intTypePromotion=1

Tóm tắt Luận án Tiến sĩ Sinh học: Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam

Chia sẻ: Nguyễn Minh | Ngày: | Loại File: PDF | Số trang:22

0
94
lượt xem
10
download

Tóm tắt Luận án Tiến sĩ Sinh học: Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Luận án Tiến sĩ Sinh học: Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam nhằm tạo được vector chuyển gen mang cấu trúc liên quan đến tính chịu hạn ở cây đậu tương; tạo cây đậu tương mang cấu trúc gen liên quan đến đặc tính chịu hạn.

Chủ đề:
Lưu

Nội dung Text: Tóm tắt Luận án Tiến sĩ Sinh học: Phân lập, tạo đột biến điểm ở gen P5CS liên quan đến tính chịu hạn và thử nghiệm chuyển vào cây đậu tương Việt Nam

  1. B GIÁO D C VÀ ÀO T O I H C THÁI NGUYÊN NGUY N TH THÚY HƯ NG PHÂN L P, T O T BI N I M GEN P5CS LIÊN QUAN N TÍNH CH U H N VÀ TH NGHI M CHUY N VÀO CÂY U TƯƠNG VI T NAM Chuyên ngành: Di truy n h c Mã s : 62.42.70.01 TÓM T T LU N ÁN TI N S SINH H C THÁI NGUYÊN - 2011
  2. CÁC CÔNG TRÌNH C A TÁC GI Ã CÔNG B LIÊN QUAN N LU N ÁN 1. Nguy n Th Thuý Hư ng, Chu Hoàng M u, Hà T n Th , inh Th Kim Phương, Tr n Th Trư ng (2006), “Sưu t p, phân lo i và ánh giá ch t lư ng h t c a m t s gi ng u tương a phương t i t nh Sơn La”, T p chí Nông nghi p và phát tri n Nông thôn, s 11 kỳ I tháng 6/2006. 28-32 2. Chu Hoàng M u, Nguy n Th Thuý Hư ng (2006), “Thành ph n axit amin và kh năng ch u h n c a m t s gi ng u tương a phương c a t nh Sơn La”, T p chí Nông nghi p và phát tri n Nông thôn, s 20 kì II tháng 10/2006. 22- 26. 3. Nguy n Th Thúy Hư ng, Chu Hoàng M u, Lê Văn Sơn, Nguy n H u Cư ng, Lê Tr n Bình, Chu Hoàng Hà (2008), " ánh giá kh năng ch u h n và phân l p gen P5CS c a m t s gi ng u tương (Glycine max L.Merrili)", T p chí công ngh sinh h c, 6(4): 459-466. 4. Nguy n Th Thúy Hư ng, Tr n Th Ng c Di p, Nguy n Thu Hi n, Chu Hoàng M u, Lê Văn Sơn, Chu Hoàng Hà (2009), "Phát tri n h th ng tái sinh invitro cây u tương (Glycine max L.Merrili) ph c v chuy n gen", T p chí khoa h c và công ngh . i h c Thái Nguyên 52 (4): 82-88. 5. Nguy n Th Thúy Hư ng, Chu Hoàng M u, Lê Văn Sơn, Nguy n H u Cư ng, Lê Tr n Bình, Chu Hoàng Hà (2009), "T o gen mã hóa Enzym P5CS (Pyroline - 5 - carboxylate synthase) mang t bi n lo i b hi u ng c ch ph n h i b ng k thu t PCR". H i ngh công ngh sinh h c toàn qu c năm 2009: 191 - 193. 6. Nguy n Th Thuý Hư ng, Chu Hoàng M u, Lê Văn Sơn, Nguy n H u Cư ng, Chu Hoàng Hà (2010), "Tách dòng và ánh giá ho t ng c a promoter c m ng khô h n rd29A t Arabidopsis thaliana", T p chí Công ngh sinh h c 8(4): 1805-1810 7. Nguy n Th Thuý Hư ng, Chu Hoàng M u, Lê Văn Sơn, Nguy n H u Cư ng, Chu Hoàng Hà (2010), "T o cây thu c lá chuy n gen P5CS t bi n lo i b hi u ng ph n h i ngư c, làm tăng hàm lư ng protein và kh năng ch ng ch u khô h n. H i ngh toàn qu c v khoa h c s s ng Bio-Hà N i 2010", T p chí công ngh sinh h c, 8 (3A): 539-544. 8. Chu Hoang Mau, Nguyen thi Thuy Huong, Nguyen Tuan Anh, Chu Hoang Lan, Le van Son, Chu Hoang Ha ( 2010) Characteristic of the gene encoding pyrroline - 5 - carboxylate synthase (P5CS) in Vietnamese sobean cultivar (Glycine max L.Merrill) 2010 International Conference on Biology, Environment and Chemistry (ICBEC 2010) IEEE: 319-323
