intTypePromotion=3

Tóm tắt luận án Tiến sỹ Kỹ thuật: Nghiên cứu tuyển chọn Rhodotorula có khả năng sinh tổng hợp Beta-carotene trên môi trường bán rắn làm thức ăn bổ sung cho gà đẻ trứng

Chia sẻ: Đỗ Hồng | Ngày: | Loại File: PDF | Số trang:14

0
78
lượt xem
14
download

Tóm tắt luận án Tiến sỹ Kỹ thuật: Nghiên cứu tuyển chọn Rhodotorula có khả năng sinh tổng hợp Beta-carotene trên môi trường bán rắn làm thức ăn bổ sung cho gà đẻ trứng

Mô tả tài liệu
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Luận án Tiến sỹ Kỹ thuật: Nghiên cứu tuyển chọn Rhodotorula có khả năng sinh tổng hợp Beta-carotene trên môi trường bán rắn làm thức ăn bổ sung cho gà đẻ trứng được thực hiện nhằm tạo ra chế phẩm sinh học là thức ăn bổ sung cho gà đẻ trứng.

Chủ đề:
Lưu

Nội dung Text: Tóm tắt luận án Tiến sỹ Kỹ thuật: Nghiên cứu tuyển chọn Rhodotorula có khả năng sinh tổng hợp Beta-carotene trên môi trường bán rắn làm thức ăn bổ sung cho gà đẻ trứng

  1. I H C QU C GIA TP. H CHÍ MINH TRƯ NG I H C BÁCH KHOA NGUY N TH MINH NGUY T NGHIÊN C U TUY N CH N RHODOTORULA CÓ KH NĂNG SINH T NG H P BETA-CAROTENE TRÊN MÔI TRƯ NG BÁN R N LÀM TH C ĂN B SUNG CHO GÀ TR NG Chuyên ngành: Công ngh Th c ph m và u ng Mã s chuyên ngành: 62.54.02.01 TÓM T T LU N ÁN TI N SĨ K THU T Tp. H Chí Minh, năm 2011
  2. Công trình ư c hòan thành t i: Trư ng i h c Bách Khoa – HQG-HCM Ngư i hư ng d n khoa h c 1: PGS.TS ng Th Anh ào Ngư i hư ng d n khoa h c 2: TS. Nguy n H u Phúc Ph n bi n c l p 1: PGS.TS Nguy n Th Xuân Sâm Ph n bi n c l p 2: PGS.TS Lưu H u Mãnh Ph n bi n 1: PGS.TS Nguy n Thúy Hương Ph n bi n 2: TS. Lê ình ôn Ph n bi n 3: PGS.TS Nguy n Ti n Th ng Lu n án s ư c b o v trư c H i ng ch m lu n án h p t i: ...................................................................................................................... ...................................................................................................................... Vào lúc gi ngày tháng năm 2011 Có th tìm hi u lu n án t i thư vi n: - Thư vi n Khoa h c t ng h p Tp.HCM - Thư vi n i h c Bách khoa – HQG-HCM
  3. 24 1 [3]. Nguy n Th Minh Nguy t, T ăng Khoa, Nguy n H u Phúc, ng Th M U Anh ào (2008). So sánh hi u qu chi t màu beta-carotene t s phá v t bào Rhodotorula sp.3 trong môi trư ng nuôi c y bán r n (SSF) b ng các phương 1. Tính c p thi t c a tài pháp khác nhau. Hóa sinh và sinh h c phân t ph c v Nông, Sinh, Y h c và Nhu c u ph i có th c ăn s ch, an toàn, m b o dinh dư ng và s c kho Công ngh Th c ph m, Báo cáo H i ngh Hóa sinh Toàn Qu c l n th IV, Nhà c ng ng c i thi n và phát tri n th l c, trí l c c a các th h ngư i Vi t xu t b n Khoa h c K thu t, Hà N i 2008, trang 370-374. trong tương lai là m t òi h i c p thi t cho ngành công ngh th c ph m. Trong kh u ph n th c ăn c a ngư i, ngoài n n t ng tinh b t như cơm, ngô, khoai.., [4]. Nguyen Thi Minh Nguyet, Nguyen Thi Tu Minh, Pham Tan Viet, Nguyen lư ng m cơ b n ư c cung c p ch y u t các s n ph m v t nuôi và cây Huu Phuc, Dong Thi Anh Dao (2009). The influence of bioproduct from tr ng như th t, tr ng, s a, rau, u, … c bi t trong ó là các s n ph m t Rhodotorula sp.CBS10104 on nutrition of lab mice Mus musculusdo. Tuy n t p chăn nuôi. Theo s li u th ng kê, trong nh ng năm u c a th k 21, ư c tính H i ngh Công ngh sinh h c Toàn qu c Khu v c phía nam 2009, Nhà xu t t ng giá tr gia c m ã óng góp kho ng 5% GDP c a Vi t Nam. Ti m năng và b n Khoa h c và K thu t, trang 805 - 809. kỳ v ng óng góp c a ngành chăn nuôi này vào vi c cung c p nhu c u th c [5]. Nguyen Thi Minh Nguyet, Nguyen Huu Phuc, Dong Thi Anh Dao (2009). ăn áp ng tiêu chu n và cho s phát tri n c a n n kinh t t nư c trong Using biological product from Rhodotorula sp. CBS. 10104 to increase the tương lai là r t l n. Tuy nhiên, t i Vi t Nam, gia c m nói chung hay gà ch content of vitamin A, beta-carotene in the egg yolks. Tuy n t p H i ngh Công y u ư c nuôi b ng ngu n th c ăn t nhiên s n có thi u ho c không cân iv ngh sinh h c Toàn qu c Khu v c phía nam 2009, Nhà xu t b n Khoa h c và dinh dư ng hay b ng ngu n th c ăn nh p t nư c ngoài v i giá cao. K thu t, trang 810 - 814. Th c ăn là v n quan tr ng nh t trong chăn nuôi, nó quy t nh tr c ti p [6]. Nguy n Th Minh Nguy t, Nguy n Th Tú Minh, Nguy n H u Phúc n năng su t, ch t lư ng và giá thành c a các s n ph m th t, tr ng, s a,... c (2010). nh hư ng c a t ng hàm lư ng carotenoid trong th c ăn n năng bi t, s c t carotenoid là y u t c n ph i có trong th c ăn. Ngoài tác d ng cung su t cho tr ng c a gà . T p chí Phân tích Hoá, Lý và Sinh h c, t p 15- s 3 c p ch t ti n vitamin A, s c t carotenoid còn là ch t ch ng oxi hóa sinh h c năm 2010, trang 68-74. b o v t bào, bu ng tr ng, làm tăng năng su t và s n lư ng tr ng. Tuy nhiên [7]. Nguyen T.M.Nguyet et al. (2008). Research on producing feedstuffs for ngu n th c ăn th c v t d i dào t i Vi t Nam như t m, khoai mì, cám, v.v… laying hens from the culture of solid-state fermentation of red yeast dùng trong chăn nuôi gia c m h u như không có s c t carotenoid. Do ó, gia Rhodotorula. World Congrees of Food Science and Technology, Shanghai, c m b thi u s c t vàng nên s c kháng y u, d sinh b nh t t, gi m t l China 2008, N0 TS 12-33, pp. 240-241. và ch t lư ng tr ng kém. [8]. Nguyen Thi Minh Nguyet et al. (2008). Research on collecting raw Trong s các vi sinh v t có kh năng t ng h p carotenoid thì gi ng n m pigment powder enriched beta-carotene from the culture of the solid-state men Rhodotorula có kh năng s n xu t carotenoid trong ó có beta-carotene fermentation red yeast Rhodotorula sp.3 on by-products of food industry in ang ư c nghiên c u s n xu t quy mô công nghi p làm ch t màu th c Vietnam. World Congrees of Food Science and Technology, Shanghai, China ph m và ã ư c dùng làm th c ăn chăn nuôi. 2008, N0 TS 12-90, pp. 260-262.
