia tienii Ninh, Tr. và Camellia hakodae Ninh có mối quan hệ gần với nhau, đồng thời các loài Camellia crassiphylla Ninh et Hakoda, Camellia tamdaoensis Hakoda et Ninh và Camellia petelotii (Merr.) Sealy có vị trí gần nhau hơn trong bậc phân loại. Cả 5 loài trà này đều có mối quan hệ gần hơn cả với loài Trà vàng Camellia tonkinensis, tiếp theo sau đó là các loài Camellia yunnanensis, Camellia sinensis var. Sinensis, Camellia leptophylla… 9
  12. Hình 3.3. Cây phân loại sinh học xây dựng dựa trên trình tự đoạn gen rbcL 10
  13. Hình 3.4. Cây phân loại sinh học xây dựng dựa trên trình tự đoạn trnH-psbA 11
  14. 3.3.1.4. Kết quả giải trình tự đoạn ycf1b Giải trình tự đoạn ycf1b ở các loài Trà hoa vàng thu được đoạn dài 762bp ở các loài Camellia tienii, Camellia hakodae; 756bp ở các loài Camellia crassiphylla, Camellia tamdaoensis và 750bp ở loài Camellia petelotii. So với hai đoạn matK và rbcL, trình tự ycf1b đã cho thấy mức độ khác biệt rõ rệt hơn, thể hiện tiềm năng giám định tốt hơn nếu được kết hợp với một vài trình tự mã vạch khác. Cây phân loại sinh học dựa trên trình tự đoạn ycf1b cho thấy ba loài Camellia crassiphylla, Camellia tamdaoensis và Camellia petelotii có mỗi quan hệ gần gũi với nhau hơn khi so sánh với hai loài còn lại Camellia tienii và Camellia hakodae. Các loài này cũng có mối quan hệ gần hơn cả với hai loài Camellia pitardii và Camellia crapnelliana. 3.3.1.5. Kết quả giải trình tự đoạn ITS2 Kết quả so sánh cho thấy so với các đoạn trình tự lục lạp nghiên cứu, đoạn ITS2 có mức độ sai khác giữa các loài Trà hoa vàng lớn nhất. Đây cũng là đoạn trình tự có số vị trí mang thông tin nhiều nhất trong số 5 đoạn trình tự (2 vị trí). Tuy nhiên độ tương đồng 100% giữa 3 loài Hải đường vàng T88 Camellia tienii, Trà vàng hakoda T89 Camellia hakodae, Trà vàng petelo T92 Camellia petelotii cho thấy tuy có mức độ sai khác cao giữa nhiều loài, song vẫn có những loài giống nhau về trình tự đoạn ITS2, do vậy đoạn ITS2 không thích hợp để làm dấu chuẩn đặc hiệu cho các loài Trà hoa vàng ở VQG Tam Đảo. Mối quan hệ giữa các loài Trà hoa vàng nghiên cứu dựa trên trình tự ITS2 được thể hiện trên cây phân loại sinh học. Trong đó, ba loài Camellia tienii Ninh, Tr., Camellia hakodae Ninh và Camellia petelotii có mối quan hệ rất gần với nhau và tách biệt với nhánh chứa hai loài Camellia crassiphylla và Camellia tamdaoensis. Theo đó, các loài trà nghiên cứu cũng có mối quan hệ gần với các loài Camellia impressinervis, Camellia yunnanensis, Camellia parvimuricata var. Hupehensis, Camellia euphlebia và Camellia piquetiana. 12
  15. Hình 3.5. Cây phân loại sinh học xây dựng dựa trên trình tự đoạn ycf1b 13
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2