  3. M U 1. tv n Cây u tương (Glycine max (L.) Merrill) là m t trong nh ng cây tr ng quan tr ng không ch Vi t Nam mà còn i v i nhi u qu c gia trên th gi i. Tình tr ng h n hán nh hư ng t i tình hình s n xu t u tương không ch Vi t Nam mà ngay c nh ng nư c s n xu t u tương hàng u th gi i. u tương là cây tr ng thu c nhóm cây có kh năng ch u h n kém. Vi t Nam, nhi u gi ng u tương có kh năng ch ng ch u h n ã ư c ch n t o thành công và ang ư c tri n khai canh tác m t s a phương. Tuy nhiên các phương pháp ch n gi ng truy n th ng t n nhi u th i gian, ph c t p và c n ph i có qu n th l n và không n nh. Nh ng như c i m c a phương pháp truy n th ng có th kh c ph c b ng vi c áp d ng các k thu t m i c a công ngh sinh h c. K thu t chuy n gen th c v t thông qua vi khu n Agrobacterium tumefaciens ã ư c các nhà khoa h c trên th gi i ng d ng và t ư c nh ng k t qu r t có tri n v ng trên cây u tương. Vi t Nam, nhóm nghiên c u c a Tr n Th Cúc Hòa t i Vi n Nghiên c u lúa ng b ng Sông C u Long ã thành công trong vi c t o ra các gi ng u tương m i mang tính kháng sâu b nh, tuy nhiên cho n nay công trình nghiên c u v chuy n gen ch u h n vào cây u tương v n chưa ư c quan tâm úng m c. Xu t phát t nh ng lý do trên chúng tôi ti n hành tài lu n án ti n sĩ là: “Phân l p, t o t bi n i m gen P5CS liên quan n tính ch u h n và th nghi m chuy n vào cây u tương Vi t Nam”. 2. M c tiêu nghiên c u 2.1. So sánh trình t gen mã hóa P5CS c a các gi ng a phương thu c nhóm ch u h n t t và ch u h n kém. T o ư c t bi n lo i b hi u ng c ch ph n h i b i prolin. 2.2. T o ư c vector chuy n gen mang c u trúc liên quan n tính ch u h n cây u tương. 2.3. T o cây u tương mang c u trúc gen liên quan n c tính ch u h n. 1
  4. 3. N i dung nghiên c u 3.1. Phân tích c i m sinh lý, hóa sinh c a m t s gi ng u tương tr ng t i khu v c mi n B c. 3.2. Phân l p và xác nh trình t gen mã hóa enzyme 1-pyrroline-5 carboxylate synthetase (P5CS). 3.3. T o t bi n lo i b hi u ng c ch ph n h i (feedback inhibition) b i prolin b ng phương pháp t o t bi n i m. 3.4. Phân l p promoter c m ng dư i i u ki n khô h n rd29A t cây Arabidopsis thaliana. Phân tích ho t ng c a promoter d a vào ho t ng c a gen GUS các dòng cây thu c lá chuy n gen. 3.5. Thi t k c u trúc mang gen P5CS t bi n ư c i u khi n b i promoter rd29A và chuy n c u trúc này vào cây thu c lá. 3.6. Phân tích các ch tiêu hóa sinh và kh năng ch ng ch u c a các dòng thu c lá trong i u ki n gây h n nhân t o. 3.7. Bi n n p c u trúc mang gen P5CS vào cây u tương thông qua vi khu n Agrobacterium tumefaciens. Phân tích s có m t c a gen bi n n p. 4. Nh ng óng góp m i c a lu n án 4.1. Gen P5CS ư c phân l p và c trình t t hai gi ng u tương Vi t Nam (DT84 và SL5), có kích thư c 2148 nucleotit, mã hóa 715 axit amin. 4.2. ã t o t bi n i m nh hư ng b ba có v trí th 125 c a gen P5CS c a gi ng SL5, thay th Asp b ng Ala trong trình t protein, lo i b hi u ng c ch ph n h i (feedback inhibition). 4.3. Promoter rd29A ã ư c phân l p thành công t cây A.thaliana, có kích thư c 1298bp mang các trình t c trưng g m các nhân t cis thu c nhóm MYB, DRE, AMYBOX nhân t c trưng c a promoter và nhân t c m ng i u ki n khô h n. 4.4. Thi t k thành công c u trúc c a promtor rd29A :: GUS và c u trúc rd29A::P5CSM. Các c u trúc này ã ư c ánh giá trong cây thu c lá i u ki n h n. 4.5. T i ưu ư c quy trình tái sinh và chuy n gen thông qua mô nách lá m m u tương. Bư c u chuy n thành công c u trúc gen 2
  5. rd29A::P5CSM vào gi ng u tương DT84 và thu ư c m t s dòng dương tính PCR i v i gen chuy n. 5. Ý nghĩa khoa h c và th c ti n 5.1. V khoa h c, lu n án là công trình Vi t Nam ã ánh giá ư c kh năng ch ng ch u h n c a các gi ng u tương trong i u ki n gây h n nhân t o, phân l p và thay i c u trúc gen P5CS d a vào phương pháp gây t bi n có nh hư ng b ng ph n ng PCR. Các k t qu phân tích gen P5CS kh ng nh r ng s khác nhau v kh năng ch u h n c a các gi ng u tương khác nhau là do nhi u y u t quy nh, tuy nhiên ho t ng c a gen P5CS gi vai trò quan tr ng i v i tính ch u h n cây tr ng. 5.2. V th c ti n, nh ng k t qu ánh giá ho t ng c a c u trúc chuy n gen mang promoter rd29A i u khi n ho t ng c a gen P5CS ã b gây t bi n lo i b hi u ng ph n h i b i prolin