  4. 2 23 tài lu n án: “Nghiên c u tuy n ch n Rhodotorula có kh năng sinh t ng - Nghiên c u s d ng Rhodotorula sp.3 làm ch t màu b sung tr c ti p hay h p beta-carotene trên môi trư ng bán r n làm th c ăn b sung cho gà gián ti p vào th c ph m và dư c ph m cho ngư i. tr ng” ư c th c hi n nh m t o ra ch ph m sinh h c làm th c ăn b sung cho - Nghiên c u c i t o gi ng, nâng cao m c c a ch ph m khi s n xu t gà áp ng m c tiêu trên. Ngoài ra, các lo i th c ph m t nhiên dùng cho công nghi p gi m t l b sung vào th c ăn. ng th i, kh o sát th c ngư i hi n t i ang r t thi u và c n b sung vitamin A. tài lu n án ã gi i nghi m trên gia c m chuyên tr ng và các v t nuôi c n s c t như cá la hán, cá quy t bài toán là c i t o ngu n th c ăn cho v t nuôi v i nguyên li u s n có và h i, tôm, ...v i quy mô l n t ng bư c thương m i hóa ch ph m. r , thông qua ó nâng hàm lư ng vitamin A trong tr ng, t o ngu n tr ng ch t - Nghiên c u các thông s k thu t c n thi t và thi t b s n xu t theo quy lư ng cao. ng th i, ánh giá tính an toàn và hi u qu c a ch ph m, mô l n ưa s n ph m t phòng thí nghi m vào s n xu t công nghi p. tài còn th c hi n nghiên c u th nghi m trên chu t và xác nh năng su t và NGHIÊN C U KHOA H C VÀ CÁC CÔNG TRÌNH ch t lư ng tr ng khi dùng ch ph m này b sung vào th c ăn cho gà . LIÊN QUAN N LU N ÁN Ã CÔNG B 2. N i dung nghiên c u c a lu n án • Nghiên c u khoa h c - Phân l p và ch n t t nhiên các n m men sinh s c t carotenoid thu c t gi i 3 H i thi Sáng t o Khoa h c K thu t T nh BR_VT năm 2008- gi ng Rhodotorula có kh năng t ng h p sinh kh i giàu beta-carotene theo 2009 v i gi i pháp: “Dùng ch ph m sinh h c thu nh n t canh trư ng nuôi phương pháp nuôi c y bán r n. c y bán r n Rhodotorula sp. CBS 10104 s n xu t tr ng gà ch t lư ng cao”. - Xác nh các thông s k thu t c a quá trình nuôi c y bán r n n m men • Các công trình ã công b Rhodotorula trên cơ ch t g o t m và bã u nành có b sung dinh dư ng. [1]. Nguy n Th Minh Nguy t, ng Th Anh ào, Nguy n H u Phúc (2007). - Kh o sát nh hư ng c a ch ph m sinh h c n năng su t và ch t lư ng Nghiên c u các c i m sinh h c và kh năng phát tri n trên môi trư ng bán cho tr ng c a gà, trong ó xác nh ư c m i quan h gi a hàm lư ng r n c a m t s n m men Rhodotorula phân l p t i Vi t Nam. Vi n Khoa h c carotenoid t ng trong th c ăn và năng su t cho tr ng c a gà chuyên tr ng. K t và Công ngh Vi t Nam, Vi n Sinh h c Nhi t i, Nhà xu t b n Khoa h c T qu c a quá trình nghiên c u cho th y tính ưu vi t và hi u qu kinh t rõ nét nhiên và Công ngh , Hà N i 2007, trang 270-277. c a ngu n th c ăn ư c t o ra theo phương cách b sung ch ph m sinh h c [2]. Nguy n Th Minh Nguy t, ng Th Anh ào, Nguy n H u Phúc (2007). trên. Ch n gi ng n m men Rhodotorula có kh năng phát tri n trên môi trư ng g o 3. Nh ng óng góp m i c a lu n án này t m cùng v i n m m c Monacus sp. theo phương pháp nuôi c y b m t. Vi n - Phân l p và ch n ư c ch ng n m men thu c gi ng Rhodotorula có Khoa h c và Công ngh Vi t Nam, Vi n Sinh h c Nhi t i, Nhà xu t b n kh năng t ng h p carotenoid giàu beta-carotene, sinh kh i và phytase theo Khoa h c T nhiên và Công ngh , Hà N i 2007, trang 263-269. phương pháp bán r n.
  5. 22 3 - T i ưu thành ph n dinh dư ng và i u ki n nuôi c y bán r n n m men Rhodotorula trên cơ ch t chính là g o t m và bã u nành v i hàm m c tiêu là 1. ã tuy n ch n m t ch ng gi ng Rhodotorula sp.3 có kh năng t ng hàm lư ng beta-carotene, ng th i ã xu t quy trình thu nh n ch ph m h p sinh kh i giàu carotenoid c bi t là beta-carotene và có ho t tính phytase sinh h c có giá tr dinh dư ng cao t n m men Rhodotorula theo phương pháp trên môi trư ng nuôi c y bán r n. lên men bán r n. 2. ã xác nh ư c i u ki n tách chi t beta-carotene có trong t bào n m - Th nghi m dùng ch ph m làm nguyên li u nuôi gà tr ng công nghi p men thu ư c t môi trư ng lên men bán r n (x lý thành t bào theo phương cho k t qu tăng năng su t và ch t lư ng tr ng. pháp k t h p L nh ông - Rã ông - Siêu âm). - Tìm ra phương trình bi u di n m i quan h gi a hàm lư ng carotenoid 3. ã xác nh ư c các thông s t i ưu cho quá trình lên men bán r n n m t ng trong th c ăn và năng su t cho tr ng c a gà chuyên tr ng IsaBrown. men Rhodotorula sp.3 nh m thu bet-carotene cao trên cơ ch t g o t m ã qua * C u trúc c a lu n án h hoá có b sung bã u nành như sau: hàm lư ng (mg/Kg) các ch t dinh Lu n án g m ph n m u, 4 chương, danh m c các công trình công b , dư ng b sung t i ưu g m: saccharose = 8700; nitơ = 8500; phosphor = b ng khen H i thi sáng t o K thu t T nh BR-VT năm 2009 và danh m c tài 3300; lưu huỳnh = 500 và i u ki n nuôi c y t i ưu là: m = 65%; dày li u tham kh o. Toàn b n i dung lu n án ư c trình bày trong 100 trang, trong l p môi trư ng = 1,5 cm; t l gi ng = 9 x 107 CFU/g MT. ó có 40 b ng; 2 sơ ; 28 hình, bi u và th ; s d ng 156 tài li u tham 4. Chúng tôi ã xây d ng ư c quy trình thu nh n ch ph m sinh h c t kh o và ính kèm 128 trang ph l c. Ph n l n n i dung c a lu n án ã ư c Rhodotorula sp.3 (g i t t là βCR). công b trong các bài báo khoa h c, gi i pháp d thi H i thi sáng t o K thu t 5. Qua kh o sát tính an toàn