cây thu c lá ã kh ng nh ý nghĩa th c ti n c a lu n văn. Kh năng ch ng ch u ư c c i thi n rõ r t các dòng thu c lá chuy n gen mang c u trúc này m b o tính kh thi c a vi c ng d ng c y trúc chuy n gen này trên các i tư ng cây tr ng khác nh m c i thi n m t trong nh ng tính tr ng r t quan tr ng là ch ng ch u h n. K t qu ban u trong vi c thi t l p quy trình chuy n gen cây u tương s là ti n quan tr ng trong ti n trình t o ra các gi ng u tương m i có tính ch u h n cao. 6. C u trúc c a lu n án Lu n án g m 113 trang, ư c chia thành các ph n: Ph n M u g m có 3 trang; Chương 1: T ng quan tài li u, 34 trang; Chương 2: V t li u và Phương pháp, 15 trang; Chương 3: K t qu và Th o lu n, 46 trang; Phân K t lu n và ngh : 2 trang; Các công trình ã công b c a tác gi : 1 trang. Tài li u tham kh o: 11 trang; Lu n án có 29 b ng s li u, 43 hình và 108 tài li u tham kh o b ng ti ng Vi t và ti ng Anh. Chương 1. T NG QUAN TÀI LI U Lu n án ã tham kh o và t ng k t 64 tài li u, trong ó có 10 tài li u ti ng vi t, 51 tài li u ti ng Anh và 3 a ch trang web v 5 v n cơ b n liên quan, như : (1) Gi i thi u v cây u tương (Glycine max (L.) Merill), 3
  6. giá tr kinh t và giá tr s d ng c a cây u tương; (2) Cơ s sinh lý, hóa sinh c a c tính ch ng ch u h n c a cây u tương; (3) Prolin và vai trò c a enzym P5CS trong con ư ng sinh t ng h p prolin; (4) Promoter và vai trò i u khi n ho t ng c a gen trong i u ki n h n; (5) Nh ng nghiên c u nâng cao kh năng ch u h n c a cây u tương. Prolin ư c bi t n là m t trong nh ng ch t óng vai trò quan tr ng trong quá trình i u ch nh áp su t th m th u khi cơ th th c v t s ng trong các i u ki n b t l i như h n, m n (Delauney and Verma, 1993). Tác d ng b o v các c u trúc n i bào và các i phân t khi t bào g p các i u ki n b t l i v áp su t th m th u; b o v các c u trúc protein và nâng cao ho t tính c a nhi u lo i enzyme khác nhau; ch ng oxy hóa v i ch c năng phân c t các g c oxy ph n ng (reactive oxygen residues) và b t ho t các g c oxy t do (singlet oxygen quencher) (Szavados và tg, 2009). th c v t, quá trình sinh t ng h p prolin ư c ki m soát b i ho t tính c a hai gen mã hóa cho enzym P5CS. Hai gen này có tương ng r t cao v trình t mã hóa nhưng bi u hi n l i r t khác nhau trong nh ng i u ki n khác nhau. C hai gen P5CS u ho t ng các mô phân sinh c a hoa, ch y u cung c p prolin cho quá trình phát tri n c a hoa (Mattioli và tg, 2009). Nghiên c u trên cây Arabidopsis các nhà khoa h c ã ch ng minh ư c m i quan h ch t ch gi a ho t ng c a enzme P5CS và s tích lũy prolin trong i u ki n cây b x lý m n; và hi u ng c ch ngư c c a prolin t i ho t tính c a P5CS cũng b nh hư ng trong các i u ki n b t l i này. Khi chuy n gen P5CS ã b gây t bi n lo i b hi u ng c ch ngư c b i prolin vào cây thu c lá các nhà khoa h c ã nh n ra r ng các dòng thu c lá chuy n gen này tăng cư ng tích lũy prolin nhi u hơn g p 2 l n so v i các dòng thu c lá ư c chuy n gen P5CS ki u d i. G n ây, gen P5CS phân l p thành công t cây lúa và khi ư c chuy n tr l i lúa nh m tăng cư ng ho t ng c a gen này các nhà khoa h c ã nh n th y r ng tính ch u m n và ch u l nh ư c c i thi n rõ r t. Promoter rd29A là m t trình t b c m ng bi u hi n dư i các i u ki n b t l i như khô h n, m n, và l nh ã ư c nhi u nhà khoa h c quan tâm. M t s nghiên c u ã phát hi n ư c trình t promoter rd29A ch a 2 vùng có ho t tính cis là vùng c m ng ABA (ABRE) và vùng c m ng m t 4
  7. nư c (DRE)/C repeat (CRT). C 2 vùng u liên quan n s bi u hi n các gen bi u hi n dư i i u ki n b t l i c a môi trư ng (Yamaguchi-Shinozaki và Shinozaki, 1993). Nhi u phòng thí nghi m trên th gi i ã phân l p và ki m tra ho t ng c a promoter rd29A trên nhi u loài cây như A. thaliana, thu c lá và lúa mì (Sun và Chen, 2002). C u trúc promoter RD29A i u khi n gen ch th GUS ư c chuy n vào cây khoai tây, mía. Ho t tính c a GUS u ư c phát hi n trong cây chuy n gen dư i i u ki n b t l i c a môi trư ng nuôi c y (Zhang et al., 2005) . Có nhi u bi n pháp c i thi n kh năng ch u h n c a cây tr ng, nh ng hi n nay áp d ng k thu t chuy n gen nh m tăng cư ng kh năng ch u h n c a th c v t ang ư c quan tâm nghiên c u. Có th nh n nh r ng tính kh thi và ti m năng ng d ng phương pháp chuy n gen th c v t như là bi n pháp nâng cao kh năng ch u h n c a cây u tương t i Vi t Nam là r t cao. Chương 2. V T LI U VÀ PHƯƠNG PHÁP NGHIÊN C U 2.1. V t li u, hóa ch t, thi t b V t li u th c v t: 16 gi ng a phương và DT84; gi ng thu c lá 326 (Nicotiana tabacum), và cây Arabidopsis thaliana. Hóa ch t nghiên c u: Vector tách dòng pBT, vector pBI101 dùng m c ích thi t k vector chuy n gen, vector pTN 289 dùng chuy n gen. Các c p m i dùng nhân b n gen P5CS và promoter RD29A ư c thi t k d a trên trình t gen P5CS và promoter RD29A ăng kí trên GeneBank v i mã s : AY492005, AB428730. Các lo i hóa ch t dùng cho các thí nghi m nuôi c y mô và sinh h c phân t ư c mua t các hãng hóa ch t: Merk, Bioneer, Fermentas do Phòng Công ngh t bào th c v t, Vi n Công ngh sinh h c cung c p. 2.2. Phương pháp nghiên c u 2.2.1. Phương pháp sinh lý, hoá sinh - ánh giá nhanh kh năng ch u h n theo phương pháp c a Lê Tr n Bình và ng tác gi năm 1998. 5
  8. - nh lư ng protein tan ư c th c hi n theo phương pháp Lowry. nh lư ng lipit ư c mô t trong tài li u c a Ph m Th Trân Châu. Hàm lư ng và thành ph n axit amin trong h t theo Ph m Văn Chi và tg (1997). - Hàm lư ng prolin ư c xác nh b ng phương pháp Bates và tg (1973). - Phương pháp tính toán và x lý s li u theo Nguy n H i Tu t và Ngô Kim Khôi (1996). 2.2.2. Các phương pháp s d ng nuôi c y in vitro Các phương pháp s d ng nuôi c y in vitro cây Arabidopsis, cây thu c lá theo Topping ,1988. i v i cây u tương tái sinh cây qua a ch i t nách lá m m h t chín và quy trình chuy n gen vào nách lá m m h t chín ư c ti n hành d a trên phương pháp c a Olhoft và tg (2001) có c i ti n. 2.2.3. Phương pháp sinh h c phân t Thi t k m i d a vào trình t ã công b trên GenBank. Quy trình tách chi t DNA t ng s ( i v i Arabidopsic và thu c lá). Phương pháp tách chi t RNA t ng s : S d ng b kit Trizol Regents (c a hãng Invitrogen) tách chi t RNA t ng s t các m u lá u tương theo ch d n c a nhà s n xu t. Phương pháp tách chi t, tinh s ch DNA và RNA. - Phương pháp t ng h p cDNA. RNA t ng s ư c s d ng nhân gen b ng phương pháp t ng h p cDNA, cDNA ư c t ng h p theo quy trình RevertAidTMH Minus First Strand cDNA Synthesis Kit (Fermentas). - Ph n ng PCR. Chu trình nhi t c a ph n ng PCR: Gen P5CS ư c khu ch i b ng k thu t PCR v i c p m i c hi u theo chu trình nhi t như sau: 94ºC/5 phút;: 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 35 chu kì. Ti n hành ph n ng PCR v i các nhi t khác nhau (t 50 - 620C) tìm nhi t g nm i c hi u. - Phương pháp OE - PCR ( Overlap Extention) Chu trình nhi t c a ph n ng PCR: 94ºC/5 phút; 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 4 chu kì. Sau 4 chu kỳ l y s n ph m ra 6
  9. t ngay vào á và b sung 1µl BamHI và 1µl SaclI th c hi n ti p ph n ng theo chu trình nhi t sau: 94ºC/5 phút; 94ºC/30 giây, Tm /45 giây, 72ºC/1 phút 30 giây; 72ºC/10 phút, 30 chu kì. - Phương pháp tách dòng: Tách chi t plasmid tái t h p ư c th c hi n theo Sambrook và tg (2001) và tinh s ch b ng Plasmid Miniprep Kit (Qiagen). Phương pháp s d ng enzym c t h n ch th c hi n theo Sambrook và tg (2001) - Phương pháp PCR tr c ti p t khu n l c (colony-PCR) - Thi t k c u trúc rd29A :: GUS và rd29A :: P5CSM - Các phương pháp phân tích cây bi n n p. Ki m tra s