c a ch ph m βCR, chúng tôi ã th nghi m T nh BR_VT năm 2009 và ã ư c báo cáo t i các h i ngh , h i th o khoa h c dùng βCR làm th c ăn nuôi gà tr ng công nghi p Isa Brown. K t thu t ch c t i Vi t Nam và nư c ngoài. Các công trình công b ư c ghi cu i ư c cho th y năng su t tr ng c a gà có th tăng thêm 8-10 % (t 83 - 85% lu n án. lô i ch ng lên 93 - 95% các lô thí nghi m), các ch tiêu ch t lư ng tr ng như màu c a lòng , k t c u albumin c a lòng tr ng tr ng c, dày v Chương 1: T NG QUAN TÀI LI U cùng v i hàm lư ng beta-carotene và vitamin A trong lòng tr ng ư c c i Trong chương này, chúng tôi trình bày nh ng ki n th c n n t ng v n m thi n áng k . men Rhodotorula cũng như khóa phân lo i mà tác gi s d ng trong lu n án, 6. M i quan h gi a hàm lư ng carotenoid t ng trong th c ăn n năng k thu t nuôi c y bán r n và vai trò c a m t s ch t dinh dư ng i v i gà su t tr ng c a gà giai o n gà cho tr ng có năng su t cao và n nh ư c tr ng. Bên c nh ó, chúng tôi ã i m qua các công trình nghiên c u trên th 2 2 th hi n qua phương trình y = - 0,0007 x + 0,1842 x + 82,21 (R = 0,9976) v i gi i v s c t carotenoid c a n m men Rhodotorula theo k thu t lên men chìm x là hàm lư ng carotenoid t ng (mg/Kg), y là năng su t cho tr ng c a gà (%). và nêu rõ vai trò c a phytase, s c t carotenoid và beta-carotene i v i gà Nhìn chung k t qu nghiên c u trong lu n án ã áp ng hoàn toàn n i chuyên tr ng. dung và nhi m v . Tuy nhiên, chúng tôi xin ngh m t s hư ng nghiên c u Chương 2: I TƯ NG - PHƯƠNG PHÁP phát tri n ti p t c như sau: 2.1 Phân l p và nh danh n m men
  6. 4 21 Theo nh ng thông tin khoa h c ã trình bày ph n t ng quan chúng tôi ch n V i lô 4 và lô 5, lư ng ch ph m s d ng cao nhưng hàm lư ng vitamin A ư c 64 ngu n phân l p có ngu n g c t b m t hoa lá, trái cây, th c ph m, trong lòng tr ng l i th p hơn so v i lô 3. Hi n tư ng này, theo chúng tôi, có ngu n t và ngu n nư c ch y u l y t i TP.HCM, t nh BR-VT và Long An. liên quan n cơ ch h p thu, chuy n hóa các ch t trong cơ th gà và ã x y ra M i m u chúng tôi ti n hành phân l p ng th trên 3 môi trư ng YMPG cơ ch tác d ng ngư c. Trong hai ch s hàm lư ng beta-carotene và vitamin (Yeast extract- Malt extract- Peptone- Glucose- agar), YPG (Yeast extract- A, chúng tôi ưu tiên l a ch n phương án t o hàm lư ng vitamin A do ây là Peptone- Glucose- agar) và PGA (Potatoes- Glucose- agar). Ch n và gi l i các ngu n vitamin t nhiên r t c n cho ngư i, góp ph n kh c ph c tình tr ng thi u m u vi sinh có hình thái t bào n m men, có khu n l c t màu kem n (s c vitamin A trong kh u ph n th c ăn ngư i. K t h p v i k t qu b ng 3.24, t carotenoid). Căn c vào khóa phân lo i c a Kreger-van Rij (1984) l n lư t chúng tôi kh ng nh t l ch ph m 15% trong thành ph n th c ăn c a gà ti n hành th c hi n các quan sát i th , vi th c n thi t cho công tác nh danh (tương ng v i lô 3) là t l t o ra năng su t và ch t lư ng tr ng cao nh t. n m men n gi ng (genus) Rhodotorula, sau ó ti n hành nhi u ph n ng sinh Tóm l i, nghiên c u c a chúng tôi ã t ư c nh ng k t qu có giá tr hóa nh danh n loài (species). 2.2 Thu nh n ch ph m sinh h c t n m men Rhodotorula theo k thu t nh t nh. Chúng tôi ã tuy n ch n ư c n m men Rhodotorula sp.3. N m men nuôi c y bán r n này ư c phân l p t lá lúa non, m u lá lúa ư c l y vào th i i m tháng 5 t i ch n ch ng làm ngu n gi ng nghiên c u chính, chúng tôi ti n hành cánh ng lúa huy n Tân An - T nh Long An, Vi t Nam. B ng các kh o sát nuôi bán r n (BR) 8 n m men Rhodotorula phân l p ư c trên môi trư ng cơ th c nghi m, k t qu nghiên c u c a lu n án ã tìm ư c phương pháp phá v b n. C nh các i u ki n nuôi c y ban u như nhau ch n ra ch ng có kh thành t bào n m men hi u qu trong trư ng h p t bào l n trong các h t cơ năng sinh t ng h p beta-carotene cao nh t trên môi trư ng BR làm ngu n ch t r n, ó là phương pháp x lý t bào b ng l nh ông – rã ông và k t h p gi ng nghiên c u chính. Môi trư ng cơ b n (môi trư ng t ng h p) ban u cho v i siêu âm. K t qu nghiên c u này có th ng d ng x lý thành t bào quá trình LBR n m men Rhodotorula có thành ph n g m cơ ch t và dư ng trong các nghiên c u có liên quan n LBR vi sinh v t. Các k t qu th c ch t b sung (dung d ch khoáng và d u c thô). chu n b 100 Kg cơ ch t nghi m trên gà tr ng cho th y ch ph m an toàn, có tác d ng làm tăng ph m chúng tôi s d ng: 45 Kg g o t m; 55 ÷ 60 lít nư c; 3 Kg bã u nành. Sau khi ch t và năng su t tr ng. Chúng tôi ã tìm ra phương trình bi u di n nh hư ng h hóa g o, ph i tr n bã u nành l n lư t b sung vào 1% dung d ch khoáng, c a hàm lư ng carotenoid t ng trong th c ăn n năng su t tr ng c a gà. 1% d u c thô (v/w; ml/g). Dung d ch khoáng có thành ph n g m NaNO3: 10g; Phương trình này có giá tr khoa h c, th c ti n cao và chưa ư c công b trong KH2PO4: 2,5g; MgSO4.7H2O: 1,75g; ư ng saccharose: 30g; nư c c t: 1000 m t công trình nào. ml. * Thí nghi m kh o sát h dung môi trích ly và phương pháp phá v t Chương 4: K T LU N bào V i các m c tiêu ban u t ra, sau th i gian nghiên c u chúng tôi ã t Kh o sát h dung môi trích ly và ch n phương pháp x lý m u trong ư c các k t qu sau: i u ki n t bào l n trong các h t cơ ch t r n. Các h dung môi (DM) kh o sát có thành ph n theo t l (% v) như sau:
  7. 20 5 beta-carotene nên ho t ng ch ng oxi hóa c a th vàng b tr ng i, s t ng -DM1 g m acetonitril: 2-propanol: methanol= 85: 10: 5 h p progesterol b ngăn c n, d n n ho t ng kém bình thư ng c a ng d n -DM2 g m acetonitrile: methanol: 2-propanol= 75: 17,5: 7,5 tr ng. -DM3 g m acetonitrile:2-propanol:ethyl acetate = 40: 40: 20 Qua các thông s kh o sát các ch tiêu ph m ch t tr ng, chúng -DM4 g macetonitrile:methanol:chloroform= 45: 45: 10 tôi k t lu n: -DM5 g m acetone: light petroleum = 75: 25 - Ch n lô 3 v i t l ch ph m b sung là 15% là lô có thành ph n th c ăn Kh o sát bư c sóng λmax (nm) và dùng phương pháp UV-Vis xác nh h p lý, và c i thi n rõ nét năng su t tr ng, ch t lư ng tr ng. hàm lư ng beta-carotene (ppm theo CK) - Ch ph m βCR an toàn và không c. * Hàm lư ng beta-carotene và vitamin A trong lòng tr ng Thu nh n tr ng các lô vào giai o n cu i c a thí nghi m, t c sau 16 tu n thí nghi m. Ti n hành phân tích hàm lư ng beta-carotene và vitamin A trong lòng tr ng, k t qu th hi n b ng 3.25. B ng 3.25 Hàm lư ng beta-carotene và vitamin A trong lòng tr ng các lô thí nghi m LÔ Hàm lư ng beta – carotene Hàm lư ng vitamin A (mg/Kg) (µg %) LÔ C 4,49 ± 0,65 d 468,24 ± 52,48f LÔ 1 6,37 ± 0,45b 551,29 ± 45,66 e LÔ 2 5,51 ± 1,02c 604,35 ± 41,88c LÔ 3 5,64 ± 0,55c 895,26 ± 66,96a LÔ 4 6,33 ± 0,82b 753,34 ± 38,45b LÔ 5 9,05 ± 1,20a 577,01 ± 62,22d (Các giá tr trong cùng m t c t có s mũ khác nhau thì khác nhau có ý nghĩa m c α = 0,05) B ng 3.25 cho th y tr ng gà t các lô thí nghi m có hàm lư ng beta- carotene và vitamin A cao hơn rõ nét so v i lô C. S khác bi t này ch ng t Sơ 2.1 Sơ kh o sát và thu nh n ch ph m sinh h c βCR gà thí nghi m h p thu ư c carotenoid có trong ch ph m. Tuy nhiên, hàm lư ng beta-carotene và vitamin A trong lòng tr ng các lô bi n thiên không ng b . Hàm lư ng vitamin A trong tr ng gà lô 3 cao nh t trong khi hàm lư ng beta-carotene trong lòng tr ng gà lô 5 cao nh t.
  8. 6 19 Chúng tôi b trí 21 nghi m th c (NT) phá v thành t bào g m các phương LÔ 3 62,87± 34,94± 33,18 12,33 0,78 ± 64,64 9,97 ± 0,39 a a pháp k t h p gi a phương pháp v t lý (nghi n, b t thu tinh, siêu âm, l nh 0,10 0,41 ± 0,58a ± 0,27a 0,004a ± 0,34a ±0,01a 1,78a ông, c p ông, rã ông), hóa h c (DMSO), sinh h c (t phân, chitinase). LÔ 4 61,25 34,20 32,99 12,29 0,77 ± 64,07 9,99 0,38 ± Kh o sát và ch n ra NT cho kh năng trích ly beta-carotene cao nh t làm ±0,30c ±0,30b ±0,97ab ± 0,28a 0,001a ± ±0,37a 0,02a phương pháp x lý m u trong các thí nghi m ti p theo. Sau khi ch n ư c 3,22a ngu n gi ng, h dung môi trích ly và phương pháp x lý m u t i ưu chúng tôi LÔ 5 61,15 34,00± 32,71 12,18 0,77 ± 61,90 9,78 ± 0,38 ± c ti n hành nuôi c y và kh o sát theo sơ tóm t t hình 2.1. ±0,08 0,38bc ± 0,13b ±0,16ab 0,005b ± 0,10a 0,01a 1,67b * T i ưu thành ph n dinh dư ng b sung và i u ki n LBR v i hàm (Các giá tr trong cùng m t c t có s mũ khác nhau thì khác nhau có ý nghĩa m c α = 0,05) m c tiêu là hàm lư ng beta-carotene (ppm theo ch t khô - CK) có trong canh K t qu trình bày b ng 3.24 cho th y: trư ng vào ngày nuôi c y th 7. Th c hi n các kh o sát sơ b tìm thí - Kh i lư ng tr ng (g/tr ng), t l lòng tr ng, màu lòng , t l lòng nghi m t i tâm và sau ó, thi t l p phương án thí nghi m và ti n hành thí tr ng c, ch s Haugh, t l v tr ng, dày v n nh qua các tu n thí nghi m theo phương án ã l p. Dùng phương pháp quy ho ch th c nghi m nghi m. Các thông s tương ng c a tr ng gà lô C th p hơn so v i tr ng các lô thí nghi m ( m c ý nghĩa α = 0,05). Các thông s này không tăng tuy n quay b c hai c a Box-Hunter, v i h s cánh tay òn sao α = 2 và s thí tính theo hàm lư ng ch ph m s d ng mà theo d ng b c hai h s âm (parabol nghi m tâm là 7 t i ưu 4 y u t dinh dư ng g m saccharose, nitơ úp ngư c). Trong ó, giá tr c c i c a các thông s kh o sát h u h t lô 3. (NaNO3), phosphor (KH2PO4) và lưu huỳnh (MgSO4). Ch n phương pháp t i - Khi tăng hàm lư ng ch ph m t 5 ÷ 15% thì h u h t các thông s tăng ưu các y u t toàn ph n 23 v i 3 thí nghi m tâm t i ưu 3 y u t i u ki n d n và t c c i hàm lư ng 15% (lô 3). lô 4 và lô 5, tuy b sung lư ng nuôi c y g m m môi trư ng (MT) (%), dày l p MT (cm) và t l gi ng ch ph m cao nhưng h u h t các thông s kh o sát gi m. Nguyên nhân là do s m t cân i gi a các thành ph n cung c p năng lư ng. Riêng i v i lô C t t (CFU/g MT). Dùng công c Optimizer c a ph n m m Modde 5.0 xác nh c các thông s u m c th p. i u này ch ng t hi u qu c a ch ph m i các giá tr t i ưu. v i năng su t và ch t lư ng tr ng c a gà. Kh o sát kh năng sinh t ng h p sinh kh i theo phương pháp m khu n - Hình d ng tr ng có ý nghĩa quan tr ng trong vi c p tr ng cũng như trong l c c a Sato và c ng s (1985). Xác nh hàm lư ng carotenoid t ng theo v n chuy n b o qu n tr ng thương ph m. Ch s hình d ng thích h p thì tr ng s có t l d p v th p nh t trong quá trình b o qu n, v n chuy n, và cho t l phương pháp so màu c a dung d ch trích ly v i thang màu m u K2Cr2O7. Xác p n cao. Quan sát tr ng gà nh t ư c lô C th y m t s tr ng có hình d ng