có m t c a gen chuy n b ng phương pháp hóa sinh. Cây thu c lá chuy n gen sau khi s ng trong nhà kính ư c x lý h n nhân t o b ng PEG (Jun và tg 20001). Hàm lư ng enzym Gus ti p t c ư c xác nh b ng phương pháp c a Tefferson và tg (1987) Chương 3. K T QU VÀ TH O LU N 3.1. K t qu sưu t p và ánh giá các gi ng u tương a phương c a t nh Sơn La. 3.1.1. c i m hình thái, hóa sinh c a h t u tương. Phát hi n 16 gi ng u tương a phương 7 huy n 11 huy n th khác nhau c a t nh Sơn La. Hàm lư ng protein c a các gi ng dao ng trong kho ng 29,72%-52,75% protein/kh i lư ng khô. Hàm lư ng lipit dao ng t 9,9% - 18,65%. Gi ng DT84 cho hàm lư ng lipit cao nh t là 18,65%, n SL3 (17,34%) 3.1.2. K t qu ánh giá kh năng ch u h n c a các gi ng u tương nghiên c u. i v i gi ng SL5 hàm lư ng prolin tăng cao nh t sau khi gây h n ư c 9 ngày (tăng 377,44%). Gi ng DT84 có t l tăng hàm lư ng prolin c ba th i i m u th p nh t (101,06; 129,26 và 146,81%). K t qu nghiên c u phù h p v i các nghiên c u c a các tác gi trên các loài cây tr ng khác nhau như lúa (Nguy n H u Cư ng và tg), (Do và tg ), 7
  10. (Choudhary và tg 2005), cây h u (Curtis và tg 2004), (Chen và tg 2009). 3.2. Phân l p gen P5CS và t bi n i m lo i b c ch ngư c 3.2.1. K t qu phân l p gen P5CS 3.2.2. K t qu khu ch i, tách dòng và xác nh trình t gen P5CS RNA t ng s ã ư c tách chi t và t ng h p cDNA t SL5 và DT84. B n o n gen P5CS ư c nhân lên b ng PCR và ư c ki m tra b ng i n di trên gel agarose 0,8%. K t qu hình 3.3 cho th y, các o n thu ư c có kích thư c tương ng v i kích thư c tính toán theo lý thuy t. thu ư c gen P5CS hoàn ch nh, hai s n ph m PCR ư c tr n l n và ư c s d ng làm khuôn cho ph n ng PCR v i c p m i P5CSfor/P5CSrev theo phương pháp OE-PCR. S n ph m PCR thu ư c có kích thư c kho ng 2100 bp ( Hình 3.4). M 1 2 3 4 M 1 2 3 4 2100bp 1500bp 1000bp Hình 3.3. K t qu nhân hai o n Hình 3.4. K t qu PCR ghép n i hai gen P5CS t 2 gi ng u tương o n gen P5CS t 2 gi ng u DT84 và SL5 tương DT84 và SL5 1, 3: gi ng DT84; 2, 4: gi ng SL5; 1, 3: gi ng DT84; 2, 4: gi ng SL5; M: Thang DNA chu n 1 kb. M: Thang DNA chu n 1 kb K t qu c trình t gen cho th y, s n ph m gen tách dòng t 2 m u nghiên c u có kích thư c 2148 nucleotide, mã hoá 715 axit amin. 2 v trí 125 và 128 c a P5CS c ba gi ng u là axit amin Asp và Phe. ây là hai v trí gây ra s c ch ho t ng c a enzym P5CS do tăng hàm lư ng c a prolin trong t bào (Zhang và tg 1995), (Hong và tg 2000). 8
  11. 3.2.3. T o t bi n i m lo i b hi u ng c ch ngư c P5CS phân l p t cây u tương K t qu hình 3.10 cho th y, các o n thu ư c có kích thư c tương ng v i kích thư c tính toán theo lý thuy t. S n ph m OE-PCR thu ư c có kích thư c kho ng 2100bp (hình 3.11). Kích thư c này tương ng v i kích thư c c a gen P5CS g c. 2 M M A B 2 2100bp 1800bp 1 400bp Hình 3.10. i n di s n ph m PCR Hình 3.11. Ph n ng n i hai o n V i c p m i P5CS gen theo phương pháp OE-PCR v i M125for2/SacI-P5C; V i c p m i c p m i BamHI-P5CS và Sacl - P5CS for / P5CS rev ; M : Thang P5CS. A, B : 1+2, M:thang DNA DNA chu n 1 kb. chu n 1 kb Nhưng bi t chính xác gen có t o ư c t bi n i m hay không c n ph i ư c c trình t gen. K t qu ư c th hi n hình 3.13. 310 320 330 340 350 360 370 380 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| MSL5 AACAGCCTTATGGCTCTTTATGATGTTTTGTTTAGTCAGCTGGATGTGACATCTGCTCAGCTTCTTGTGACGGCCAATGA N S L M A L Y D V L F S Q L D V T S A Q L L V T A N D SL5 .........................................................................A...... N S L M A L Y D V L F S Q L D V T S A Q L L V T D N D Hình 3.13. Phân tích, so sánh trình t nucleotit và phát hi n t bi n t i v trí nucleotit 374 c a gen P5CS Trình t gen này mã hoá cho protein P5CS c a u tương, qua k t qu c trình t chúng tôi nh n th y nucleotit A v trí 374 c a mã b ba GAC 9
  12. ư c thay th b ng nucleotit C c a mã b ba GCC tương ng trên trình t protein axit amin v trí 125 Asp ư c thay b ng Ala 3.3. Phân l p và ki m tra ho t ng c a promotor rd29A c m ng khô h n 3.3.1. Phân l p promoter rd29A Trên cơ s trình t gen rd29A ã công b trên ngân hàng gen th gi i, c p m i rd29A -HindIII / rd29A -BamHI ã ư c thi t k có trình t như b ng 3.7. C p m i này s tách ư c promoter có kích thư c 1290 bp, n m trư c codon m u c a gen ch c năng rd29A. B ng k thu t PCR, promoter rd29A ã ư c phân l p t A. thaliana s d ng c p m i c hi u. S n ph m ư c ki m tra trên gel agarose cho th y có m t băng duy nh t v i kích thư c kho ng 1300 bp, tương ương kích thư c tính toán theo lý thuy t. Hình 3.15. i n di s n ph m PCR và c t h n ch vector pBT/ rd29A M) Marker; 1) s n ph m PCR; 2) s n ph m c t b ng BamHI/HindIII S n ph m PCR ư c g n vào vector tách dòng pBT và ư c bi n n p vào E. coli DH5α. K t qu ch n dòng b ng colony-PCR và c t plasmid b ng enzym h n ch BamHI/HindIII cho th y s n ph m có kích thư c tương ương kích thư c ã tính toán theo lý thuy t (hình 3.15). Như v y s n ph m PCR ã ư c ghép n i thành công vào vector tách dòng pBT. 10
  13. 3.3.2. Phân tích trình t promoter rd29A bi t chính xác s n ph m PCR chúng tôi ã ti n hành c trình t nucleotide. K t qu thu ư c so sánh v i các trình t gen trên Ngân hàng gen chính cho th y s n ph m là promoter rd29A c a A.thaliana. Khi phân tích trình t thu ư c cho th y promoter phân l p có chi u dài 1290 bp, ch a các box trình t c n thi t cho promoter i u hòa bi u hi n gen như TATA; CCAAT box- vùng giàu GC (GGGCCAATAG), Cap signal và các vùng liên quan qu trình phiên mã (-10 và -35). Ngoài ra còn ch a các vùng liên quan n c m ng i u ki n khô h n DRE, ABRE (hình 3.16). K t qu này phù h p v i công b c a Wu và tg. (2008) và Shinozaki và tg (2007). Sau khi ã tách dòng và xác nh trình t promoter rd29A s d ng ph n m m chuyên d ng phân tích trình t o n promoter ã tách dòng ư c. K t qu nh n th y r ng trên o n trình t promoter rd29A phân l p trong nghiên c u này có ch a các nhân t cis thu c nhóm MYB, DRE, AMYBOX. Các nhân t cis này ã ư c kh ng nh là c hi u cho các promoter i u khi n bi u hi n c a gen dư i các i u ki n b t l i như h n, m t nư c và m n. ã phân l p thành công promoter rd29A, o n gen dài 1290bp ch a các nhân t cis c hi u, s d ng o n gen thi t k vector phân tích quá trình bi u hi n c a promoter dư i i u ki n h n. gaatgagaaggatgtgccgtttgttataataaac -10 agccacacgacgtaaacgtaaaatgaccacatgatgggccaatagacatggaccga CCAAT box và vùng giàu GC ctactaataatagtaagttacattttaggatggaataaatatcaTACCGACATcag DRE-1 ttttgaaagaaaagggaaaaaaagaaaaaataaataaaagatatacTACCGACATg -35 DRE-2 agttccaaaaagcaaaaaaaaagatcaagccgacacagacacgcgtagagagcaaaatgactttgacgtcacaccacgaaaacagacg cttcatACGTGTCcctttatctct ABRE ctcagtctctctataaacttagtgagaccctcctctgttttactcacaaatatgca Cap signal TATA box aactagaaaacaatcatcaggaataaagggtttgattacttctattgga Hình 3.16. Phân tích trình t promoter rd29A 11
  14. 3.3.3. Thi t k vector chuy n gen mang c u trúc rd29A ki m tra kh năng i u khi n c a promoter thu ư c, promoter rd29A ư c thi t k vào vector pBI101 i u khi n s bi u hi n gen ch th GUS. K t qu ki m tra b ng PCR và c t b ng enzym h n ch BamHI/SacI cho th y vector tái t h p thu ư c ch a o n promoter rd29A (hình 3.18) có kích thư c như mong mu n. Hình 3.18. i n di s n ph m PCR và c t h n ch vector pBI101/ rd29A M) Marker; 1-2) s n ph m PCR; 3-4) s n ph m c t b ng BamHI/SacI Vector tái t h p thu ư c bi n n p vào ch ng vi khu n Agrobacterium C58, ây s là nguyên li u cho chuy n gen vào th c v t, ánh giá kh năng i u khi n c a promoter b ng m c bi u hi n GUS dư i i u ki n x lý h n. 3.3.4. T o cây thu c lá chuy n gen mang c u trúc rd29A :: GUS 1. M nh lá thu c lá trên môi 2. M nh lá ngâm 3. M nh lá trên môi trư ng c m ng GM sau 2 trong d ch huy n trư ng c ng sinh ngày phù vi khu n sau 2 ngày 12