nh ho t tính phytase d a trên nguyên t c phosphate tác d ng v i amonium không u, quá dài hay quá tròn, ôi khi có ch l i lõm. Trong khi ó, tr ng molydat s t o ra phosphomolybdat có màu vàng. Khi kh phosphomolybdat, nh t ư c t các lô thí nghi m ch s hình d ng tr ng cao. Tr ng lô 3 và lô 4 màu vàng s chuy n thành màu xanh molybdat, m c a màu s c t l v i r t p, cân i có m t u tù, m t u nh n. S khác bi t v hình d ng c a hàm lư ng phosphor có trong m u. tr ng lô C và các lô thí nghi m có th gi i thích d a vào bi u hi n ho t ng co bóp c a ng d n tr ng, khi gà ăn th c ăn có b sung beta-carotene thì 2.3 Kh o sát tính an toàn c a ch ph m trên ng v t thí nghi m ho t ng ch ng oxi hóa c a th vàng t t d n n ho t ng sinh lý bình i tư ng thí nghi m là chu t nh t tr ng, chu t c, 16 ngày tu i, kh i thư ng c a bu ng tr ng. Ngư c l i, thành ph n th c ăn l ô C thi u
  9. 18 7 Threonine (%) 0,76 0,83 0,89 0,95 1,01 lư ng 15 ÷ 16 g/cá th . Chu t thí nghi m ư c chia thành 4 lô, m i lô g m 9 Isoleucine (%) 0,82 0,92 1,01 1,10 1,19 Tryptophan (%) 0,21 0,22 0,23 0,24 0,25 cá th chu t. Sau 15 ngày thí nghi m xác nh t l cá th ch t/s ng, các ch s Calci (%) 0,55 0,55 0,55 0,54 0,54 máu, hàm lư ng vitamin A và beta-carotene trong huy t thanh, hàm lư ng Ca, Phosphor t ng (%) 0,64 0,62 0,61 0,60 0,58 P trong xương và P trong phân c a t ng cá th chu t. Phosphor hi u d ng 0,22 0,22 0,21 0,21 0,21 (%) T l th c ăn s d ng trong các lô thí nghi m như sau: Mu i NaCl (%) 0,60 0,60 0,60 0,59 0,59 - Lô 1: chu t ăn 100% th c ăn Vi n Pasteur (lô i ch ng - C) Aflatoxin (ppb) 9,80 9,20 8,60 8,00 7,40 - Lô 2: chu t ăn th c ăn g m 75% th c ăn C + 25% ch ph m βCR Linoleic acid (%) 4,95 6,17 7,40 8,62 9,85 - Lô 3: chu t ăn th c ăn g m 50% th c ăn C + 50% ch ph m βCR Carotenoid (mg/kg) 43,77 78,70 113,62 148,55 183,48 Beta-carotene (mg/kg) 7,96 15,93 23,89 31,85 39,82 - Lô 4: chu t ăn th c ăn g m 25% th c ăn C+ 75% ch ph m βCR. * Các ch tiêu ph m ch t tr ng m s lư ng h ng c u, b ch c u theo phương pháp pha loãng r i m trên Ti n hành kh o sát các ch tiêu ch t lư ng tr ng và thu ư c k t qu trung bu ng m Neubaure. Hàm lư ng Hemoglobin (Hb) xác nh theo phương bình th hi n như b ng 3.24. Kh o sát năng su t tr ng c a gà liên t c trong 12 tu n vào giai o n gà pháp so màu trên máy Specon. Xác nh hàm lư ng beta-carotene và vitamin A ư c 30 ÷ 42 tu n tu i cho th y năng su t tr ng trung bình tăng d n t lô 1 n trong huy t thanh theo phương pháp c a Easley J.F. (1965). Xác nh hàm lô 3, có gi m nh lô 4. Gà lô 3 cho năng su t cao nh t (93,74 ± 2,47)% và k lư ng Ca theo phương pháp chu n ph c và P theo phương pháp UV-vis. n là lô 4 (93,08 ± 3,89)%. Tuy nhiên s khác bi t này không có ý nghĩa v m t th ng kê. Lô 5 lư ng ch ph m b sung li u r t cao, song kh năng sinh 2.4 Kh o sát nh hư ng c a ch ph m trên gà s n c a gà l i không cao, có th do s m t cân i c a thành ph n th c ăn. Gà Các thí nghi m kh o sát nh hư ng c a ch ph m βCR lên gà tr ng ư c lô C cho năng su t tr ng th p nh t, ch t (83,21 ± 3,42)%. ti n hành t i tr i gà c a doanh nghi p tư nhân MaiTh y, t nh Bà R a-Vũng B ng 3.24 K t qu trung bình kh o sát các ch tiêu ch t lư ng tr ng qua các tu n thí nghi m Tàu. Gà thí nghi m là gi ng gà IsaBrown, b t u thí nghi m khi gà giai Klg T l T T l Ch Ch s Màu o n 26 tu n tu i và k t thúc vào 42 tu n tu i. Th c ăn C là th c ăn m c LÔ tr ng lòng l v s Haugh lòng dày GD26 Star Feed do Công ty chăn nuôi CP VN cung c p. (g) tr ng lòng (%) hình v c (%) d ng Gà thí nghi m ư c chia làm 6 lô, m i lô 40 con g m 10 chu ng, m i (%) chu ng 4 con. Kh o sát các ch tiêu năng su t tr ng, kh i lư ng c a gà thí LÔ 60,01 32,74 30,70 11,54 0,77 ± 41,21 ± 6,80 0,26 ± nghi m trư c khi b t u thí nghi m. Gà lô C ư c ăn 100% th c ăn do d d C ±0,75 ±0,17 ± ± 0,22c 0,001b 0,60d ± 0,02c 0,12d 0,06c doanh nghi p ph i tr n. Thành ph n th c ăn C ư c ph i tr n g m: GD26 LÔ 1 61,42 33,71 31,81 11,97 0,77 ± 53,48 ± 9,30 0,34 ± Star Feed, b p vàng xay, t m, cám g o, v sò. T l (%) các thành ph n thay ±0,46c ±0,20c ± ± 0,34b 0,003b 1,99c ± 0,01b 0,08c 0,53b i theo t ng giai o n tu i. LÔ 2 61,90 34,1 32,63 12,18 0,77 60,38 9,74 0,38 Gà các lô thí nghi m t lô 1 n lô 5 ư c ăn th c ăn h n h p do chúng ±0,27b ±0,66b ± ±0,31ab ±0,01b ± 2,99b ±0,02a tôi xây d ng. Kh u ph n áp ng nhu c u 18% protein, có thành ph n ph i 0,27b 0,11a tr n g m: b p vàng, bã u nành, cám g o, ch ph m βCR, b t cá, b t v sò,