  15. 4. M nh lá trên môi trư ng 5. C m ch i trên 6. Cây con trên môi GM + 50 mg/l Kanamycine + môi trư ng GM + trư ng RM + 50 400 mg/l Cefotaxime sau 1 50 mg/l mg/l Kanamycine + tháng Kanamycine + 400 400 mg/l mg/l Cefotaxime sau Cefotaxime 1 tháng sau 1 tháng 7. Ra cây trong b u tr u: cát 8. Trong b u t 9. Ra nhà lư i Hình 3.19. Hình nh chuy n c u trúc promotor rd29A vào thu c lá ánh giá ho t ng c a promtor RD29A trong cây thu c lá chuy n gen K t qu thu ư c 51 dòng cây thu c lá tái sinh trên môi trư ng ch a kanamycin. Ki m tra 22 dòng cây b ng ph n ng PCR v i c p m i c hi u rd29A -HindIII/ rd29A -BamHI cho th y có 21 dòng mang gen chuy n rd29A. ánh giá ho t ng i u khi n s bi u hi n gen GUS c a promoter rd29A, chúng tôi ch n ng u nhiên 3 dòng cây dương tính v i PCR và ti n hành x lý h n nhân t o b ng 10% PEG (polyethylene glycol). K t qu cho th y dư i i u ki n thi u nư c bi u hi n GUS các dòng thu c lá chuy n gen khá m nh và rõ ràng so v i các dòng cây chuy n gen không x lý và cây i ch ng (hình 3.20). 13
  16. 800 700 600 Lư ng M U (p m o l/m in .m g) 500 400 300 200 100 0 DCT DCS 3T 3S 4T 4S 5T 5S M u Hình 3.20. Bi u hi n gen GUS trên Hình 3.21. Ho t tính c a enzym cây chuy n gen GUS các dòng cây thu c lá A: Cây i ch ng không chuy n chuy n gen mang promoter rd29A gen có x lý h n; B: Cây chuy n trong i u ki n h n nhân t o gen không x lý h n; C: Cây C: m u cây i ch ng không chuy n gen sau x lý h n 24 gi . chuy n gen; 3, 4, 5: các dòng cây chuy n gen, T: trư c x lý h n, S: sau x lý h n. Ho t tính c a enzym GUS còn ư c xác nh thông qua ph n ng chuy n hóa cơ ch t (MUG). Enzym GUS xúc tác cho ph n ng chuy n hóa MUG thành MU, ho t tính c a gen enzym GUS càng m nh thì MU ư c t o ra càng nhi u. MU ư c phát hi n b ng phép o h p th bư c sóng 378 nm ( Fior và tg 2009). Lư ng MU o ư c sau x lý h n cao hơn so v i trư c x lý h n t 6 - 13 l n ( hình 3.21). Nh ng s li u này hoàn toàn th ng nh t v i công b c a (Zhang và tg 2005) 3.4. ánh giá kh năng tăng cư ng kh năng ch u h n c a cây thu c lá chuy n gen mang c u trúc rd29A:: P5CSM 3.4.1. Thi t k vector chuy n gen mang c u trúc rd29A:: P5CSM K t qu c t P5CSM và rd29A :: GUS b ng BamHI và SacI. Và th c hi n ph n ng ghép n i . b ng enzym T4 ligaza và bi n n p s n ph m ghép n i vào t bào kh bi n E.coli ch ng DH5α, 14
  17. M 1 2 3 - + 1 2 3 M 12kb 3,4kb 1.3kb A B Hình 3.23. i n di s n ph m clony- PCR và c t h n ch vector pBT rd29A:: P5CSM K t qu c a ph n ng c t b ng enzym gi i h n và colony-PCR (Hình 3.23) ã kh ng nh ch c ch n c 3 dòng khu n l c u có ch a vector chuy n gen, nghĩa là chúng tôi ã thi t k thành công c u trúc gen chuy n mang gen ch u h n rd29A:: P5CSM ư c ghép n i thành công vào vector tách dòng pBT. K t qu bi n n p vector chuy n gen rd29A:: P5CSM vào A. tumefaciens K t qu PCR ư c i n di ki m tra trên gel agarose 0,8% cho th y: có 4 trong 9 dòng khu n l c ư c l a ch n cho k t qu dương tính v i ph n ng PCR v i 1 băng duy nh t có kích thư c kho n 1300 bp. i u này ch ng t ã bi n n p thành công vector rd29A:: P5CSM vào t bào A. tumefaciens.. Như v y chúng tôi ã t o ư c ch ng A. tumefaciens pGV2260 mang plasmid tái t h p rd29A:: P5CSM. ây chính là ngu n nguyên li u ph c v cho m c ích chuy n gen t o cây tr ng ch ng ch u h n. 3.4.2. T o cây thu c lá chuy n gen mang c u trúc rd29A:: P5CSM C u trúc chuy n gen pBI101 mang promoter rd9A i u khi n ho t ng c a gen P5CS ư c chuy n vào m nh lá cây thu c lá gi ng K326 15
  18. M 1 2 3 4 5 6 7 8 9 - + Hình 3.25. K t qu PCR các dòng chuy n gen b ng c p m i rd29A for /rd29Arev M: Marker DNA 1kb; 1-9: Các dòng chuy n gen; (-) i ch ng âm; (+) i ch ng dương Hình 3.25 cho th y, trong s 33 dòng ki m tra thu ư c 30 dòng cho ph n ng dương tính, các gi ng xu t hi n m t v ch AND có kích thư c kho ng 1,4kb. ây là kích thư c tương ng c a promoter rd29A. i u này ch ng t các dòng cây này có mang c u trúc rd29A:: P5CSM mong mu n. 3.4.3. ánh giá kh năng ch u h n c a các dòng thu c lá chuy n gen. Các m u lá c a các dòng thu c lá chuy n gen và i ch ng ã ư c thu trư c gây h n và sau khi gây h n 3, 5, 7 và 9 ngày. Các m u ư c tách chi t và ki m tra hàm lư ng prolin. K t qu trình bày b ng 3.7 và hình 3.25. Sau khi gây h n nhân t o, hàm lư ng prolin tăng r t m nh so v i trư c gây h n t t c các dòng cây nghiên c u, c bi t các dòng cây chuy n gen. Sau 9 ngày gây h n, prolin cây i ch ng không chuy n gen tăng 206.8%, trong khi ó v i cây chuy n gen tăng t 259,5-451,8% (cao nh t dòng H33 và th p nh t dòng H11). 16
  19. Hình 3.27. Các dòng cây thu c lá sau 20 ngày h n nhân t o (A) và sau ph c h i (B) WT: cây i ch ng không chuy n gen, H11, H15, H26, H33: các dòng cây chuy n gen 3.5. K t qu t o cây u tương chuy n gen 3.5.1. K t qu tái sinh t o a ch i gi ng u tương DT84 3.5.1.1. T i ưu th i gian kh trùng h t So sánh hai phương pháp kh trùng (b ng khí clo và b ng Javen), chúng tôi nh n th y phương pháp kh trùng b ng khí clo ã t ra ưu th hơn, vì v y chúng tôi l a ch n phương pháp kh trùng này trong th i gian kh trùng là 16 gi kh trùng h t thu nguyên li u cho các thí nghi m ti p theo. 3.5.1.2. nh hư ng c a BAP n kh năng t o a ch i t lá m m h t chín Các m u này sau khi gây t n thương và c t b nh sinh trư ng, chúng ư c t o a ch i trên 8 lo i môi trư ng (SIM0-SIM7) ch a n ng BAP t 0mg/l n 2,5 mg/l. Như v y chúng tôi l a ch n n ng BAP là 2 mg/l (SIM4) b sung vào môi trư ng t o a ch i và s d ng k t qu này cho các thí nghi m ti p theo. 3.5.1.3. nh hư ng c a hocmon sinh trư ng GA3,t i kh năng kéo dài ch i. Các c m ch i t o trên môi trư ng SIM4 ư c chuy n sang 4 môi trư ng (SEM0-SEM3) có b sung GA3 v i các n ng tương ng là 0,5 17
  20. mg/l, 1 mg/l và 1,5 mg/l Nh ng k t qu thu ư c nh n th y s ph i h p gi a GA3 (0,5 mg/l) là thích h p cho quá trình kéo dài ch i. K t qu này cũng phù h p v i m t s k t qu nghiên c u c a các tác gi khác ã công b (Olhoft và tg 2007), Olhoft và tg 2001) 3.5.1.4. nh hư ng c a IBA n hi u qu t o r . N ng IBA chúng tôi ã nghiên c u nh n th y 0,1 mg/l là n ng thích h p nh t cho vi c ra r c a cây u tương in vitro gi ng DT84. 3.5.1.5. Xác nh giá th thích h p cho ra cây in vitro Th nghi m 3 lo i giá th khác nhau là: tr u hun, 1 tr u hun:1 cát vàng và h n h p tr ng cây có bán s n. Hai y u t ư c ánh giá trong thí nghi m này là t l s ng c a cây con và ch t lư ng cây con. Căn c vào ch t lư ng cây con k t qu nh n th y v i t l giá th là 1 tr u hun: 1 cát vàng là phù h p..Sau hai tu n chúng tôi chuy n ra t. 3.5.2. K t qu bư c u chuy n gen GUS vào cây u tương DT84. T l bi u hi n t m th i gen gus thu ư c là 67,5%. T l m u s ng sót sau 2 tu n trên môi trư ng ch n l c là 15,21%. 3.5.3. K t qu chuy n c u trúc gen ch u h n vào u tương Thí nghi m ư c ti n hành trên 3 lô thí nghi m v i t ng s 1262 m u ư c s d ng cho chuy n gen, có 564 s m u t o ch i, 101 s m u kéo dài ch i, trong quá trình ch n l c kháng sinh có 28 cây s ng sót ra r và tr ng nhà lư i. ki m tra s có m t c a gen chuy n, sau khi ra cây kho ng 1 tháng, m u lá c a các dòng cây T0 ư c ti n hành thu tách chi t DNA t ng s . K t qu i n di s n ph m PCR cho th y ã thu nh n ư c 3 cây dương tính v i ph n ng PCR. 18
ADSENSE
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản
2=>2