  10. 8 17 mu i NaCl. C nh các thành ph n cám g o (12% m): 20%, b t cá (53% th c th c ăn cho gà mái các lô. Dùng ph n m m Ultramix tính năng m): 5%, NaCl: 0,5% và b t v sò: 0,5%. Thay i t l ch ph m βCR s lư ng và công th c c a th c ăn chúng tôi thu ư c b ng 3.23. d ng trong các lô 1 n lô 5 l n lư t là 5, 10, 15, 20 và 25%. T t l ch ph m So sánh ba y u t chính trong th c ăn dùng cho gà thí nghi m b ng 3.23 βCR s d ng trong các lô, ti n hành tính toán thành ph n c n ph i tr n c a b p chúng tôi nh n th y: vàng, bã u nành và xu t thành ph n th c ăn ph i tr n cho gà các lô thí - V m t năng lư ng trao i ME (Kcal/Kg) trong th c ăn cung c p các lô nghi m. thí nghi m không khác bi t m c ý nghĩa α = 0,05 và ME t giá tr trung Sau 4 tu n thí nghi m gà quen d n th c ăn, chúng tôi ti n hành thu nh n bình 2893 ± 10 (Kcal/Kg). tr ng và xác nh hi u su t cho tr ng, các ch tiêu v ph m ch t tr ng như kh i - V hàm lư ng protein thô trong th c ăn các lô thí nghi m không khác lư ng, hình d ng, ch s Haugh, màu lòng , t l lòng tr ng tr ng c, t l bi t m c ý nghĩa α = 0,05 và t giá tr trung bình 18,27 ± 0,35 (% Klg). lòng ,t l v , dày v tr ng. Các ch tiêu tr ng ư c th c hi n t i phòng - V hàm lư ng carotenoid có s khác nhau áng k gi a các lô thí nghi m thí nghi m b môn chăn nuôi chuyên khoa, khoa chăn nuôi thú y, Trư ng H và lô C. Theo b ng 3.23 chúng tôi tìm ư c m i quan h gi a hàm lư ng Nông Lâm TP.HCM. Ti n hành xác nh hàm lư ng vitamin A và carotenoid carotenoid t ng trong th c ăn và năng su t cho tr ng c a gà, quan h này bi u trong lòng tr ng theo phương pháp c a AOAC 958.05 và 974.29 và g i hi n qua phương trình y = - 0,0007 x2 + 0,1842 x + 82,21 (R2=0,9976) v i x là m u tr ng tươi n Trung tâm s c ký H i ăng ki m ch ng. hàm lư ng carotenoid t ng (mg/Kg), y là năng su t cho tr ng c a gà (%). Chương 3: K T QU NGHIÊN C U B ng 3.23 Công th c th c ăn cho gà s d ng trong thí nghi m 3.1 Ch n Rhodotorula có kh năng sinh t ng h p betacarotene trên môi Thành ph n(% Klg) Lô 1 Lô 2 Lô 3 Lô 4 Lô 5 B p vàng xay 49 46 43 40 37 trư ng bán r n Bã u nành 20 18 16 14 12 T 64 m u phân l p ban u (trong ó có 21 m u lá; 17 m u hoa, v qu ; Ch ph m βCR 5 10 15 20 25 10 m u t cát; 3 m u nư c; 3 m u rác và 10 m u th c ph m), sau khi làm Cám g o 20 20 20 20 20 B t cá 5 5 5 5 5 thu n và quan sát các c i m hình thái t bào dư i kính hi n vi, chúng tôi ã B t v sò 0,5 0,5 0,5 0,5 0,5 tuy n ch n ư c 17 dòng n m men sinh s c t t có màu t vàng kem, h ng NaCl 0,5 0,5 0,5 0,5 0,5 cam n . Các n m men này ư c ký hi u l n lư t là MN1, MN2, MN3, T ng c ng 100 100 100 100 100 Ch t khô (%) 87,11 87,18 87,25 87,32 87,39 MN4, MN5, MN6, MN7, MN8, MN9, MN10, MN11, MN12, MN13, MN14, ME (Kcal/kg) 2903,00 2898,00 2893,00 2888,00 2883,00 MN15, MN16 và MN17. Protein t ng (%) 18,09 18,20 18,31 18,42 18,53 B ng 3.2 K t qu kh o sát c i m sinh lý và sinh hóa c a 8 ch ng Rhodotorula phân l p ư c Ch t béo t ng (%) 6,86 7,28 7,70 8,12 8,54 Ký hi u n m men Rhodotorula phân l p ư c Xơ thô (%) 4,05 4,21 4,37 4,54 4,70 TT Thí nghi m th c hi n MN1 MN5 MN7 MN8 MN10 MN12 MN16 MN17 Lysine (%) 1,00 1,03 1,07 1,10 1,14 1. Nang bào t - - - - - - - - Methionine (%) 0,42 0,49 0,57 0,64 0,71 2. S ti p h p - - - - - - - - Met + Cystine (%) 0,73 0,80 0,87 0,94 1.01 3. Gi s i n m - - - - - - - -
  11. 16 9 4 N t ng s 3,62 ± 0,02 4. Khu n ty th - - - - - - - - 5. Bào t b n - - - - - - - - 5 N formol 1,75 ± 0,17 6. Urease + + + + + + + + 6 Tinh b t 40,43 ± 1,58 7. DBB (diazonium blue B) + + + + + + + + 8. Phát tri n 200C + + + + + + + + 7 Lipid 13,52 ± 3,02 9. Phát tri n 300C + + - - + + - -/+ 8 Xơ t ng 6,89 ± 0,87 10. Phát tri n 370C - - - - - - - - 9 Tro t ng 4,73 ± 0,55 11. Lên men glucose - - - - - - - - 12. Hình thành h p ch t tinh b - - - - - - - - 10 Beta-carotene 180,68 ± 17,58 (ppm theo CK) 13. D-glucose + + + + + + + + 11 Carotenoid t ng 804,04 ± 32,12 (ppm theo CK) 14. D-galactose + + + + + + + + 12 Ho t tính phytase 87,07 ± 19,02 UI/g ch ph m khô 15. Lactose - - - - - - - - 16. Sucrose + + + + + + + + Hàm lư ng protein c a g o t m ban u th p kho ng 7%, sau khi qua x lý 17. Maltose + - + - + + - + và LBR n m men Rhodotorula hàm lư ng protein tăng áng k và t 22,60 ± 18. Cellobiose + + - - - - - V 19. D-xylose + + + + + + + + 1,25 (%Klg). K t qu này ch ng t n m men Rhodotorula ã chuy n hóa ư c 20. L-Arabinose - - - - - - - - ngu n nitơ trong cơ ch t (g o và bã u nành) và ngu n nitơ vô cơ b sung 21. D-Trehalose + + - - - - - - (mu i NaNO3) thành ngu n nitơ h u cơ c a t bào dư i d ng protein. Như v y, 22. Melezitose + - + - + + - + 23. Raffinose V + + - + + - + v phương di n sinh h c, ch ph m thích h p làm ngu n th c ăn b sung cho 24. L-Arabitol - + - - - - - - dinh dư ng v t nuôi. 25. Glycerol + + + + + + + + 3.3 Kh o sát tính an toàn c a ch ph m trên chu t 26. Melibiose - - - - - + - - 27. Inositol - - - - - - - - Sau th c nghi m kh o sát nh hư ng c a ch ph m βCR trên chu t, chúng 28. Potassium nitrate + + + - + + - + tôi ưa ra các k t lu n sau: Ghi chú: (-): ph n ng âm tính; (+): ph n ng dương tính; V(-/+): ph n ng y u, không rõ. - T t c các cá th chu t thí nghi m u s ng. Ti n hành th c hi n các ph n ng sinh lý, sinh hóa i v i 17 n m men sinh - ã cho chu t ăn ch ph m v i li u 250 g/Kg th tr ng liên t c trong 15 s c t carotenoid phân l p ư c trên tr l i các câu h i trong vi c nh ngày nhưng chu t v n không ch t và không có bi u hi n b nh lý. i u ó, danh nhóm các gi ng n m men t o bào t và không t o bào t theo khoá phân ch ng t tính an toàn c a ch ph m. lo i c a Kreger-van Rij (1984). K t qu chúng tôi ã ch n ư c 8 ch ng n m - Các k t qu trên là cơ s ban u chúng tôi ti p t c ti n hành th c men mang ký hi u MN1, MN5, MN7, MN8, MN10, MN12, MN16 và MN17 nghi m kh o sát nh hư ng c a ch ph m βCR trên gà tr ng. thu c gi ng Rhodotorula. Chúng tôi ã quan sát và mô t hình thái t bào, t c 3.4 Kh o sát nh hư ng c a ch ph m trên gà phát tri n trên th ch ĩa c a 8 lo i n m men Rhodotorula phân l p ư c. T l protein t ng trong th c ăn nuôi gà tr ng c n áp ng m c 18%. Ti n hành kh o sát các c i m sinh lý, sinh hóa c a các n m men S li u này là cơ s chúng tôi xây d ng thành ph n th c ăn cho gà thí Rhodotorula phân l p ư c trên b Test ID32E và trên các môi trư ng nghi m. Sau khi tính toán, cân i và i u ch nh, chúng tôi nh n ư c công
  12. 10 15 chung th ch ĩa và trong ng nghi m. Các k t qu ư c trình bày b ng 3.2. Toàn b canh trư ng nuôi c y BR ư c s y nhi t 50 ± 1oC trong th i Quan sát các c i m hình thái sinh lý t bào, khu n l c và các c i m sinh gian 24 n m t yêu c u ưa vào b o qu n kho ng 11 ÷ 12%, chúng tôi hóa c a các n m men thu c gi ng Rhodotorula và sau ó, căn c vào khóa thu ư c ch ph m βCR như hình 3.11. nh danh c a Kreger-van Rij, chúng tôi k t lu n như sau: - N m men ký hi u MN5 là Rh. graminis; - N m men ký hi u MN7 là Rh. ingeniosa; - Hai ch ng MN10 và MN17 u là Rh. glutinis nên ư c ký hi u l n lư t là Rh. glutinis HUI-1 và Rh. glutinis HUI-2; - B n n m men có ký hi u MN1, MN8, MN12 và MN16 chưa cơ s nh danh n loài nên chúng ư c ký hi u l n lư t là: Rhodotorula sp.1 (MN1), Rhodotorula sp.2 (MN8), Rhodotorula sp.3 (MN12) và Rhodotorula sp.4 (MN16). Hình 3.11 Khay lên men bán r n Rhodotorula và ch ph m βCR thu ư c 7 C y cùng t l gi ng kho ng 2x10 CFU/g MT vào môi trư ng cơ b n và h n ch s t n th t carotenoid do s oxi hóa trong quá trình s y và b o nuôi BR 8 n m men Rhodotorula phân l p ư c trong cùng i u ki n. Kh o sát qu n chúng tôi ã th c hi n vi c x lý canh trư ng sau lên men theo trình t kh năng sinh t ng h p beta-carotene c a t ng ch ng vào ngày nuôi c y th 7. như sau: vi bao canh trư ng b ng b t g o (t l b t g o s d ng 5% Klg) r i K t qu thu ư c th hi n b ng 3.3. ti n hành s y nhi t 50 ± 1oC n m 11 ÷ 12%. Sau ó óng gói chân B ng 3.3 Kh năng sinh t ng h p beta-carotene c a các lo i n m men Rhodotorula không trong bao bì ghép nhi u l p có kh năng ch n ánh sáng và tia c c tím, Ký hi u Hàm lư ng beta- Ký hi u Hàm lư ng beta- ch ng th m oxi và hơi nư c cao. B ng k thu t x lý vi bao và óng gói trong n m men carotene (ppm CK) n m men carotene (ppm CK) bao bì có c u trúc ghép ph c h p như trên, ng th i ch ph m ư c chi t rót, MN1 14,48 ± 3,81c MN10 16,70 ± 2,18 c rút chân không chúng tôi ã h n ch ư c s oxi hóa c a các ch t dinh dư ng MN5 27,77 ± 7,03 b MN12 42,55 ± 3,57 a có trong ch ph m, t l t n th t carotenoid t ng gi m ch còn 8 ÷ 10%. MN7 3,98 ± 0,97 d MN16 5,10 ± 2,06 d MN8 4,42 ± 1,43d MN17 4,42 ± 1,43d Ti n hành phân tích thành ph n dinh dư ng trong ch ph m βCR, k t qu (Các giá tr có ch s mũ khác nhau thì khác nhau có ý nghĩa m c α = 0,05) thu ư c trình bày b ng 3.20. Th c nghi m kh o sát kh năng sinh t ng h p beta-carotene c a 8 ch ng B ng 3.20 K t qu phân tích thành ph n dinh dư ng c a βCR n m men Rhodotorula phân l p ư c trình bày b ng 3.3. B ng 3.3 cho th y MN12 là n m men có kh năng sinh t ng h p beta-carotene cao nh t do ó S TT Ch tiêu phân tích Thành ph n (% Klg) MN12 ư c ch n làm ch ng gi ng nghiên c u chính. Bên c nh phương pháp 1 m 11,85 ± 0,82 nh danh d a vào các c i m sinh lý, sinh hóa theo khoá phân lo i c a Kreger-van Rij (1984) chúng tôi cũng g i m u n m men MN12 n Công ty 2 T ng s CFU 1,2 x 107 CFU/g CK 3 Protein t ng 22,61 ± 1,25
  13. 14 11 T ó ch ng t vi c t i ưu các thông s công ngh trong quá trình LBR có ý Nam Khoa xác nh tr t t s p x p các nucleotid, k t qu nh n ư c như nghĩa r t l n trong th c t s n xu t. sau: * Quá trình sinh t ng h p sinh kh i, phytase, carotenoid t ng và beta- TTGCTTGCCGGGCTTGCTCGGTTTGCAGGCCAGCATCAGTTTTCTGG carotene theo th i gian GACGGATAATGGCAGTTAGAATGTAGCGTCTCGGCTGTGTTATAGC Trong các thí nghi m này, chúng tôi s d ng k t qu t i ưu dinh dư ng và TTTCTGCTGGATACGTCCGGGGGACTGAGGAACGCAGCGTGCCGTA i u ki n nuôi c y, l n lư t ti n hành kh o sát ng h c sinh t ng h p sinh TGGCGAGGCTTTGGTCCTTTCACGCTTAGGATGCTGGTGGAATGGTT kh i, phytase, carotenoid t ng và beta-carotene c a n m men Rhodotorula theo TAAACGACCCGTCTTGAAACACGGACCAAGGAGTA. Qua vi c gi i th i gian LBR. K t qu nh n ư c các th sau: trình t 28S DNA và tra c u trên blast search, cho k t qu như hình 3.5, v i Hình tương ng 100% v i ch ng Rhodotorula sp. CBS 10104 trong d li u ngân 3.7; hàng NCBI. 3.9 th bi u di n Hình 3.5 K t qu tra c u trình t 28S DNA c a ch ng MN12 kh năng t ng h p sinh kh i; V y trong lu n án này, thu n l i cho vi c trình bày chúng tôi th ng nh t beta-carotene và carotenoid g i n m men Rhodotorula sp.3 (MN12) là Rhodotorula. N m men Rhodotorula t ng h p sinh kh i, carotenoid t ng và beta-carotene 3.2 Thu nh n ch ph m sinh h c t Rhodotorula (βCR) không tương thích nhau. Sinh kh i t bào và carotenoid tc c i vào ngày * Phương pháp phá v thành t bào n m men th lên men 7 và t i th i i m này hàm lư ng beta-carotene ch chi m 20,95 ± V i thành ph n cơ ch t chính như ã trình bày ph n phương pháp, k t qu 0,96% carotenoid t ng. Chúng tôi ch n th i gian thích h p thu nh n ch chúng tôi ch n ư c h dung môi DM3 g m acetonitrile: 2-propanol: ethyl ph m sinh h c t n m men Rhodotorula là vào ngày lên men th 7. acetate = 40: 40: 20 (% th tích) là h dung môi hi u qu dùng trích ly beta- N m men Rhodotorula do chúng tôi phân l p ư c có kh năng t ng h p carotene b ng phương pháp UV-Vis bư c sóng 454 nm. Dùng h dung môi phytase nên có ý nghĩa th c ti n r t l n khi s d ng canh trư ng LBR làm th c DM3 kh o sát các phương pháp phá v t bào khác nhau. ăn cho gà . Khi ó ch ph m sinh h c thu ư c t n m men Rhodotorula s Hi n nay, ã có nhi u công b khoa h c v phương pháp thu nh n sinh kh i giúp gà h p thu t t các dư ng ch t, c bi t làm tăng hàm lư ng phosphor, và tách chi t s c t carotenoid và beta-carotene c a Rhodotorula khi nuôi c y calci trong xương ng th i góp ph n làm gi m thi u lư ng phosphor trong theo k thu t lên men chìm. Nghiên c u nuôi c y Rhodotorula trên môi trư ng r n và phá v t bào n m men có l n trong các h t cơ ch t r n là m t nghiên phân h n ch gây ô nhi m môi trư ng chăn nuôi. c u hoàn toàn m i c a chúng tôi, chưa ư c c p b t kỳ trong m t công trình nào. Vi c tách sinh kh i ra kh i cơ ch t có c u trúc xơ hay h t là r t khó nên
  14. 12 13 m c tiêu c a thí nghi m này là tìm ra cách phá v thành t bào có hi u qu cao Y1 max = 238,29 ppm beta-carotene (theo CK) tách chi t s c t n i bào trong i u ki n t bào n m men Rhodotorula l n V i các hàm lư ng dư ng ch t b sung t i ưu như sau: saccharose 8700, trong các h t cơ ch t r n. nitơ 8500, phosphor 3300 và lưu huỳnh 500 (mg/Kg MT). K t qu kh o sát thí Hàm lư ng beta-carotene luôn ư c phóng thích kh i t bào v i li u lư ng nghi m tâm cho bài toán th c nghi m t i ưu v i 3 y u t i u ki n nuôi c y cao hơn m t cách áng k các nghi m th c có qua x lý t bào b ng sóng như sau: m = 60%; dày l p MT = 2cm; t l gi ng = 7x107 CFU/g MT. siêu âm. Phương pháp x lý siêu âm có b sung b t th y tinh ã cho hi u qu Sau khi tính toán các h s bj, h s h i qui tj và tra b ng tiêu chu n Student, phá v t bào cao hơn so v i trư ng h p không b sung b t th y tinh. nhi t lo i b các h s không có ý nghĩa, ki m tra s tương thích c a phương trình l nh ông, g n như a s nư c t do có trong m u k t tinh thành nư c á h i quy, chúng tôi nh n ư c phương trình h i qui t i ưu các y u t i u ki n v i tinh th to, s c nên khi rã ông các tinh th á này làm v t bào m nh hơn nuôi c y: so v i phương pháp c p ông. Theo k t qu trình bày b ng 3.5 cho th y Y2 = 202,99 + 27,36 x1 + 26,70 x3 - 27,43 x2 x3 NT13 cho hi u qu tách chi t cao nh t v i th i gian x lí m u l i ng n và hàm Phương trình h i qui này cho th y 3 y u t : m (x1), dày l p MT (x2), lư ng beta-carotene cao nh t, t (108,19 ± 4,58) ppm theo CK. Như v y, và t l gi ng (x3) u nh hư ng n quá trình sinh t ng h p beta-carotene NT13 tương ng v i phương pháp l nh ông - rã ông - siêu âm ư c ch n c a n m men Rhodotorula. Trong ó, m và t l gi ng nh hư ng t l làm nghi m th c phá v thành t bào trong các nghiên c u ti p theo. thu n còn tương tác kép gi a dày l p môi trư ng và t l gi ng nh hư ng * T i ưu thành ph n dinh dư ng và i u ki n LBR t l ngh ch. i u này hoàn toàn phù h p v i th c t . Trong hai y u t nh Sau khi xác nh ư c hàm lư ng saccharose, nitơ, phosphor và lưu huỳnh hư ng t l thu n, m là y u t nh hư ng nhi u nh t n hàm lư ng beta- tâm l n lư t là 7000; 8000; 3000 và 700 (mg/Kg MT), chúng tôi th c hi n carotene c a n m men. Vì v y, tăng hàm lư ng beta-carotene c n tăng giá các thí nghi m v i các thông s theo ma tr n ã ho ch nh. Tính các h ng s tr m ban u nh m duy trì giá tr ho t aW thích h p cho n m men phát bj, h s h i qui tj và tra b ng tiêu chu n Student v i p = 0,05, lo i b các h s tri n. T phương trình h i qui nh n ư c ta có th xác nh ư c các thông s không có ý nghĩa, ki m tra s tương thích c a phương trình h i quy. K t qu i u ki n LBR n m men Rhodotorula theo lý thuy t và qua ó có th i u chúng tôi tìm ư c phương trình có d ng: khi n các thông s trên. Ti n hành t i ưu theo phương pháp tìm c c tr b ng Y1 = 194,06 +11,18 x2 + 12,30 x3 +17,25 x1 x2 -13,43 x3 x4 -18,11 x12 cách s d ng công c Optimizer c a ph n m m Modde 5.0., chúng tôi nh n Phương trình h i quy tìm ư c cho th y c 4 y u t saccharose (x1), nitơ ư c k t qu là: (x2), phosphor (x3), và lưu huỳnh (x4) u nh hư ng n quá trình sinh t ng Y2 max = 283,21 ppm beta-carotene (theo CK) h p beta-carotene c a n m men Rhodotorula. tìm hàm lư ng dư ng ch t V i các i u ki n nuôi c y t i ưu như sau: m = 65%; dày l p MT = 1,5cm; t l gi ng = 9x107 CFU/g MT. So sánh k t qu t i ưu giai o n này t i ưu c n b sung v i m c tiêu thu ư c hàm lư ng beta-carotene cao nh t, (Y2 max = 283,21 ppm) v i giai o n u khi ch t i ưu các y u t dinh dư ng chúng tôi ti n hành t i ưu theo phương pháp tìm c c tr . Dùng ph n m m (Y1 max = 238,29 ppm), k t qu cho th y hàm lư ng beta-carotene tăng lên Modde 5.0, công c Optimizer th c hiên t i ưu hóa, k t qu nh n ư c giá 18,85% so v i khi chưa ti n hành t i ưu các y u t i u ki n LBR. tr c a hàm m c tiêu y như sau:

CÓ THỂ BẠN MUỐN DOWNLOAD

 

Đồng bộ tài khoản